Advertisement
Research Article

A Novel Plasmid-Encoded Serotype Conversion Mechanism through Addition of Phosphoethanolamine to the O-Antigen of Shigella flexneri

  • Qiangzheng Sun equal contributor,

    equal contributor Contributed equally to this work with: Qiangzheng Sun, Yuriy A. Knirel, Ruiting Lan, Jianping Wang

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Yuriy A. Knirel equal contributor,

    equal contributor Contributed equally to this work with: Qiangzheng Sun, Yuriy A. Knirel, Ruiting Lan, Jianping Wang

    Affiliation: N. D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Moscow, Russian Federation

    X
  • Ruiting Lan equal contributor,

    equal contributor Contributed equally to this work with: Qiangzheng Sun, Yuriy A. Knirel, Ruiting Lan, Jianping Wang

    Affiliation: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, Australia

    X
  • Jianping Wang equal contributor,

    equal contributor Contributed equally to this work with: Qiangzheng Sun, Yuriy A. Knirel, Ruiting Lan, Jianping Wang

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Sof’ya N. Senchenkova,

    Affiliation: N. D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Moscow, Russian Federation

    X
  • Dong Jin,

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Alexander S. Shashkov,

    Affiliation: N. D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Moscow, Russian Federation

    X
  • Shengli Xia,

    Affiliation: Branch for Enteric Disease Control and Prevention, Institute for Infectious Disease Control and Prevention, Henan Center for Disease Control and Prevention, Zhengzhou, China

    X
  • Andrei V. Perepelov,

    Affiliation: N. D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Moscow, Russian Federation

    X
  • Qiang Chen,

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Yan Wang,

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Haiyin Wang,

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Jianguo Xu mail

    xujianguo@icdc.cn

    Affiliation: State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, China CDC, Changping, Beijing, China

    X
  • Published: September 26, 2012
  • DOI: 10.1371/journal.pone.0046095

Abstract

Shigella flexneri is the major pathogen causing bacillary dysentery in developing countries. S. flexneri is divided into at least 16 serotypes based on the combination of antigenic determinants present in the O-antigen. All the serotypes (except for serotype 6) share a basic O-unit containing one N-acetyl-d-glucosamine and three l-rhamnose residues, whereas differences between the serotypes are conferred by phage-encoded glucosylation and/or O-acetylation. Serotype Xv is a newly emerged and the most prevalent serotype in China, which can agglutinate with both MASF IV-1 and 7,8 monoclonal antibodies. The factor responsible for the presence of MASF IV-1 (E1037) epitope has not yet been identified. In this study, we analyzed the LPS structure of serotype Xv strains and found that the MASF IV-1 positive phenotype depends on an O-antigen modification with a phosphoethanolamine (PEtN) group attached at position 3 of one of the rhamnose residues. A plasmid carried gene, lpt-O (LPS phosphoethanolamine transferase for O–antigen), mediates the addition of PEtN for serotype Xv and other MASF IV-1 positive strains. These findings reveal a novel serotype conversion mechanism in S. flexneri and show the necessity of further extension of the serotype classification scheme recognizing the MASF IV-1 positive strains as distinctive subtypes.

Introduction

Shigella flexneri is the major pathogen causing bacillary dysentery in developing countries. It is estimated that Shigella is responsible for approximately 164.7 million shigellosis cases annually worldwide, resulting in 1,100,000 deaths, with the majority involving children under five years old [1].

S. flexneri is divided into various serotypes based on the combination of antigenic determinants present in the O-antigen of the cell envelope lipopolysaccharide (LPS). To date, at least 16 serotypes have been recognized [2], [3], [4], [5]. Except for serotype 6, all have the same basic repeating tetrasaccharide unit, comprised of →2)-α-L-RhapIII-(1→2)-α-L-RhapII-(1→3)-α-L-RhapI-(1→3)-β-D-GlcpNAc-(1→ [4]. The basic O-antigen structure is referred to as serotype Y characterized by a single group 3,4 antigenic determinant. The addition of glucosyl and/or O-acetyl residues to different sugars in the tetrasaccharide unit results in the type- (i.e. I, II, III, IV, V, IC) and group- (i.e. 3,4; 6; 7,8) specific antigenic determinants [3]. The O-acetyl on RhaI defines group 6 determinant in serotype 3a, 3b, 1b, and 4b strains [6], [7]. Determinants specific for type I, IC, II, IV, V and group 7,8 antigens are associated with glucosylation on various sugar residues in the tetrasaccharide unit. The genes responsible for the O-antigen glucosylation [gtrA, gtrB, and gtr (type)] have been identified [3], [8], [9], [10], [11]. They are arranged in a single operon known as the gtr cluster [12]. gtrA and gtrB are highly conserved and interchangeable, while gtr (type) is unique and encodes the glucosyltransferase responsible for the attaching of a glucosyl group to a specific sugar in the tetrasaccharide repeat unit of the O-antigen [3], [12]. The O-acetylation of RhaI depends on the presence of the oac gene for O-acetyl transferase [6], [7]. All the O-antigen modification genes known to date are encoded by seven temperate bacteriophages or prophages (SfI, SfIC, SfII, Sf6, SfIV, SfV and SfX), which are integrated into the conserved sites of the host S. flexneri genome [3], [6], [8], [9], [10], [11], [13], [14].

In 2001, a novel S. flexneri serotype called serotype Xv appeared in Henan province, China. In the following years (2002–2006), it replaced serotype 2a and became the most prevalent serotype in Henan province, accounting for 14%, 35%, 47%, 48%, and 27% of the isolations in the respective years [2]. Serotype Xv was also found to be the most prevalent serotype in Shanxi province in 2006 (67%) and 2007 (33%) and in Gansu, Anhui, and Shanghai in 2007 with 67%, 54%, and 35% of the isolations of S. flexneri, respectively [2]. Although it has declined since 2007, serotype Xv is still the predominant serotype in China (http://www.moh.gov.cn).

Since serotype Xv can agglutinate with both group antigen-specific monoclonal antibodies MASF IV-1 and 7,8, it was initially named as serotype 4X and then as 4c [15], [16]. Compared to typical serotype X, serotype Xv strains carry an additional new O-antigenic epitope MASF IV-1 (also called E1037, an antigenic determinant specific for MASF IV-1 antibody) [2]. Such antigenic determinant has also been reported to be presented on some S. flexneri serotypes 4a, Y and 6 strains [15], [17]. The genes responsible for the group 7,8 antigen have been identified on a SfX prophage integrated into the host genome [2]. However, the factor(s) responsible for the presence of MASF IV-1 or E1037 antigenic determinant in serotype Xv and other MASF IV-1 positive serotypes had not yet been identified.

In this study, we analyzed the O-antigen structure of serotype Xv strains and found a phosphoethanolamine (PEtN) residue attached at position 3 of RhaII, which is absent from the typical serotype X O-antigen. This modification was shown to confer the MASF IV-1 positive phenotype in serotype Xv strains. The gene named as lpt-O, encoding an LPS phosphoethanolamine transferase for O-antigen was identified to be responsible for carrying out the PEtN modification in serotype Xv and other MASF IV-1 positive strains and was found to be carried on a plasmid.

Materials and Methods

Ethics Statement

This study was reviewed and approved by the ethics committee of National Institute for Communicable Disease Control and Prevention, the Chinese CDC. S. flexneri strains were acquired with the written informed consent of the diarrhea patients and with the approval of the ethics committee of National Institute for Communicable Disease Control and Prevention, according to the medical research regulations of Ministry of Health (permit number 2007-17-3).

Bacterial Strains, Plasmid and Culturing Condition

Serotype Xv strains 2002017 [2] and 2003055 were used for LPS structure analysis. Serotype X strain 51580 (amps) and 4a strain NCTC 9725 (amps) were used as hosts for lpt-O gene expression. pMD20-T Vector (TaKaRa) was used for DNA sequencing and expression vector. E. coli JM109 was used for plasmid propagation. S. flexneri strains used for plasmid profiling and lpt-O gene detection analysis were isolated from diarrheal patients in China or purchased from National Collection of Type Cultures (NCTC), UK. Strains were grown in a 37°C incubator or orbital shaker in Luria-Bertani broth (LB) supplemented with ampicillin (100 µg ml−1) when appropriate.

Isolation of Lipopolysaccharides and Polysaccharides

LPS were isolated from dried bacterial cells by the phenol-water method [18]. The crude extract without separation of the layers was dialyzed against distilled water, nucleic acids and proteins were precipitated by adding aqueous 50% trichloroacetic acid at 4°C to reduce pH to 2, the supernatant was dialyzed against distilled water and freeze-dried to give purified LPS in yields of 5.6–7.6% of dried cells mass. Delipidation of the LPS was performed with aqueous 2% acetic acid (6 ml) at 100°C until precipitation of lipid A. The precipitate was removed by centrifugation (13,000×g, 20 min), and the supernatant was fractionated by gel-permeation chromatography on a column (56×2.6 cm) of Sephadex G-50 Superfine (Amersham Biosciences, Sweden) in 0.05 M pyridinium acetate buffer, pH 4.5, monitored with a differential refractometer (Knauer, Germany). High-molecular mass O-polysaccharides were obtained in yields of 27–44% of LPS mass.

NMR Spectroscopy

Samples were deuterium-exchanged by freeze-drying twice from 99.9% D2O and then examined as solutions in 99.95% D2O at 40°C. NMR spectra were recorded on an Avance II 600 spectrometer (Bruker, Germany) using internal sodium 3-(trimethylsilyl) propanoate-2,2,3,3-d4H 0) and acetone (δC 31.45) as references. Two-dimensional NMR spectra were obtained using standard Bruker software and parameters set as described [19]. TopSpin 2.1 program was used to acquire and process the NMR data.

Slide Agglutination Analysis

The serotypes of S. flexneri strains were determined by slide agglutination test using two serotyping kits specific for all S. flexneri type- and group-factor antigens: (i) a commercially available monovalent antisera kit (Denka Seiken, Japan) and (ii) monoclonal antibody reagents (Reagensia AB, Sweden), as described in the manufacturers’ protocols.

DNA Techniques

Chromosomal DNA was isolated from S. flexneri strains using DNA extraction Kit (Qiagen, Germany). Oligonucleotide primers lpt-O-1U: AAAAATACGCACCGTTCAGA (nt 1271–1290, complementary to pSFxv_2 sequence) and lpt-O-1L: AAAAGCACCGTCATCCACTA (nt 3305–3324) were designed for function analysis (Fig. 1A). Primer pair lpt-O-2U: ATCTAGTATTGTTGGCGTTA (nt 1721–1740, complementary to pSFxv_2 sequence) and lpt-O-2L: CCTTTTCTTGTGTTCTTATC (nt 2799–2818) were used for the lpt-O gene detection (Fig. 1A). Oligonucleotide primers were synthesized by Sangon Biotech (Shanghai). PCR amplifications were performed using TaKaRa PCR Amplification Kit (Takara, Japan). Reaction mixtures for each PCR consisted of 1× PCR buffer, 0.2 µM of each primer, 3 µl of template DNA, 2.5 U DNA polymerase and 0.4 mM deoxynucleoside triphosphates in a final reaction volume of 50 µl. Unless otherwise stated, PCR amplification was performed using a standard protocol with the following thermal cycling profile: 94°C for 5 min followed by 30 cycles of 94°C for 30 s, 55°C for 50 s, and 72°C for 2 min, and 72°C for 5 min, on a SensoQuest LabCycler (Germany).

thumbnail

Figure 1. Genomic structure and the presence of plasmid pSFxv_2 in serotype Xv and X strains.

A, genomic structure of plasmid pSFxv_2. ORFs were shown as thick arrows, and encoding regions were marked according to the genome annotation (accession No. CP001385). The specific lpt-O gene was marked in red color, and primers positions were indicated using thin arrows. B, plasmid profiles of serotype Xv strains 2002017, 2008129, 2008131, 05AH022 and 05AH027 (lanes 1–5, respectively) and X strains 06HN400, 05BJ002, 03HL001, 03HL020 and 2003055 (lanes 6–10, respectively) strains. Plasmid DNA was separated by electrophoresis with a Chef Mapper system (Bio-Rad) on a 1% SeaKem Gold agarose gel and visualized by EB staining. Plasmids isolated from strain 2002017 (lane 1) were used as control. Lambda DNA cleaved with HindIII (TaKaRa, Japan) was used as molecular mass markers. C, Southern hybridization detection of the lpt-O gene in serotype Xv strains. PCR product amplified from strain 2002017 using primer pair lpt-O-2 was prepared as probe.

doi:10.1371/journal.pone.0046095.g001

PCR products using primers lpt-O-1were purified and cloned into pMD20-T T-A cloning vector (TaKaRa, Japan) to generate the lpt-O expression vector pSQZ. The pSQZ was further transformed into ampicillin sensitive strains 51580 (serotype X) and NCTC 9725 (serotype 4a).

Plasmid Profiling and Southern Hybridization Analyses

A plasmid purification kit (Qiagen, Germany) was used to isolate the plasmids in accordance with the manufacturer’s recommendations. Plasmid DNA was separated by electrophoresis with a Chef Mapper system (Bio-Rad) on a 1% SeaKem Gold agarose gel and visualized by ethidium bromide staining. Plasmids isolated from strain 2002017 were used as the positive control. Lambda DNA cleaved with HindIII (TaKaRa, Japan) was used as electrophoresis markers.

The plasmid DNA separated on Gold agarose gel were further transferred onto a nylon membrane (Amersham) using a Vacuum Blotter (Bio-Rad). Southern hybridization was performed using an ECL™ Direct Nucleic Acid Labelling and Detection System (Amersham) as recommended by the manufacturer. DNA product amplified from strain 2002017 using primer pair lpt-O-2 was prepared for a biotin-labeling DNA probe.

Results

Identification of a Novel O-antigen Modification that gives Rise to the MASF IV-1 Reactivity in Serotype Xv Strains

To identify the MASF IV-1 determinant in serotype Xv strains, the isolated O-polysaccharide of serotype Xv strain 2002017 was analyzed by NMR techniques. The 1H NMR and 13C NMR spectra of the O-polysaccharide demonstrated a non-O-acetylated pentasaccharide O-unit containing one residue each of glucose (Glc) and N-acetylglucosamine (GlcNAc) and three residues of Rha (Fig. 2B). However, comparison of the 1H NMR and 13C NMR spectra of the serotype X O-polysaccharide (Fig. 2A) with those of serotype Xv showed additional signals for a PEtN group at δH 3.29 and 4.15, δC 41.4 and 63.2 in the latter (Fig. 2B). There are also other differences in the positions of some signals of RhaII (RII) as well as the intensities of the peaks for RhaI 1 (RI 1), RhaIII 1 (RIII 1), and RhaII 1 (RII 1) between X and Xv (Fig. 2), particularly because the peaks for RI 1 and RIII 1 coincided in the spectrum of X, whereas the peaks for RII 1 and RIII 1 coincided in the spectrum of Xv.

thumbnail

Figure 2. 13C NMR spectra of the O-polysaccharides from S. flexneri serotype X (A), serotype Xv (B) and transformant 51580_Xv (C).

Numbers refer to protons in sugar residues denoted as follows: G, Glc; GN, GlcNAc; RI, RhaI; RII, RhaII; RIII, RhaIII. In the spectrum of the transformant 51580_Xv O-polysaccharide, the annotations for the signals of the minor bisphosphorylated O-unit are italicized. The most important difference between X and Xv is the presence in the latter of peaks for ethanolamine, which are annotated as EtN 1 and EtN 2. The different positions of the signals for C3 of RhaII (non-phosphorylated in X and phosphorylated in Xv) are shown by a dotted line.

doi:10.1371/journal.pone.0046095.g002

The NMR spectra of the serotype Xv O-polysaccharide were assigned and analyzed using two-dimensional 1H,1H and 1H,13C NMR techniques (Table 1) [20]. Significant downfield displacements due to phosphorylation were observed for the signals of H3 and C3 of RhaII to δH 4.35 and δC 76.5 as compared with their positions at δH 3.92 and δC 71.1, respectively, in the serotype X O-polysaccharide. A two-dimensional 1H,31P heteronuclear multiple-bond correlation (HMBC) experiment, which correlates by spin coupling phosphorus and protons separated by three bonds, was used to demonstrate independently the site of phosphorylation in the serotype Xv O-polysaccharide. The HMBC spectrum of the O-polysaccharide showed correlations of the phosphate group with CH2O protons of the PEtN group at −0.24/4.15 and with H3 of RhaII at −0.24/4.35 (Fig. 3A), respectively. Therefore, PEtN is attached at position 3 of RhaII, and the O-polysaccharide of S. flexneri serotype Xv has the structure shown in Figure 4B. It differs from the O-polysaccharide of S. flexneri serotype X [21] (Fig. 4A) in phosphorylation of RhaII with PEtN only.

thumbnail

Table 1. 1H and 13C NMR chemical shifts (δ, ppm) of S. flexneri O-polysaccharides.

doi:10.1371/journal.pone.0046095.t001
thumbnail

Figure 3. Parts of two-dimensional 1H, 31P HMBC spectra of the O-polysaccharides from S. flexneri serotype Xv (A) and transformant 51580_Xv (B) 4av (C) and transformant NCTC 9725_4av (D).

The corresponding parts of the 1H NMR and 31P NMR spectra are displayed along the horizontal and vertical axes, respectively. RII and RIII indicate RhaII and RhaIII, respectively. The annotations for the cross-peaks of the minor bisphosphorylated O-unit are italicized.

doi:10.1371/journal.pone.0046095.g003

The O-antigen of another serotype Xv strain 2003055 was also analyzed and found to have the same structure as that of 2002017, suggesting that the PEtN modification is common among serotype Xv strains and responsible for the MASF IV-1 positive phenotype in serotype Xv.

A Plasmid Borne Gene (lpt-O) is Required for MASF IV-1 Reactivity in Serotype Xv Strains and Conversion of Serotype X to Serotype Xv

Addition of PEtN to the inner core lipopolysaccharide (LPS) or lipooligosaccharide (LOS) has been reported in a number of bacterial species [22], [23], [24], [25], [26], [27] and is carried out by various PEtN transferases. The known genes involved include lpt3 (NMB2012), lptA (NMB1638), lpt6 (NMA0408) (all Neisseria meningitides), cptA (STM4118), pmrC (ΣΤΜ429) (both Salmonella Typhimurium) and eptB (ZP_04872785) (Escherichia coli) [22], [23], [25]. We used these gene sequences to search the S. flexneri 2002017 genome including chromosome and plasmid sequences by tBLASTn and BLASTP for homologous proteins. Seven homologous proteins with 22–99% identity and 39–99% similarity were identified, including 6 from the chromosome and 1 from one of the plasmids, pSFxv_2. The 7 homologs in the 2002017 genome were further compared with other sequenced S. flexneri genomes, Sf301, 2457t and 8401, which are all MASF IV-1 negative phenotype strains. All chromosomal homologs were found present in these 3 genomes, whereas the plasmid borne homolog (SFxv_5135) was unique, suggesting that SFxv_5135 may be responsible for the PEtN modification in serotype Xv strains.

To confirm this hypothesis, we first performed PCR assay with 9 more serotype Xv strains (2008129, 2008131, 05AH016, 05AH022, 05AH027, 05AH030, 06HN005, 06HN019 and 2008164 ) and 5 serotype X strains (06HN400, 05BJ002, 03HL001, 03HL020 and 2003055) to determine whether the lpt-O gene is carried exclusively by serotype Xv strains. The expected fragment of 1,098 bp can only be obtained from serotype Xv strains, but not from serotype X strains. Sequencing of the PCR products from these 9 serotype Xv strains showed that all were identical to that of 2002017.

Plasmid pSFXv_2 is a double-stranded circular plasmid of 6,850 bp in length. BLAST search revealed no homology with any plasmids or bacterial genomes in the NCBI database, except for 2 regions (4186–5525 and 6058–6847) showing high similarity (96% and 78% identity, respectively) to those of pJHCMW1, a multiresistance plasmid from Klebsiella pneumoniae [28]. There are 11 orfs coding for a mobilization protein, a replication initiation protein, a lipoprotein and a PEtN transferase discovered in this study as well as 7 proteins of unknown function (Fig. 1A).

To determine whether the lpt-O carrying pSFxv_2 plasmid is present in all serotype Xv strains, we analyzed the plasmid profiles of 59 serotype Xv and 40 serotype X strains by electrophoresis with 10 plasmid profiles (serotype Xv strains 2002017, 2008129, 2008131, 05AH022 and 05AH027, and serotype X strains 06HN400, 05BJ002, 03HL001, 03HL020 and 2003055 ) shown in Figure 1B. All strains presented a plasmid profile with 3–7 plasmids, from 2 kb to 10 kb. Note that plasmids larger than 20 kb were not resolvable on this gel and were not included. Compared to serotype X strains, all Xv strains had a 10-kb plasmid band (Fig. 1B). Southern hybridization using biotin-labeled lpt-O as a probe confirmed that the 10-kb plasmid band corresponds to the lpt-O-carrying pSFxv_2 of 6.85 kb as only Xv strains showed a positive signal (Fig. 1C). The 10-kb plasmid band of 2002017 was extracted from gel and used as template for overlapping PCR covering the circular plasmid. Results indicated that the plasmid sequence is identical to that of pSFxv_2 (unpublished data). The observation that the plasmid appeared larger in size on the gel than its actual size of 6.85 kb may be due to the migration difference of covalently closed circular plasmid DNA and the molecular marker of linear DNA. The data obtained suggest that all serotype Xv strains carry a pSFxv_2-like plasmid, which mediates the addition of PEtN to the O-antigen giving rise to the MASF IV-1 positive phenotype.

To elucidate the function of the lpt-O gene, we then cloned the entire lpt-O gene of 1,521 bp, together with 533 bp sequences up and downstream to cover its promoter and terminator sequences, from strain 2002017 into plasmid pMD20-T (pSQZ) and transformed it into serotype X strain 51580 (amps). Slide agglutination assay indicated that the host strain was converted to serotype Xv, with the transformant (51580_Xv) serologically reacting with both MASF IV-1 and MASF 7,8 monoclonal antibodies (Table 2). Similar to that of serotype Xv strains, the transformant also reacted with monovalent antisera IV of Denka Seiken (Table 2). The serological features of 51580_Xv were identical to that of the control strain 2002017 (Table 2).

thumbnail

Table 2. Serological identification of transformants using the monoclonal antibodies of MASF scheme and monovalent antisera of Seiken by slide agglutination.

doi:10.1371/journal.pone.0046095.t002

A previous study has identified that serotype 4a strain G1668 contains a PEtN residue on RhaIII at position 3 [29]. We confirmed serologically that G1668 is MASF IV-1 positive and thus is a serotype 4a variant hereafter called 4av. To examine whether the same gene can convert serotype 4a into serotype 4av, a serotype 4a strain NCTC 9725 (amps) was transformed with pSQZ. The transformant (NCTC 9725_4av) showed the acquired MASF IV-1 positive phenotype with the same serological feature as that of control serotype 4av strain G1668 (Table 2).

Motif analysis revealed that the lpt-O encoding protein contains a sulfatase domain on its carboxyl terminal and thus belongs to the sultafase superfamily. At protein level, Lpt-O shows significant similarity with a sulfatase protein (71% identity and 85% similarity) of Enterobacteriaceae bacterium 254FAA (ZP_07953373) and is moderately homologous to sulfatase proteins (31–38% identity, and 51–56% similarity) in E. coli, Erwinia billingiae, Pantoea vagans, Stenotrophomonas maltophilia, Eubacterium cellulosolvens and Afipia sp. The sulfatase domain is also present in the other known PEtN transferases (Lpt3, Lpt6, LptA, CptA, EptC, EptB, PmrC, Hp0022) [22], [23], [25], [26], [27], [30], [31], [32] and is likely to be involved in catalyzing the transfer of PEtN moiety to a sugar residue.

Gain of the lpt-O Gene and MASF IV-1 Reactivity was Concomitant with Gain of the O-antigen Modification with PEtN

To confirm that the gain of the lpt-O gene and MASF IV-1 reactivity by serotype X strains correlates with the gain of PEtN, the O-polysaccharide of the transformant 51580_Xv was analyzed by NMR spectroscopy. The 1H NMR and 13C NMR (Fig. 2C) spectra of the 51580_Xv O-polysaccharide showed a structural heterogeneity. Analysis of the spectra using two-dimensional NMR techniques revealed the occurrence of two types of repeats in the ratio of ~1.5:1: the major O-unit typical of the Xv O-polysaccharide (Fig. 4B) and a minor bisphosphorylated non-glucosylated O-unit. Particularly, in addition to the major signals for the phosphorylated RhaII residue (δH-3 4.35 and δC-3 76.5), there were signals for the phosphorylated RhaIII residue (δH-3 4.25 and δC-3 76.2). Accordingly, in the 1H,31P HMBC spectrum (Fig. 3B), there were one major P/RhaII cross-peak at δ −0.24/4.35 for the monophosphorylated O-unit and two minor P/RhaII and P/RhaIII cross-peaks at δ −0.16/4.35 and −0.24/4.25, respectively, for the bisphosphorylated O-unit. A more careful analysis of the NMR spectra, including the 1H,31P HMBC spectrum, indicated the presence of the bisphosphorylated O-units in the wild-type Xv O-polysaccharide too but their content is significantly lower (~15% of the total O-units versus ~40% in the transformant 51580_Xv O-polysaccharide) (Fig. 3A). Therefore, in serotype Xv strains phosphorylation interferes with glycosylation on RhaIII giving rise to the O-units in which the lateral Glc residue is replaced with the second PEtN group. The bisphosphorylated O-units of this type are characteristic for some strains of serotype Y that may be called Yv (see below) (Fig. 4C) (authors’ unpublished data), which seems to be the same as reported serotype 4 s [33].

thumbnail

Figure 4. Structures of the O-polysaccharides from S. flexneri serotypes X (A)

[21], Xv (B) (this study), Yv (C) (this study), and 4 av (D) [29].

doi:10.1371/journal.pone.0046095.g004

NMR spectroscopic analysis showed that the major O-unit of the NCTC 9725_4 av transformant (~50% of the total O-units) has the same structure as that of wild-type 4 av strains reported earlier [29] (Fig. 4D). Minor O-unit variants (each of ~25%) lack lateral Glc and have either one PEtN group on RhaII or two PEtN groups on both RhaII and RhaIII (for the 1H,31P HMBC spectrum see Fig. 3D). Again, a more careful analysis of the wild-type 4 av polysaccharide revealed the presence of minor proportion (~10%) of the O-units with PEtN groups on RhaII (for the 1H,31P HMBC spectrum of the O-polysaccharide from strain G1668 see Fig. 3C). Therefore, the lpt-O gene is required and sufficient for the addition of PEtN residue to the O-antigen in serotype 4 av strains too. These data also suggest that Lpt-O can mediate the attachment of PEtN to either RhaII or RhaIII.

The Functional lpt-O Gene is Carried Only by MASF IV-1 Positive Phenotype Strains

To determine whether the lpt-O gene is more widely present in S. flexneri, another expanded PCR screening of 310 strains of 15 serotypes (Table 3) was performed using primer pair lpt-O-2. These strains were randomly selected from our collection, and their serotype characteristics have been determined earlier. A strict correlation was observed between the presence of functional lpt-O gene and MASF IV-1 positive reactivity. As expected, PCR products were found in all 59 serotype Xv strains tested. The expected PCR product (1,098 bp) was also obtained from 19 serotype Yv, 3 serotype 4 av (2002091, NCTC 8296 and G1668), and surprisingly, 4 serotype X (HN059, HN060, HN066 and HN378) and one serotype 4b (NCTC 9726) strains. Although the lpt-O gene can be amplified from these 5 strains, they all did not react with monoclonal antibody MASF IV-1. Plasmid profile analysis indicated that the pSFxv_2- like plasmid is present in these 5 strains. Sequencing of the lpt-O gene from these 5 strains revealed that all had a single base deletion at the position of 295, which resulted in a stop codon at amino acid 99, and abolishes the function of the gene without the presumed sulfatase domain (from aa165 to aa465) of Lpt-O. We cloned the defective gene and showed that it cannot convert serotype X strain 51580 to serotype Xv, confirming that the single base deletion inactivated the gene.

thumbnail

Table 3. Distribution of the lpt-O gene in S. flexneri strains detected by PCR.

doi:10.1371/journal.pone.0046095.t003

The lpt-O positive serotype Yv strains are serologically different from typical serotype Y with additional MASF IV-1 and monovalent antisera IV reactivity phenotype. Analysis of the O-antigen structure of a serotype Yv strain, HN006, demonstrated a PEtN modification at position 3 of both RhaII and RhaIII (Fig. 4C) (details of structural studies on the Yv O-antigen will be reported elsewhere). The 3 lpt-O positive genotype 4 av strains differ from typical serotype 4a strains only in the MASF IV-1 positive phenotype (Table 2). The lpt-O gene in these 3 serotype 4 av strains were sequenced and compared to that of 2002017. The lpt-O genes among the 3 serotype 4 av strains are identical, and they are highly homologous to that of 2002017 (99.3%), with 11 base changes (243, A→G; 310, G→A; 379, G→A; 687, T→G; 691, T→C; 728, C→T; 772, C→T; 836, C→A; 1144, G→A; 1449, G→A; 1481, T→C), which resulted in the substitution of 7 amino acids of Lpt-O (104, V→I; 127, E→K; 231, Y→H; 243, A→V; 279, A→D; 382, V→I; 494, I→T). It is not certain if these changes would have an effect on the specificity of PEtN addition to Rha. However, the observation that cloned lpt-O from serotype Xv strain 2002017 can mediate the phosphorylation modification on both RhaII and RhaIII of transformant NCTC 9725_4 av and 036_Yv (unpublished data) indicates the common function of the lpt-O homologues.

Discussion

The O-antigen structure and its diversity of S. flexneri are well studied. Until recently, glucosyl and O-acetyl groups have been the only two known residues attached to S. flexneri O-antigen backbone giving rise to various serotypes. In 2009, Perepelov et al [29] had reported the ethanolamine phosphate (EtnP) attachment at position 3 of RhaIII of the O-antigen in two serotype 4a strains G1668 and 1359. However, the mechanism of PEtN modification has not been elucidated. In this study, the novel O-antigen modification, πηοσπηορψλατιον ωιτη ΠΕτΝ, was identified in serotype Xv and some other serotypes. PEtN modifications have been reported in other bacteria, including N.meningitidis [27], Haemophilus influenzae [34], S. typhimurium [23], E. coli [31], Pasteurella multocida [35] and Campylobacter jejuni [32]. However, the PEtN modification in these cases occurs in the LPS or LOS core and does not involve in serotype conversion except in P. multocida [35]. Our study revealed other serotypes of S. flexneri modified by PEtN through PCR screening, and potentially there are many variants of the currently known serotypes due to PEtN modification. As reported previously [2], serotype Xv emerged as a new serotype and rapidly became the predominant serotype in China to cause a large number of shigellosis cases, the other variants also have the potential to flourish and change the dynamics of S. flexneri epidemics. The elucidation of this new O-antigen modification mechanism provides avenue for further study of S. flexneri serotype diversity and epidemiology.

The presence and location of non-carbohydrate substituents in LPS, such as PEtN, are critical for the immune recognition of LPS by antibodies in some bacterial species [27], [35]. The PEtN-3 constituent on the β-chain heptose (HepII) of the inner core LPS of N. meningitides is the target epitope of protective antibody mAb B5+ [27]. In P. multocida, the serological classification of strains into serotypes 2 and 5 is dependent on the presence or absence of PEtN on Hep II of LPS [35]. In this study, the MASF IV-1 positive reactivity was found to be dependent on the PEtN modification of the O-antigen, which confers the specific MASF IV-1 or E1037 antigen on the host. Since human immune response to S. flexneri infection is serotype specific with protection against further infection by the same serotype only [36], the presence of a new surface epitope in S. flexneri would expect to confer the bacterium an adaptive advantage to evade human immune killing. This may account for the emergence of serotype Xv in China, which appeared in one province initially and expand to most provinces of China during a short period of time, surpassing serotype 2a as the predominant serotype [2]. Apart from the multidrug resistance of the new serotype [2], the immune evasion offered by the new PEtN modification may also play an important role in the spread of the pathogen.

In this study, the lpt-O gene required for the PEtN addition was also identified. Its causal role is supported by the following evidences: 1) the protein encoded by the lpt-O gene is homologous to other PEtN transferases; 2) the cloned lpt-O gene can transform serotype X to serotype Xv and serotype 4a to serotype 4 av; 3) the PEtN modification correlates strictly with the presence of the functional lpt-O gene; 4) naturally occurring mutation (one base deletion) abolishes the function of the lpt-O gene without the presumed sulfatase domain and lost the reactivity with MASF IV-1 antibody. Future studies are necessary to characterize the biochemical process of the PEtN modification.

The known O-antigen modifications through glucosylation or O-acetylation in S. flexneri are mediated by serotype-converting bacteriophages or prophages with 7 identified up to date [3], [6], [8], [9], . In contrast, our study demonstrated a plasmid-encoded serotype conversion mechanism, which has not been reported in S. flexneri earlier. This finding changed the landscape of S. flexneri serotype diversity and serotype conversion. As an easily transferable factor, the lpt-O carrying plasmid can spread among different stains and mediate the serotype conversion. Serotype Xv strains are clearly originated from serotype X strains by gaining a lpt-O carrying plasmid since previous PFGE analysis showed that serotype Xv strains were grouped together with serotype X, and many serotype Xv strains shared the same PFGE profiles as serotype X strains [2].

In conclusion, the chemistry and genetics of a new O-antigen modification in S. flexneri serotype Xv have been elucidated. Attachment of a PEtN group to Rha residues gives rise to the MASF IV-1 positive phenotype in this and several other serotypes. The lpt-O gene, required for PEtN addition is carried by a pSFxv_2 like plasmid in all MASF IV-1 positive phenotype strains. This novel mechanism of modification has profound implications in S. flexneri epidemiology as it may offer a significant advantage to the bacterium which is demonstrated by the prevalence of serotype Xv in China. Additionally, these findings, together with published data [2], [15], [17], [33], show a necessity of further extension of classification scheme for S. flexneri by adding MASF IV-1 positive strains as new subtypes of serotypes 4, X and Y.

Author Contributions

Conceived and designed the experiments: QS RL JX YAK. Performed the experiments: QS YAK JW SNS DJ ASS SX AVP QC YW HW. Analyzed the data: RL QS YAK JX. Wrote the paper: QS YAK RL JX.

References

  1. 1. Kotloff KL, Winickoff JP, Ivanoff B, Clemens JD, Swerdlow DL, et al. (1999) Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ 77: 651–666.
  2. 2. Ye C, Lan R, Xia S, Zhang J, Sun Q, et al. (2010) Emergence of a new multidrug-resistant serotype X variant in an epidemic clone of Shigella flexneri. J Clin Microbiol 48: 419–426. doi: 10.1128/JCM.00614-09
  3. 3. Stagg RM, Tang SS, Carlin NI, Talukder KA, Cam PD, et al. (2009) A novel glucosyltransferase involved in O-antigen modification of Shigella flexneri serotype 1c. J Bacteriol 191: 6612–6617. doi: 10.1128/JB.00628-09
  4. 4. Simmons DA, Romanowska E (1987) Structure and biology of Shigella flexneri O antigens. J Med Microbiol 23: 289–302. doi: 10.1099/00222615-23-4-289
  5. 5. Sun Q, Lan R, Wang Y, Wang J, Luo X, et al. (2011) Genesis of a novel Shigella flexneri serotype by sequential infection of serotype-converting bacteriophages SfX and SfI. BMC Microbiol 11: 269. doi: 10.1186/1471-2180-11-269
  6. 6. Clark CA, Beltrame J, Manning PA (1991) The oac gene encoding a lipopolysaccharide O-antigen acetylase maps adjacent to the integrase-encoding gene on the genome of Shigella flexneri bacteriophage Sf6. Gene 107: 43–52. doi: 10.1016/0378-1119(91)90295-M
  7. 7. Verma NK, Brandt JM, Verma DJ, Lindberg AA (1991) Molecular characterization of the O-acetyl transferase gene of converting bacteriophage SF6 that adds group antigen 6 to Shigella flexneri. Mol Microbiol 5: 71–75. doi: 10.1111/j.1365-2958.1991.tb01827.x
  8. 8. Adams MM, Allison GE, Verma NK (2001) Type IV O antigen modification genes in the genome of Shigella flexneri NCTC 8296. Microbiology 147: 851–860.
  9. 9. Adhikari P, Allison G, Whittle B, Verma NK (1999) Serotype 1a O-antigen modification: molecular characterization of the genes involved and their novel organization in the Shigella flexneri chromosome. J Bacteriol 181: 4711–4718.
  10. 10. Guan S, Bastin DA, Verma NK (1999) Functional analysis of the O antigen glucosylation gene cluster of Shigella flexneri bacteriophage SfX. Microbiology 145 1263–1273. doi: 10.1099/13500872-145-5-1263
  11. 11. Mavris M, Manning PA, Morona R (1997) Mechanism of bacteriophage SfII-mediated serotype conversion in Shigella flexneri. Mol Microbiol 26: 939–950. doi: 10.1046/j.1365-2958.1997.6301997.x
  12. 12. Allison GE, Verma NK (2000) Serotype-converting bacteriophages and O-antigen modification in Shigella flexneri. Trends Microbiol 8: 17–23. doi: 10.1016/S0966-842X(99)01646-7
  13. 13. Allison GE, Angeles D, Tran-Dinh N, Verma NK (2002) Complete genomic sequence of SfV, a serotype-converting temperate bacteriophage of Shigella flexneri. J Bacteriol 184: 1974–1987. doi: 10.1128/JB.184.7.1974-1987.2002
  14. 14. Casjens S, Winn-Stapley DA, Gilcrease EB, Morona R, Kuhlewein C, et al. (2004) The chromosome of Shigella flexneri bacteriophage Sf6: complete nucleotide sequence, genetic mosaicism, and DNA packaging. J Mol Biol 339: 379–394. doi: 10.1016/j.jmb.2004.03.068
  15. 15. Carlin NI, Lindberg AA (1987) Monoclonal antibodies specific for Shigella flexneri lipopolysaccharides: clones binding to type IV, V, and VI antigens, group 3,4 antigen, and an epitope common to all Shigella flexneri and Shigella dysenteriae type 1 stains. Infect Immun 55: 1412–1420.
  16. 16. Pryamukhina NS, Khomenko NA (1988) Suggestion to supplement Shigella flexneri classification scheme with the subserovar Shigella flexneri 4c: phenotypic characteristics of strains. J Clin Microbiol 26: 1147–1149.
  17. 17. Carlin NI, Rahman M, Sack DA, Zaman A, Kay B, et al. (1989) Use of monoclonal antibodies to type Shigella flexneri in Bangladesh. J Clin Microbiol 27: 1163–1166.
  18. 18. Westphal O, Jann K (1965) Bacterial lipopolysaccharides. Extraction with phenol-water and further applications of the procedure. Methods Carbohydr Chem 5: 8.
  19. 19. Hanniffy OM, Shashkov AS, Senchenkova SN, Tomshich SV, Komandrova NA, et al. (1998) Structure of a highly acidic O-specific polysaccharide of lipopolysaccharide of Pseudoalteromonas haloplanktis KMM 223 (44–1) containing L-iduronic acid and D-QuiNHb4NHb. Carbohydr Res 307: 291–298. doi: 10.1016/S0008-6215(97)10108-2
  20. 20. Duus J, Gotfredsen CH, Bock K (2000) Carbohydrate structural determination by NMR spectroscopy: modern methods and limitations. Chem Rev 100: 4589–4614. doi: 10.1021/cr990302n
  21. 21. Kenne L, Lindberg B, Petersson K, Katzenellenbogen E, Romanowska E (1977) Structural studies of the Shigella flexneri variant X, type 5 a and type 5 b O-antigens. Eur J Biochem 76: 327–330. doi: 10.1111/j.1432-1033.1977.tb11599.x
  22. 22. Reynolds CM, Kalb SR, Cotter RJ, Raetz CR (2005) A phosphoethanolamine transferase specific for the outer 3-deoxy-D-manno-octulosonic acid residue of Escherichia coli lipopolysaccharide. Identification of the eptB gene and Ca2+ hypersensitivity of an eptB deletion mutant. J Biol Chem 280: 21202–21211. doi: 10.1074/jbc.M500964200
  23. 23. Tamayo R, Choudhury B, Septer A, Merighi M, Carlson R, et al. (2005) Identification of cptA, a PmrA-regulated locus required for phosphoethanolamine modification of the Salmonella enterica serovar typhimurium lipopolysaccharide core. J Bacteriol 187: 3391–3399. doi: 10.1128/JB.187.10.3391-3399.2005
  24. 24. Tamayo R, Prouty AM, Gunn JS (2005) Identification and functional analysis of Salmonella enterica serovar Typhimurium PmrA-regulated genes. FEMS Immunol Med Microbiol 43: 249–258. doi: 10.1016/j.femsim.2004.08.007
  25. 25. Wenzel CQ, St Michael F, Stupak J, Li J, Cox AD, et al. (2009) Functional characterization of Lpt3 and Lpt6, the inner-core lipooligosaccharide phosphoethanolamine transferases from Neisseria meningitidis. J Bacteriol 192: 208–216. doi: 10.1128/JB.00558-09
  26. 26. Wright JC, Hood DW, Randle GA, Makepeace K, Cox AD, et al. (2004) lpt6, a gene required for addition of phosphoethanolamine to inner-core lipopolysaccharide of Neisseria meningitidis and Haemophilus influenzae. J Bacteriol 186: 6970–6982. doi: 10.1128/JB.186.20.6970-6982.2004
  27. 27. Mackinnon FG, Cox AD, Plested JS, Tang CM, Makepeace K, et al. (2002) Identification of a gene (lpt-3) required for the addition of phosphoethanolamine to the lipopolysaccharide inner core of Neisseria meningitidis and its role in mediating susceptibility to bactericidal killing and opsonophagocytosis. Mol Microbiol 43: 931–943. doi: 10.1046/j.1365-2958.2002.02754.x
  28. 28. Sarno R, McGillivary G, Sherratt DJ, Actis LA, Tolmasky ME (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother 46: 3422–3427. doi: 10.1128/AAC.46.11.3422-3427.2002
  29. 29. Perepelov AV, L’Vov V L, Liu B, Senchenkova SN, Shekht ME, et al. (2009) A new ethanolamine phosphate-containing variant of the O-antigen of Shigella flexneri type 4a. Carbohydr Res 344: 1588–1591. doi: 10.1016/j.carres.2009.03.022
  30. 30. Tran AX, Karbarz MJ, Wang X, Raetz CR, McGrath SC, et al. (2004) Periplasmic cleavage and modification of the 1-phosphate group of Helicobacter pylori lipid A. J Biol Chem. 279: 55780–55791. doi: 10.1074/jbc.m406480200
  31. 31. Kanipes MI, Lin S, Cotter RJ, Raetz CR (2001) Ca2+-induced phosphoethanolamine transfer to the outer 3-deoxy-D-manno-octulosonic acid moiety of Escherichia coli lipopolysaccharide. A novel membrane enzyme dependent upon phosphatidylethanolamine. J Biol Chem 276: 1156–1163. doi: 10.1074/jbc.M009019200
  32. 32. Cullen TW, Madsen JA, Ivanov PL, Brodbelt JS, Trent MS (2011) Characterization of unique modification of flagellar rod protein FlgG by Campylobacter jejuni lipid A phosphoethanolamine transferase, linking bacterial locomotion and antimicrobial peptide resistance. J Biol Chem 287: 3326–3336. doi: 10.1074/jbc.M111.321737
  33. 33. Qiu S, Wang Z, Chen C, Liu N, Jia L, et al. (2011) Emergence of a novel Shigella flexneri serotype 4 s strain that evolved from a serotype X variant in China. J Clin Microbiol 49: 1148–1150. doi: 10.1128/JCM.01946-10
  34. 34. Schweda EK, Hegedus OE, Borrelli S, Lindberg AA, Weiser JN, et al. (1993) Structural studies of the saccharide part of the cell envelope lipopolysaccharide from Haemophilus influenzae strain AH1–3 (lic3+). Carbohydr Res 246: 319–330. doi: 10.1016/0008-6215(93)84043-6
  35. 35. St Michael F, Harper M, Parnas H, John M, Stupak J, et al. (2009) Structural and genetic basis for the serological differentiation of Pasteurella multocida Heddleston serotypes 2 and 5. J Bacteriol 191: 6950–6959. doi: 10.1128/JB.00787-09
  36. 36. Phalipon A, Kaufmann M, Michetti P, Cavaillon JM, Huerre M, et al. (1995) Monoclonal immunoglobulin A antibody directed against serotype-specific epitope of Shigella flexneri lipopolysaccharide protects against murine experimental shigellosis. J Exp Med 182: 769–778. doi: 10.1084/jem.182.3.769