Figures
Abstract
Herein, we report the biochemical and functional characterization of a novel Ca2+-activated nucleoside diphosphatase (apyrase), CApy, of the intracellular gut pathogen Cryptosporidium. The purified recombinant CApy protein displayed activity, substrate specificity and calcium dependency strikingly similar to the previously described human apyrase, SCAN-1 (soluble calcium-activated nucleotidase 1). CApy was found to be expressed in both Cryptosporidium parvum oocysts and sporozoites, and displayed a polar localization in the latter, suggesting a possible co-localization with the apical complex of the parasite. In vitro binding experiments revealed that CApy interacts with the host cell in a dose-dependent fashion, implying the presence of an interacting partner on the surface of the host cell. Antibodies directed against CApy block Cryptosporidium parvum sporozoite invasion of HCT-8 cells, suggesting that CApy may play an active role during the early stages of parasite invasion. Sequence analyses revealed that the capy gene shares a high degree of homology with apyrases identified in other organisms, including parasites, insects and humans. Phylogenetic analysis argues that the capy gene is most likely an ancestral feature that has been lost from most apicomplexan genomes except Cryptosporidium, Neospora and Toxoplasma.
Citation: Manque PA, Woehlbier U, Lara AM, Tenjo F, Alves JM, Buck GA (2012) Identification and Characterization of a Novel Calcium-Activated Apyrase from Cryptosporidium Parasites and Its Potential Role in Pathogenesis. PLoS ONE 7(2): e31030. https://doi.org/10.1371/journal.pone.0031030
Editor: Gordon Langsley, Institut National de la Santé et de la Recherche Médicale - Institut Cochin, France
Received: October 3, 2011; Accepted: December 30, 2011; Published: February 7, 2012
Copyright: © 2012 Manque et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grant U54 AI057168 from the National Institute of Allergy and Infectious Diseases of the National Institutes of Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Cryptosporidiosis, caused by the obligate intracellular protozoan Cryptosporidium, is a ubiquitous infectious disease that can cause a persistent and chronic diarrhea [1]. Most Cryptosporidium infections in humans are self-limiting, but severe disease may occur in immunodeficient hosts, in particular in AIDS patients [2]. Although Cryptosporidium hominis (C. hominis) is the most prevalent cause of endemic disease in humans, Cryptosporidium parvum (C. parvum) also can cause serious outbreaks when humans are exposed to contaminated water supplies or are otherwise in close contact with the non-human carriers of this parasite. Effective vaccines and safe non-toxic anti-cryptosporidial drugs are not yet available. The cellular and molecular mechanisms of infection are poorly understood, mostly due to difficulties in propagation of the parasite in culture.
A Cryptosporidium infection is initiated when the host ingests oocysts from which invasive sporozoites emerge and infect enterocytes [3]. Clearly, interactions between macromolecules of the parasites and host cells are of critical importance for the establishment of the infection and consequent survival of the parasite. Thus, pathogenic factors such as parasite proteins or macromolecules responsible for attachment or invasion, or factors that block host cell responses, are ideal targets for drug and vaccine development.
Nucleotide mediated signaling plays a central role in maintaining homeostasis in many tissues. Thus, ecto-nucleotidases are major players in the regulation of purinergic signaling, modulate inflammation and immune responses in Langerhans cells [4], and lead to cardioprotection and protective responses to hypoxia/ischemia in mice [5], [6]. As signaling molecules, extracellular nucleotides also serve as danger signals induced by pathogen infection as well as cell or tissue injury, triggering various cellular events such as proliferation, differentiation and chemotaxis [7]. Recently, high ecto-nucleotidase activity of several protozoan parasites - including Toxoplasma gondii, Entamoeba histolytica, Leishmania tropica, Leishmania amazonesis, Trypanosoma cruzi, Trypanosoma brucei, and Tritrichomonas foetus - has been shown to interfere with the extracellular signaling of the host and affect the virulence and pathogenesis of these organisms [8], [9], [10], [11], [12], [13], [14], [15], [16], [17]. Thus, it has been suggested that these enzymes play a role in the pathogenicity of these parasites by controlling the host cell response to infection, specifically by: (i) protecting the parasite from the cytolytic effects of extracellular ATP, (ii) regulating ectokinase substrate concentrations, (iii) preventing activation of signal transduction cascades associated with cellular injury, and (iv) facilitating cellular adhesion [18], [19], [20], [21], [22], [23], [24], [25], [26], [27], [28], reviewed in [28].
Among ecto-nucleosidases, Ecto-ATPases, or E-ATPases, are cell-surface enzymes that hydrolyze a range of extracellular nucleoside triphosphates (NTPs) and nucleoside diphosphates (NDPs). Most of the E-ATPases are apyrases (ATP diphosphohydrolases, EC 3.6.1.5), enzymes that were originally defined as those that catalyze the hydrolysis of both adenosine triphosphate (ATP) and adenosine diphosphate (ADP) to adenosine monophosphate (AMP) and inorganic phosphate (Pi) [18]. The majority of known apyrases belong, on basis of sequence homology, to the CD39 family. CD39, also known as ENTPD1 (ectonucleoside triphosphate diphosphohydrolase 1), is an integral plasma membrane protein with two transmembrane domains and a large heavily glycosylated extracellular region with nucleoside triphosphate diphosphohydrolase activity [18], [29], [30]. However, a novel and evolutionarily distinct apyrase, that differs from the CD39 family in amino acid sequence as well as its exclusive calcium-dependent functionality, has been identified in the salivary glands of blood-sucking bed bug Cimex lectularius [31]. A series of homologs to the Cimex gene were recently found in other blood-sucking insects, as well as in vertebrates, including humans, indicating that these enzymes represent an evolutionarily widespread family of proteins [31], [32], [33], [34], [35], [36], [37], [38].
Herein we describe for the first time the biochemical and functional characterization of an apyrase from C. hominis, designated CApy, its potential role during the infection, and the resulting implications for pathogenesis during cryptosporidiosis.
Materials and Methods
Ethics statement
All mice were housed at the vivarium at Virginia Commonwealth University (VCU) in an AAALAC-accredited facility and experimentation followed VCU Institutional Animal Care and Use Committee approved protocols (VCU IACUC Approved Protocol AM10329, Cryptosporidium Reverse Vaccinology). This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH).
Mammalian cell culture and C. parvum
Intestinal epithelial HCT-8 cells were obtained from ATCC (CCL-244) and grown in 75-cm2 flasks in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) containing 10% fetal calf serum, 25 mM HEPES, 100 units penicillin, and 100 µg of streptomycin per ml at 37°C in 5% CO2 as described [39]. C. parvum oocysts were purchased from the University of Arizona. Oocysts were stored at 4°C until use.
Plasmid construction
The sequence encoding the C. hominis apyrase gene (CApy) (Chro. 60194) lacking the N-terminal signal sequence was obtained by PCR amplification from C. hominis genomic DNA and cloned into the pTriEx-4 Ek/LIC vector (Novagen) using the following primers: apyLICF 5′GACGACGACAAGATGATAGACGAAAGGAGGGTTTG3′, and apyLICR 5′GAGGAGAAGCCCGGTTTATATAAATTCTATCCCCTCGTATTTG3′. The 5′ end of the primers incorporated the LIC (ligation independent cloning) sequences (underlined). The amplified CApy product was ligated into pTriEx-4 after treatment with LIC-qualified T4 DNA polymerase as described by the manufacturer (Novagen). E. coli strain NovaBlue (Novagen) and E. coli strain BL21(DE3) (Novagen) were used for plasmid maintenance and protein expression, respectively. The resulting protein is fused to an N-terminal His6- and S-tag with a predicted molecular mass of 41,014 Da, and is referred to as recombinant CApy, designated rCApy.
For production of an unrelated control protein (composed of an N-terminal His6-tag, Nus-protein, and C-terminal His6- and S-tag), the pET44 Ek/LIC vector (Novagen) transformed into E. coli strain BL21(DE3) was used. The resulting protein with a molecular mass of 61,523 Da is herein referred to as Nus.
Expression and purification of rCApy protein
The E. coli strain BL21(D3) transformed with pTriEx-4/CApy was cultured aerobically in TB medium (Overnight Express™ Autoinduction System, Novagen) supplemented with ampicillin (100 µg/ml) at 37°C under constant agitation. The rCApy protein C-terminally fused to a His6/S-Tag was expressed in inclusion bodies (not shown). Cell pellets were resuspended in BugBuster protein extraction reagent (Novagen) with Lysonase™ solution (Novagen), and incubated for 30 min at room temperature to induce lysis. After centrifugation at 39000×g (Sorvall SS-34 rotor) for 30 min at 4°C, the supernatant was discarded and the pellet was resuspended in BugBuster protein extraction reagent with rLysozyme™ solution (Novagen). Following incubation for 5 min at room temperature, 6 volumes of 1∶10 diluted BugBuster protein extraction buffer was added and mixed by vortexing for 1 min. The suspension was centrifuged for 15 min at 39000×g (Sorvall SS-34 rotor) at 4°C and the supernatant was discarded. rCApy inclusion bodies were resuspended in 20 mM sodium phosphate, pH 7.4, 500 mM NaCl, 6 M guanidine hydrochloride (buffer 1), and vortexed for 5 min. The buffer was adjusted to 20 mM sodium phosphate pH 7.4, 500 mM NaCl, 4 M guanidine hydrochloride, 10 mM imidazole (buffer 2) and applied to Ni2+ chelate affinity chromatography using a column with a 1 ml bed volume (GE Healthcare). The solubilized rCApy inclusion bodies were loaded onto a Ni2+- column in buffer 2 (GE Healthcare). Bound proteins were washed with buffer 3 (buffer 1 with 25 mM imidazole) and eluted with buffer 4 (buffer 1 with 500 mM imidazole). The eluted material was renatured by dialysis overnight against a minimum of 50 volumes of 100 mM Tris, pH 8.0, 1 M arginine, 2 mM EDTA, 1 mM GSH (glutathione reduced), 0.1 mM GSSG (glutathione oxidized), 5% glycerol at 4°C. Finally, after additional dialysis overnight at 4°C against a minimum of 200 volumes of PBS (phosphate buffered saline), pH 7.4, or 20 mM MOPS, pH 7.4, the purity of the CApy protein preparation was examined by SDS-PAGE analysis. Protein concentrations were determined according to Bradford (Biorad).
To purify Nus, the supernatant after bacterial cell lysis as described above was diluted 1∶1 with 20 mM sodium phosphate pH 7.4, 500 mM NaCl, 10 mM imidazole (buffer 5) and loaded onto a Ni2+- column (GE Healthcare) equilibrated with buffer 5. Column bound proteins were washed with buffer 6 (buffer 5 with 50 mM imidazole) and eluted with buffer 7 (buffer 5 with 500 mM imidazole). The eluted material was dialyzed overnight 4°C against a minimum of 200 volumes of PBS, pH 7.4.
Production of antibodies against rCApy
Groups of five female 6 to 8 week old C57BL/6 mice (Jackson Laboratory, MA) were immunized i.p. on day 0 with 20 µg purified rCApy or Nus formulated in Freund's complete adjuvant. Mice were boosted i.p. twice on day 21 and 42 with 20 µg purified rCApy or Nus formulated in incomplete Freund's adjuvant. Blood samples were collected on day 63 and sera were prepared, pooled, and stored at −20°C. The serum against Nus protein was used as an unrelated control serum.
SDS-PAGE and Western blot analysis
To obtain sporozoites, 1×108 C. parvum oocysts were washed three times (5,000×g for 4 minutes at 4°C) with Hanks' Balanced Salt Solution, transferred to excystation medium (0.75% Sodium Taurocholate and 0.25% Trypsin in Hanks' medium) and incubated 37°C for one hour.
For preparation of soluble and insoluble fractions of oocysts and sporozoites, parasites were lysed in a Nonidet P-40 based lysis buffer (1% Nonidet P-40, 50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 20% glycerol, proteinase inhibitor cocktail (Roche)) for 20 min at room temperature. After centrifugation at 16000×g and 4°C the supernatant (soluble fraction) was collected and the pellet (insoluble fraction) was dissolved in Nonidet P-40 based lysis buffer.
To remove N and O-linked oligosaccharides from native CApy, sporozoites obtained as described above were treated with the Enzymatic Carbo Release Kit™ (QAbio, San Mateo, CA) as recommended by the manufacturer. In brief, 2×108 sporozoites in 385 µl of water were mixed with 55 µl of Carbo Release buffer. After addition of 27.5 µl denaturation buffer, the sample was boiled for 5 min, chilled on ice, and supplemented with 27.5 µl Triton-X. For incubation with various combinations of carbohydrate removing enzymes, the sporozoite extract was distributed into 1.5 ml microfuge tubes (45 µl each), and 1 µl each of the following enzymes was added: PNGase, sialidase, ß-galactosidase, glucosaminidase and/or O-glycosidase, as recommended by manufacturer. After incubation at 37°C for 16 hr, protein loading buffer was added, the samples were incubated at 100°C for 5 min, and an equivalent of 2.5×106 sporozoites was subjected SDS-PAGE (12% polyacrylamide). Separated proteins were transferred to PVDF nitrocellulose membrane (Millipore) for 90 min at 350 mA and 4°C. Following blocking for 1 h at room temperature with 10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween20 (TBST) containing 2% milk powder (blocking buffer); the nitrocellulose membrane was incubated for 1 hour at room temperature with mouse anti-rCApy serum diluted 1∶500 in blocking buffer. After 3 washes with TBST, the membrane was further incubated with anti-mouse IgG HRP-conjugate (Sigma) diluted 1∶5000 in blocking buffer. The final reaction was revealed by chemiluminescence using ECL Western blotting detection reagent (Pierce) and BioMax light film (Kodak) as recommended by the manufacturers.
Apyrase activity assays
Apyrase activity assays were conducted in 96-well microtiter plates at 23°C in a final volume of 80 µl of 20 mM MOPS, pH 7.4, 100 mM NaCl containing 0.5 µM rCApy and 2.5 mM NTPs, NDPs, or NMPs. Additionally, CaCl2, MgCl2 and/or EDTA the solutions to an end concentration of 5 mM. After 10 min, 20 µl of Chan's reagent (SensoLyte™ MG Phosphate Assay Kit, AnaSpec) was added to determine the amount of inorganic phosphate (Pi) formed. After 5 min of gentle shaking, absorbance was measured at 630 nm. The units used for enzyme activity are µmol of Pi generated per mg of protein per hour.
HCT-8 cell binding assay
Cell binding assays were performed similar as previously described [40]. Briefly, HCT-8 cells (1×105/well) were seeded in 96-well microtiter plates (Costar) and grown overnight at 37°C. After fixation with 4% paraformaldehyde in PBS, pH 7.4, for 1 h at RT, the cells were washed three times with PBS, pH 7.4, blocked for 1 hour at room temperature with PBS, pH 7.4, containing 10% FCS (PBS-FCS), washed three times with PBS, pH 7.4, and incubated with varying concentrations of rCApy or Nus protein as an unrelated protein control, in PBS-FCS. After 1 h at 37°C, the cells were washed four times with PBS, pH 7.4, containing 0.05% Tween20 (PBS-Tween), and incubated for 1 h at 37°C with mouse anti-His6-HRP conjugated antibody 1∶10,000 (SantaCruz) diluted in PBS-FCS. After four washes, PBS-Tween substrate buffer containing o-phenylenediamine (SIGMAFAST OPD™) was added, the cells were incubated for 30 min and the OD was measured at 450 nm.
Cell invasion assay
Sporozoites (1×106) were incubated with 1∶10 diluted mouse anti-rCApy serum or non-related control serum (anti-Nus) for 30 min at 37°C, washed three times with PBS, pH 7.4, and added to 24-well plates containing a monolayer of HCT-8 cells in a ratio of 4 parasite:1 cell. Following incubation under culture conditions for 3 hours, extracellular parasites were removed by washing three times with PBS, pH 7.4, and the plates were returned to the incubater. Cells were collected 24 hours post-infection RNA was extracted from infected cells using the RNAqueous system (Ambion) following the manufacturer's recommendations. RNA samples were stored at −80°C until quantification of C. parvum rRNA by RT-PCR.
Real-time quantitative RT-PCR
RT-PCR was used to quantify the in vitro infection rate of HCT-8 cells by C. parvum. Thus, RNA samples from HCT-8 cells infected with C. parvum sporozoites pretreated with mouse anti-rCApy serum and the corresponding control (mouse anti-Nus serum) were incubated with TURBO DNA-free DNase (Ambion) following the manufacture's instructions and used for Real-Time RT-PCR analysis using TaqMan™ technology. Primers and probes specific for Cryptosporidium rRNA and human rRNA were designed using Primer Express® version 2.0 (ABI). For each target, forward and reverse primers and an internal probe were synthesized. Probes were synthesized with 5′ end linked FAM (6-carboxyfluoresceine) and 3′ end fluorescent TAMRA (6-carboxytetramethylrhodamine) dyes. Amplification and analysis were performed in our ABI7900HT instrument. The infection rate was obtained by calculating the ratio of human rRNA versus Cryptosporidium rRNA, with 100% infection represented by the negative control (treated with anti-Nus serum).
Sequence analysis
Putative signal peptide cleavage sites and asparagine-linked glycosylation sites of CApy were determined using SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) and NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/). The theoretical molecular weights and isoelectric points were determined with PeptideMass (http://www.expasy.ch/tools/peptide-mass.html).
Phylogenetic analysis of CApy
Putative orthologs of CApy were identified by BLAST [41] search of the CApy protein sequence against NCBI GenBank non-redundant protein database (nr), with a threshold of 1E-6 for the expectancy value E. All the identified protein sequences were aligned with ClustalX [42] and manually checked for adequate aligned length (>75% of the protein aligning). To expedite subsequent bootstrap analyses and simplify the final tree, phylogenetic analysis was performed by maximum likelihood using PHYML [43] in two steps: first, a preliminary analysis (without bootstrap and using less thorough tree space search strategies) identified possible in-paralogs as well as out-paralogs that reflected the same phylogenetic pattern. These sequences were then removed from the alignment, and the sequences were realigned and reanalyzed to check whether the phylogeny remained stable after removal of the paralogs. The second analysis, involving only sequences remaining after the first step, was performed with one hundred bootstrap replicates and the SPR strategy [44] for the search of the optimal trees. The amino acid substitution model used was LG with 4 categories of gamma-distributed substitution rates, as selected by ModelGenerator [45]. Table S1 lists the GenBank accession numbers for the 109 sequences utilized in phylogenetic reconstruction.
Results
Identification and sequence analysis of a C. hominis apyrase (CApy)
Analysis of the recently sequenced C. hominis and C. parvum genomes identified a single ecto-ATP diphoshohydrolase (apyrase, EC 3.6.1.5) in each sequence that displays high similarity to the human soluble calcium-activated nucleotidase 1 (SCAN-1, Fig. 1A) (GenBank accession numbers EAL36710, and EAK89829). The Cryptosporidium apyrase (CApy) is a single copy gene with a predicted open reading frame of 1035 bp coding for a 345 amino acid protein. Further characterization of CApy amino acid protein sequence predicted a signal peptide with a cleavage site between residues 22 and 23. The cleavage results in a protein of 323 amino acids, with a predicted molecular mass of 36,932 Da and an isoelectric point of 5.23 (Fig. 1B). No GPI anchor or other known cell targeting signals were found, suggesting that the protein is either attached to the membrane by a hydrophobic stretch or secreted. In addition, N-linked glycosylation sites were not detected.
A. Alignment of selected apyrase sequences. Sequence alignment was performed using the CLUSTAL 2W algorithm. The GenBank accession numbers of sequences are given in parentheses. CH, Cryptosporidium hominis (XP_666945); CP, Cryptosporidium parvum (XP_627524); CM, Cryptosporidium muris (XP_002140694); HS, Homo sapiens (NP_620148); MM, Mus musculus (EDL34666), BT, Bos Taurus (XP_596269). The enzymatic activity of the human apyrase has been established by biochemical analysis [56], therefore residues important for nucleotide and Ca2+ binding in the human apyrase and the predicted counterparts in corresponding apyrases of other species are indicated by gray shadows and pluses. Residues that differ from the human sequence at positions with potential impact on enzymatic activity are colored red. Cysteine residues are shadowed light blue. B. CApy is a protein comprising 345 aa, including a 22-aa signal peptide (SP), and an apyrase domain spanning residues 26–345.
Expression, Purification and Refolding of recombinant CApy
The C. parvum and C. hominis apyrase amino acid sequences are 98% identical. Herein, we describe the cloning, expression and purification of recombinant CApy derived from C. hominis, designated rCApy. Thus, the DNA sequence encoding amino acid residues 34–345 excluding the signal peptide of the gene was amplified from C. hominis genomic DNA. The resulting 936-bp fragment was inserted into the pTriEx-4 vector (Novagen) C-terminally fused to a His6-S-tag. As shown in Fig. 2, rCApy was expressed in E. coli in inclusion bodies (IBs) and was therefore solubilized as described in the Materials and Methods. Subsequent purification by Ni2+- chelate chromatography under denaturing conditions led to a highly purified and homogenous product (Fig. 2, lane 7). During refolding of rCApy, little or no protein was lost due to precipitation (Fig. 2, lane 8). Nevertheless, in subsequent dialysis against PBS, pH 7.4, or MOPS pH 7.4 (Fig. 2, lanes 9 and 10), a significant fraction of the refolded protein precipitated when protein concentrations exceeded approximately 0.35 mg/ml. A similar dependency on protein concentration for successful refolding was reported for human SCAN-1 [38].
The electrophoretic analysis (SDS-PAGE, 12% PAA under reducing conditions) shows extracts of non-induced and induced E. coli cultures (lane 1 and 2) bearing the CApy gene in the pTriEx-4 expression vector from samples taken at different steps of protein purification (lanes 3–10). Following bacterial cell lysis the soluble (supernatant, lane 3) and insoluble (pellet, lane 4) fractions show that CApy was mostly found in the insoluble fraction in form of inclusion bodies (IBs). The solubilized IBs (see Materials and Methods) were loaded onto a Ni2+ chelate column and purified under denaturing conditions, flow-through (lane 5), wash (lane 6), and elution (lane 7) fractions were collected. The eluate containing the purified CApy was refolded by dialysis against folding buffer (lane 8), which was subsequently dialysed against PBS, pH 7.4 (lane 9) or 20 mM MOPS, pH 7.4 (lane10).
Expression and localization of CApy in infective forms of C. parvum
To determine the expression and localization of the CApy protein in Cryptosporidium parasites, we performed Western blot experiments. Since C. hominis is very difficult to obtain, we used C. parvum in this and the following experiments where parasites are required. Since the genomes of these two parasites exhibit ∼95% sequence identity and the amino acid sequences of the CApy proteins are nearly 98% identical [46], [47], we do not expect major differences in results obtained using C. parvum parasites. Western blot analysis using polyclonal antibodies against rCApy showed that the native protein is in the detergent-soluble fraction of oocysts and sporozoites with an apparent molecular mass of ∼50 kDa (Fig. 3). The apparent ∼50 kDa molecular mass suggests that the protein may be subject to post-translational modifications. Higher molecular mass bands were also observed, particularly in the oocyst fraction (Fig. 3), suggesting that CApy could form multimer complexes. Previously we showed using polyclonal mouse antibodies raised against rCApy that this parasite protein is membrane associated with polar localization in the infected sporozoites [48]. The intriguing possibility that CApy is associated with and secreted by the apical complex in sporozoites remains to be further explored.
CApy is expressed in oocysts and sporozoites. Aliquots of NP-40 soluble (S) or insoluble (I) C. parvum oocyst and sporozoite fractions were resolved by 12% SDS-PAGE, transferred to nitrocellulose and probed with mouse anti-rCApy serum as described in the Materials and Methods.
To investigate the possible presence of N- and O- linked oligosaccharides on CApy, we performed enzymatic deglycosylation experiments on the proteins in sporozoite extracts and analyzed the resulting proteins by Western blot analysis using CApy-specific antibodies (Fig. 4). Treatment with glucosamidase, O-glucosidase, or sialidase showed little effect on the migration of CApy. In contrast, treatment with PNGase or ß-galactosidase revealed a major shift in the molecular mass of CApy, with ß-galactosidase having the most pronounced effect. Nevertheless, even after deglycosylation with both PNGase and ß-galactosidase the most prominent band detected in sporozoites was significantly higher, ∼50 kDa, than the expected molecular weight for CApy, ∼39 kDa. Moreover, reduction of samples in the presence 100 mM DTT (1,4-dithio-DL-threitol) before separation in SDS-PAGE did not change the outcome of the Western blot (data not shown). These results suggest that CApy in its mature form is posttranslationally glycosylated in an N-linked fashion. Additional posttranslational modifications may also be present since a larger than the expected protein species was obtained after deglycosylation.
C. parvum sporozoites were treated as recommended in the Enzymatic Carbo Release Kit™ (QAbio, San Mateo, CA) for identification of glycosylation. In brief, sporozoites were suspended in Carbo Release buffer, and denaturation buffer was added. After incubation at 100°C for 5 min, samples were chilled on ice and Triton-X was added. The enzymes PNGase, Sialidase, ß-Galactosidase, Glucosaminidase, O-Glycosidase were added alone or in combinations. Following incubation at 37°C for 16 hours, protein loading buffer was added and samples were incubated again at 100°C for 5 min. Proteins were separated by 12% SDS-PAGE, transferred to nitrocellulose and probed with mouse anti-rCApy serum.
Activity of CApy requires Ca2+ and is highest against UDP and GDP
We evaluated the nucleotidase activity of rCApy using a variety of substrates and divalent cations. ATPase and ADPase activities were measured at 2.5 mM total nucleotide concentrations in the absence of divalent cations, as well as in presence of 5 mM CaCl2, or MgCl2 (Fig. 5A). Nucleotidase activity was only detected in presence of calcium ions. To determine enzyme substrate specificity of CApy, a variety of nucleoside mono-, di-, and triphosphates were used as substrates (2.5 mM final nucleotide concentrations) in the presence of 5 mM CaCl2 (Fig. 5B). The activity for the preferred substrates UDP and GDP is high, whereas activities towards ATP and GTP are lowest. No measurable hydrolysis of any investigated monophosphate was detected. These results reflect those expected for human apyrase SCAN-1.
Apyrase activity was measured in 20 mM MOPS buffer, pH 7.4, and a final nucleotide concentration of 2.5 mM. Activity units are micromoles of Pi liberated per milligram of protein per hour at 23°C. The graphs present the mean and standard deviations of triplicate experiments. A. Cofactor specificity of rCApy. ATPase and ADPase activity of rCApy was measured in presence of either 5 mM CaCl2 or 5 mM MgCl2 with or without addition of 5 mM EDTA. B. Substrate preference of rCApy. Assays were done in presence of 5 mM CaCl2.
Recombinant CApy binds to the HCT-8 cells in a dose dependent fashion
To assess the possibility that CApy may play a role in the attachment of Cryptosporidium sporozoites to enterocytes, we measured the ability of recombinant CApy to bind HCT-8 cells. Binding assays were performed by adding various concentrations of rCApy to paraformaldehyde fixed HCT-8 cells as described in the Materials and Methods. As shown in Fig. 6, rCApy binds to HCT-8 cells in a dose-dependent and saturable manner. No binding was observed when an unrelated protein (bacterial Nus) was used in identical assays.
Increasing concentrations of protein in the range of 5–60 µg/ml, rCApy or control protein, were added to 96-well plates containing formaldehyde-fixed adherent HCT-8 cells (as described in Material and Methods. Interactions of proteins, both carrying a His6-tag, with the HCT-8 cell surface were detected by ELISA using anti-His6 HRP-conjugated antibody. The bound antibody was revealed by using o-phenylenediamine as a substrate. Respective results of one of three experiments are shown, and are expressed as absorbance at 450 nm. The values are the means of one experiment performed in triplicates, error bars represent standard deviations. An unrelated bacterial protein (Nus) was used as a control (C).
Antibodies directed against rCApy block invasion of HCT-8 cells by C. parvum
To further gain insight into the role of CApy during parasite invasion, we performed in vitro invasion assays using HCT-8 cells. Thus, sporozoites were pre-incubated with mouse anti-rCApy serum or unrelated control serum and the infection rate was measured using quantitative RT-PCR (Fig. 7). In these experiments, antibodies against rCApy were able to reduce the invasion of enterocytes by sporozoites by over 60%, suggesting that CApy plays a role during the early stages of infection.
C. parvum sporozoites were preincubated with mouse anti-rCApy serum or unrelated control serum (dilution 1∶10), followed by incubation with HCT-8 cells for 24 hours and infection was quantified by RT-PCR as described in the Materials and Methods. The values are the means three independently performed experiments performed, error bars represent standard deviations.
Sequence and phylogenetic analysis of apyrase sequences
To perform a reconstruction of the evolutionary history of CApy, we identified putative orthologs in as many genomes as possible (Table S1) and used these sequences to perform a phylogenetic analysis (Fig. 8, and see Materials and Methods). The analysis showed that among the Unikonta [49], [50], a CApy ortholog is present in Choanozoa, the Amoebozoa, in one Opisthokonta of uncertain phylogenetic affiliation (Capsaspora), and in several Metazoa, but not in any fungi. Among the Bikonta, CApy orthologs only seem to be present in the Chromalveolata, comprised of Alveolata (which includes apicomplexan parasites) and Stramenopiles, and in one Excavata, Naegleria gruberi, which grouped at a deep divergence, and with low bootstrap support, with the Unikonta. The grouping of Apicomplexa and Stramenopiles has strong bootstrap support, as have the internal groupings of cryptosporidia, diatoms and oomycetes. The branch connecting Toxoplasma and Neospora with Cryptosporidium is relatively well supported, with a bootstrap value of 75 (only values above 50 are shown on Fig. 8). Other known Bikonta (Excavata, Plantae and Rhizaria) genomes seem to lack an ortholog of this protein, with the exception of the excavate Naegleria, as noted above.
Numbers at the nodes represent bootstrap support (only numbers above 50 are shown).
Multiple sequence alignment of these orthologs from protozoan, invertebrate, and vertebrate organisms shows that most variations occur in the N-terminus, possibly reflecting differences in the secretory systems, as well as possible different localizations of the protein, depending on the specific function in the respective organism. Nevertheless the apyrase domain, and in particular the structurally important regions, seem to be highly conserved (data not shown). Surprisingly, orthologs occur in various infectious disease causing eukaryotic parasites, as well as their respective hosts, yet they are apparently absent in yeast and bacteria. Overall, our analysis argues that CApy was present in the progenitors of Cryptosporidium, but was lost in other apicomplexans except Toxoplasma and Neospora, or, less likely, that the gene was picked up by the parasites from more distantly related organisms by lateral gene transfer.
Discussion
In this study, we have identified and characterized a C. hominis gene, CApy, which encodes an ecto-apyrase homolog of a group of calcium-dependent apyrases that catalyze hydrolysis of both nucleoside triphosphate (NTP) and nucleosine diphosphate (NDP) to nucleoside monophosphate (NMP) and inorganic phosphate (Pi). These enzymes are highly conserved among the Unikonta, including arthropods and vertebrates [31], [32], [33], [34], [36], [37], but much less prevalent in the Bikonta, which includes the apicomplexans.
Initial analysis of the CApy sequence revealed that the protein displays a classical signal peptide sequence, suggesting that the protein is either located on the surface of the parasite or secreted. No GPI anchor or other transmembrane signal was identified. Interestingly, immunofluorescence experiments suggested that the protein is mainly located in the apical region of the parasite, a highly specialized structure containing several organelles known to secret a series of proteins necessary for invasion of the host [3]. Although bioinformatic analysis did not strongly suggest the presence of glycosylation sites, our observations suggest that CApy is heavily glycosylated. It remains to be investigated to what extent glycosylation influences the function of the molecule.
Our recombinant CApy functions as a soluble apyrase with exclusive calcium-dependent activity, consistent with its human homolog ortholog SCAN-1 [34], [38], as well as various insect apyrases from Cimex lectularius [31], Phlebotomus papatasi [33], and Lutzomyia longipalpis [36]. As observed for SCAN-1, UDP and GDP, rather than ADP or ATP, are the preferred substrates of CApy [34], [38].
Several indications suggest that CApy could be involved in the invasion of human enterocytes by Cryptosporidium. Thus, CApy seems to be found on the apical surface of sporozoites, binds to the host cell in a dose-dependent manner suggesting the presence of a potential receptor on the host cell surface, and elicits antibodies that significantly block invasion. Our observations support previous reports that indicate that ecto-apyrases play various roles during host pathogen interaction [51]. Recently it was reported, that antibodies directed against an ecto-NTPDase from Trypanosoma cruzi and Leishmania amazonesis are able to significantly reduce the rate of infection of these parasites [10], [52]. Furthermore chemical inhibition of the ecto-NTPDase led to a reduction of the virulence of T. cruzi in in vivo experiments [12]. Moreover, Bissagio et al. 2003 [10] suggested that Mg2+-dependent ecto-ATPase activity on the surface of T. cruzi could stimulate the adherence of the parasite to the host cell and protect from neutrophil attack.
The ability of CApy to inactivate extracellular nucleotides, which generally serve as danger signals that are rapidly produced during the onset of immune responses, suggests other possible roles of CApy during parasite pathogenesis. Moderate to severe infection with Cryptosporidium is characterized by mucosal inflammation with neutrophils and macrophages in the lamina propria underlying intestinal epithelial cells, as well as the presence of intraepithelial neutrophils ([53], reviewed in [54]). Cell and tissue damage, hypoxia, leukocyte activation, decreased pH and other stress factors previously described to be caused by this pathogen [7], [55] may lead to the release of large amounts of extracellular nucleotides into the intestinal lumen at the site of inflammation. Our in vitro data indicate that CApy may interfere with the interaction of ADP, ATP, UDP, and UTP with different subsets of purinergic receptors, thereby possibly impacting various signaling pathways normally activated during inflammation resulting in modulation of cellular immune responses. In addition to its potential role in attachment, an apyrase expressed on the surface or secreted by the parasite may be an effective counter measure to the release of extracellular nucleotides rapidly secreted at local sites of infection which would otherwise display potent innate immune-enhancing activities undermining successful parasite propagation. Further studies are necessary to test this hypothesis.
Apyrases are broadly distributed among the tree of life and are present in many pathogenic parasites [28]. To gain insight into the evolution of this pathogenic factor we performed phylogenetic analysis of CApy and all orthologs that we could identify from available sequences. Our analysis, using recent multi-gene phylogenies of eukaryotes as a benchmark [49], suggests that CApy was present in the apicomplexan progenitor, but the gene was lost from apicomplexans other than Cryptosporidium, Neospora, and Toxoplasma. Moreover, the phylogenetic analysis indicates that all Chromalveolata sequences form a monophyletic group, suggesting that CApy might have been an ancestral feature of the group that was later lost in other Apicomplexa (e.g., Plasmodium, Theileria) and the Ciliata (e.g. Tetrahymena and Paramecium). While Toxoplasma, Neospora and Cryptosporidium branch together, they do so with moderate bootstrap support of 75. This is likely due to the greater sequence divergence of the Toxoplasma and Neospora apyrases, which can lead to lower phylogenetic signal and more homoplasy with other sequences. Assuming that the phylogenetic groups Bikonta and Unikonta are natural, the absence of this apyrase in other bikonts (all Excavata but Naegleria, all Plantae, and possibly Rhizaria, for which no complete genomes were available at analysis time) suggests that either the CApy gene is ancient but was lost in these bikont lineages, or that this gene is novel and was transferred from unikonts to Chromalveolata (or vice-versa) early in evolution of these groups. Our current taxonomic sampling of this gene does not allow a definitive conclusion, emphasizing the need for further genomic studies of more diverse taxa among the unikonts, Chromalveolata, Rhizaria, as well as basal Plantae, e.g. rhodophytes and glaucophytes.
In summary, herein we described a new potential pathogenic factor, the CApy apyrase, in Cryptosporidium. CApy may play multiple roles during the infection, including an active participation in the attachment and invasion of Cryptosporidium to the host cells. In addition, we provide indirect evidence suggesting that CApy could potentially interfere with extracellular nucleotide signaling responsible for triggering an inflammatory response in injured tissues, possibly delaying it and providing an opportunity for the parasite to successfully establish the infection. Phylogenetic evidence suggests that either this gene was acquired very early in evolution but lost in many of the nearest relatives of Cryptosporidium, explaining its otherwise broad distribution among the tree of life and among pathogenic parasites, or, less likely, that Cryptosporidium, Toxoplasma, and Neospora may have acquired the gene by lateral gene transfer. Finally the evidence provided by this study indicates that CApy might be a potential drug target and/or vaccine candidate against cryptosporidiosis.
Supporting Information
Table S1.
Database accession number of sequences used in phylogenetic reconstruction.
https://doi.org/10.1371/journal.pone.0031030.s001
(DOC)
Acknowledgments
DNA synthesis and sequencing, and RT-PCR were performed in the Nucleic Acids Research Facilities at Virginia Commonwealth University.
Author Contributions
Conceived and designed the experiments: PAM UW. Performed the experiments: PAM UW AML FT. Analyzed the data: PAM UW JMA GAB. Contributed reagents/materials/analysis tools: GAB. Wrote the paper: PAM UW JMA GAB.
References
- 1. Goodgame RW (1996) Understanding intestinal spore-forming protozoa: cryptosporidia, microsporidia, isospora, and cyclospora. Ann Intern Med 124: 429–441.
- 2. Guerrant RL (1997) Cryptosporidiosis: an emerging, highly infectious threat. Emerg Infect Dis 3: 51–57.
- 3. Smith HV, Nichols RA, Grimason AM (2005) Cryptosporidium excystation and invasion: getting to the guts of the matter. Trends Parasitol 21: 133–142.
- 4. Mizumoto N, Kumamoto T, Robson SC, Sevigny J, Matsue H, et al. (2002) CD39 is the dominant Langerhans cell-associated ecto-NTPDase: modulatory roles in inflammation and immune responsiveness. Nat Med 8: 358–365.
- 5. Kohler D, Eckle T, Faigle M, Grenz A, Mittelbronn M, et al. (2007) CD39/ectonucleoside triphosphate diphosphohydrolase 1 provides myocardial protection during cardiac ischemia/reperfusion injury. Circulation 116: 1784–1794.
- 6. Eltzschig HK, Kohler D, Eckle T, Kong T, Robson SC, et al. (2009) Central role of Sp1-regulated CD39 in hypoxia/ischemia protection. Blood 113: 224–232.
- 7. Di Virgilio F, Chiozzi P, Ferrari D, Falzoni S, Sanz JM, et al. (2001) Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97: 587–600.
- 8. Silverman JA, Qi H, Riehl A, Beckers C, Nakaar V, et al. (1998) Induced activation of the Toxoplasma gondii nucleoside triphosphate hydrolase leads to depletion of host cell ATP levels and rapid exit of intracellular parasites from infected cells. J Biol Chem 273: 12352–12359.
- 9. Barros FS, De Menezes LF, Pinheiro AA, Silva EF, Lopes AH, et al. (2000) Ectonucleotide diphosphohydrolase activities in Entamoeba histolytica. Arch Biochem Biophys 375: 304–314.
- 10. Bisaggio DF, Peres-Sampaio CE, Meyer-Fernandes JR, Souto-Padron T (2003) Ecto-ATPase activity on the surface of Trypanosoma cruzi and its possible role in the parasite-host cell interaction. Parasitol Res 91: 273–282.
- 11. Sansom FM, Newton HJ, Crikis S, Cianciotto NP, Cowan PJ, et al. (2007) A bacterial ecto-triphosphate diphosphohydrolase similar to human CD39 is essential for intracellular multiplication of Legionella pneumophila. Cell Microbiol 9: 1922–1935.
- 12. Santos RF, Possa MA, Bastos MS, Guedes PM, Almeida MR, et al. (2009) Influence of Ecto-Nucleoside Triphosphate Diphosphohydrolase Activity on Trypanosoma cruzi Infectivity and Virulence. PLoS Negl Trop Dis 3: e387.
- 13. Berredo-Pinho M, Peres-Sampaio CE, Chrispim PP, Belmont-Firpo R, Lemos AP, et al. (2001) A Mg-dependent ecto-ATPase in Leishmania amazonensis and its possible role in adenosine acquisition and virulence. Arch Biochem Biophys 391: 16–24.
- 14. de Souza Leite M, Thomaz R, Fonseca FV, Panizzutti R, Vercesi AE, et al. (2007) Trypanosoma brucei brucei: biochemical characterization of ecto-nucleoside triphosphate diphosphohydrolase activities. Exp Parasitol 115: 315–323.
- 15. Jesus JB, Lopes AH, Meyer-Fernandes JR (2002) Characterization of an ecto-ATPase of Tritrichomonas foetus. Vet Parasitol 103: 29–42.
- 16. Fietto JL, DeMarco R, Nascimento IP, Castro IM, Carvalho TM, et al. (2004) Characterization and immunolocalization of an NTP diphosphohydrolase of Trypanosoma cruzi. Biochem Biophys Res Commun 316: 454–460.
- 17. Peres-Sampaio CE, Palumbo ST, Meyer-Fernandes JR (2001) An ecto-ATPase activity present in Leishmania tropica stimulated by dextran sulfate. Z Naturforsch C 56: 820–825.
- 18. Plesner L (1995) Ecto-ATPases: identities and functions. Int Rev Cytol 158: 141–214.
- 19. Steinberg TH, Di Virgilio F (1991) Cell-mediated cytotoxicity: ATP as an effector and the role of target cells. Curr Opin Immunol 3: 71–75.
- 20. Filippini A, Taffs RE, Agui T, Sitkovsky MV (1990) Ecto-ATPase activity in cytolytic T-lymphocytes. Protection from the cytolytic effects of extracellular ATP. J Biol Chem 265: 334–340.
- 21. Margolis RN, Schell MJ, Taylor SI, Hubbard AL (1990) Hepatocyte plasma membrane ECTO-ATPase (pp120/HA4) is a substrate for tyrosine kinase activity of the insulin receptor. Biochem Biophys Res Commun 166: 562–566.
- 22. Najjar SM, Accili D, Philippe N, Jernberg J, Margolis R, et al. (1993) pp120/ecto-ATPase, an endogenous substrate of the insulin receptor tyrosine kinase, is expressed as two variably spliced isoforms. J Biol Chem 268: 1201–1206.
- 23. Dubyak GR, el-Moatassim C (1993) Signal transduction via P2-purinergic receptors for extracellular ATP and other nucleotides. Am J Physiol 265: C577–606.
- 24. Clifford EE, Martin KA, Dalal P, Thomas R, Dubyak GR (1997) Stage-specific expression of P2Y receptors, ecto-apyrase, and ecto-5′-nucleotidase in myeloid leukocytes. Am J Physiol 273: C973–987.
- 25. Knowles AF (1995) The rat liver ecto-ATPase/C-CAM cDNA detects induction of carcinoembryonic antigen but not the mercurial-insensitive ecto-ATPase in human hepatoma Li-7A cells treated by epidermal growth factor and cholera toxin. Biochem Biophys Res Commun 207: 529–535.
- 26. Stout JG, Strobel RS, Kirley TL (1995) Properties of and proteins associated with the extracellular ATPase of chicken gizzard smooth muscle. A monoclonal antibody study. J Biol Chem 270: 11845–11850.
- 27. Kirley TL (1997) Complementary DNA cloning and sequencing of the chicken muscle ecto-ATPase. Homology with the lymphoid cell activation antigen CD39. J Biol Chem 272: 1076–1081.
- 28. Roberto Meyer-Fernandes J (2002) Ecto-ATPases in protozoa parasites: looking for a function. Parasitol Int 51: 299–303.
- 29. Maliszewski CR, Delespesse GJ, Schoenborn MA, Armitage RJ, Fanslow WC, et al. (1994) The CD39 lymphoid cell activation antigen. Molecular cloning and structural characterization. J Immunol 153: 3574–3583.
- 30. Wang TF, Guidotti G (1998) Widespread expression of ecto-apyrase (CD39) in the central nervous system. Brain Res 790: 318–322.
- 31. Valenzuela JG, Charlab R, Galperin MY, Ribeiro JM (1998) Purification, cloning, and expression of an apyrase from the bed bug Cimex lectularius. A new type of nucleotide-binding enzyme. J Biol Chem 273: 30583–30590.
- 32. Uccelletti D, Pascoli A, Farina F, Alberti A, Mancini P, et al. (2008) APY-1, a novel Caenorhabditis elegans apyrase involved in unfolded protein response signalling and stress responses. Mol Biol Cell 19: 1337–1345.
- 33. Valenzuela JG, Belkaid Y, Rowton E, Ribeiro JM (2001) The salivary apyrase of the blood-sucking sand fly Phlebotomus papatasi belongs to the novel Cimex family of apyrases. J Exp Biol 204: 229–237.
- 34. Smith TM, Hicks-Berger CA, Kim S, Kirley TL (2002) Cloning, expression, and characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a new family of extracellular nucleotidases. Arch Biochem Biophys 406: 105–115.
- 35. Devader C, Webb RJ, Thomas GM, Dale L (2006) Xenopus apyrase (xapy), a secreted nucleotidase that is expressed during early development. Gene 367: 135–141.
- 36. Charlab R, Valenzuela JG, Rowton ED, Ribeiro JM (1999) Toward an understanding of the biochemical and pharmacological complexity of the saliva of a hematophagous sand fly Lutzomyia longipalpis. Proc Natl Acad Sci U S A 96: 15155–15160.
- 37. Failer BU, Braun N, Zimmermann H (2002) Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase. J Biol Chem 277: 36978–36986.
- 38. Murphy DM, Ivanenkov VV, Kirley TL (2003) Bacterial expression and characterization of a novel, soluble, calcium-binding, and calcium-activated human nucleotidase. Biochemistry 42: 2412–2421.
- 39. Joe A, Verdon R, Tzipori S, Keusch GT, Ward HD (1998) Attachment of Cryptosporidium parvum sporozoites to human intestinal epithelial cells. Infect Immun 66: 3429–3432.
- 40. Manque PM, Eichinger D, Juliano MA, Juliano L, Araya JE, et al. (2000) Characterization of the cell adhesion site of Trypanosoma cruzi metacyclic stage surface glycoprotein gp82. Infect Immun 68: 478–484.
- 41. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402.
- 42. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948.
- 43. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704.
- 44.
Hillis DM, Moritz C, Mable BK (1996) Molecular systematics. Sunderland, Mass.: Sinauer Associates.
- 45. Keane TM, Creevey CJ, Pentony MM, Naughton TJ, McLnerney JO (2006) Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evol Biol 6: 29.
- 46. Xu P, Widmer G, Wang Y, Ozaki LS, Alves JM, et al. (2004) The genome of Cryptosporidium hominis. Nature 431: 1107–1112.
- 47. Abrahamsen MS, Templeton TJ, Enomoto S, Abrahante JE, Zhu G, et al. (2004) Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science 304: 441–445.
- 48. Manque PA, Tenjo F, Woehlbier U, Lara AM, Serrano MG, et al. (2011) Identification and immunological characterization of three potential vaccinogens against Cryptosporidium. Clin Vaccine Immunol.
- 49. Keeling PJ, Burger G, Durnford DG, Lang BF, Lee RW, et al. (2005) The tree of eukaryotes. Trends Ecol Evol 20: 670–676.
- 50. Cavalier-Smith T (2003) The excavate protozoan phyla Metamonada Grasse emend. (Anaeromonadea, Parabasalia, Carpediemonas, Eopharyngia) and Loukozoa emend. (Jakobea, Malawimonas): their evolutionary affinities and new higher taxa. Int J Syst Evol Microbiol 53: 1741–1758.
- 51. Sansom FM, Robson SC, Hartland EL (2008) Possible effects of microbial ecto-nucleoside triphosphate diphosphohydrolases on host-pathogen interactions. Microbiol Mol Biol Rev 72: 765–781, Table of Contents.
- 52. Pinheiro CM, Martins-Duarte ES, Ferraro RB, Fonseca de Souza AL, Gomes MT, et al. (2006) Leishmania amazonensis: Biological and biochemical characterization of ecto-nucleoside triphosphate diphosphohydrolase activities. Exp Parasitol 114: 16–25.
- 53. Laurent F, Eckmann L, Savidge TC, Morgan G, Theodos C, et al. (1997) Cryptosporidium parvum infection of human intestinal epithelial cells induces the polarized secretion of C-X-C chemokines. Infect Immun 65: 5067–5073.
- 54. Laurent F, McCole D, Eckmann L, Kagnoff MF (1999) Pathogenesis of Cryptosporidium parvum infection. Microbes Infect 1: 141–148.
- 55. Luttikhuizen DT, Harmsen MC, de Leij LF, van Luyn MJ (2004) Expression of P2 receptors at sites of chronic inflammation. Cell Tissue Res 317: 289–298.
- 56. Dai J, Liu J, Deng Y, Smith TM, Lu M (2004) Structure and protein design of a human platelet function inhibitor. Cell 116: 649–659.