TAT-MafA effectively transduces living cells in vitro

In order to test whether TAT confers MafA the ability to penetrate across cellular membranes, mouse pancreatic insulinoma cells MIN-6 and β-TC3 were incubated with Alexa Fluor 568-labeled protein (final concentration in culture medium: 1 µM). Hoechst was used as a nuclear counter-staining in living cells. Figure 1a shows a time course experiment (2–24 h) using the latter cell line. In agreement with our previous experience with other TAT-fused proteins, virtually 100% of the cells were transduced as early as 2 h after addition of the labeled protein to the medium. Most of the TAT-MafA staining remains in cytoplasmic macropinocytotic vesicles at 24 h [23], but nuclear co-localization of released TAT-MafA was also demonstrated by confocal microscopy (figure 1b). This was particularly evident at later time points. MIN-6 cells displayed similar uptake kinetics, although in this cell line overt transduction could not be seen until 4 h of incubation (data not shown). The stability of the protein over longer incubation periods was not studied. The above observations indicate that TAT-MafA can be efficiently transduced in vitro.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. TAT-MafA uptake in β-TC3 cells.

(A)TAT-MafA protein (1 µg/µl) was labeled with Alexa Fluor 568 and added to the culture medium of β-TC3 cells grown in glass bottom dishes (P35G-1.5-20-C 35 mm, MatTek Corporation, Ashland, MA) to ensure maximal optical clarity for live confocal microscopy. Hoescht (blue) was used as nuclear counter-staining (first column). An overlay of both channels is seen in the last column. The culture medium was removed and cells washed in PBS prior to each observation in order to eliminate free extracellular immunofluorescence background. Disturbance of the cultures prior to the time of observation was prevented by plating each individual group (time point) independently. Size bar: 20 µm. (B) Detail of nuclear localization of the protein after 8 h by live confocal microscopy (staining as above). Size bar: 5 µm.

https://doi.org/10.1371/journal.pone.0022364.g001

Recombinant TAT-MafA binds to the insulin promoter

TAT-MafA protein was purified as described in the Methods section. Optimization of the process results in high yield (>1 mg)-high purity (80–90%) protein. TAT-MafA can be detected as a ∼50 kD band by automated gel electrophoresis using a Experion bioanalyzer (Bio-Rad, Hercules, CA) (fig. 2a). The identity of the band was confirmed by Western blot using a rabbit polyclonal anti-MafA antibody (Abcam ab17976) (fig. 2b).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. In vitro activity of TAT-MafA.

(A) Experion™ virtual run of the last the purest eluate of TAT-MafA (far right), preceded by the three previous ones. (B) Western blot (MafA antibody) was used to confirm the identity of the purified protein. (C) Electrophoretic Mobility Shift Assay (EMSA). All samples include biotin-labeled DNA. 1. Labeled DNA alone (baseline control); 2. TAT-MafA (no competitor); 3. TAT-MafA+unlabeled DNA competitor (control); 4. Kinase treated TAT-MafA; 5. Kinase treated TAT-MafA+unlabeled DNA competitor (control); 6. Kinase alone (control); 7. Kinase+unlabeled DNA competitor (control) (D) qRT-PCR to measure relative expression of key pancreatic genes (insulin 1, insulin 2 and Glut-2) in e14.5 buds treated with TAT-MafA or vehicle. Black columns: control (vehicle); grey columns: TAT-MafA treatment. Bars: standard error.

https://doi.org/10.1371/journal.pone.0022364.g002

In order to determine whether TAT-MafA binds to its appropriate DNA target within the Insulin promoter, an electrophoretic mobility shift assay (EMSA) was done as indicated above. The sequence ATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATC (−139 to −104 of the insulin promoter) was synthesized at Sigma-Aldrich (St. Louis, MO) for use in hybridization studies. This sequence encompasses the C1 box of the insulin promoter, a highly conserved region to which MafA is known to bind in a selective manner [35]. As mutational analysis has shown that the formation of MafA dimers capable of DNA binding is phosphorylation-dependent [36], [37], we used the ERK2 kinase (New England Biolabs, Ipswich, MA) to activate TAT-MafA before the reaction. As shown in fig. 2c, the use of phosphorylated TAT-MafA results in a significant mobility shift. With the exception of unphosphorylated TAT-MafA (which in our hands also exhibited basal DNA-binding activity), no other controls induced any band displacement.

TAT-MafA has biological activity in vitro

A prediction of an effective binding to the insulin promoter in vitro would be an increase in insulin expression in relevant cell substrates. A set of experiments in which mouse insulinoma cells (β-TC3) were cultured for 24 h with the protein showed that purified TAT-MafA increased insulin expression by about 15-fold (data not shown). However, recent transgenic experiments indicate that ectopic expression of MafA too early during pancreatic development arrests the differentiation and proliferation of progenitor cells, possibly by inducing cyclin kinase inhibitors p27 and p57 [38]. A conclusion of these studies was that MafA may be used to enhance maturation, rather than specification, of β cells from their progenitors. We confirmed this observation by treating explanted e14.5 pancreatic buds with TAT-MafA for 48 h. Real-Time qRT-PCR analysis showed a significant down-regulation of the key β cell markers insulin 1, insulin 2 and GLUT-2 compared to vehicle-treated controls (fig. 2d). This down-regulation did not entail any loss in overall viability. In conclusion, purified TAT-MafA is able to recognize its biological DNA target and induce the expression of the insulin promoter, but has a detrimental effect on pancreatic progenitor cells at an early stage of development (e14.5). These results indicate that TAT-MafA is active and functions in a manner consistent with the predicted biological activity of the native protein.

Targeting of the developing pancreas in utero by injection of transducible proteins

We decided to test the hypothesis that TAT-MafA has an effect on the maturation of late-stage pancreatic progenitors. However, unlike e14.5 pancreatic buds, late-stage fetal pancreata are large structures whose culture poses significant challenges in terms of appropriate oxygen and nutrient diffusion. Also, despite the known ability of TAT-fused proteins to go across relatively think structures (such as isolated islets), in our experience their penetration is rather limited beyond 300–400 microns in vitro. Because of the above considerations, the observation that we could not detect any significant difference at the gene expression level between TAT-MafA-supplemented and control e17.5 cultured pancreata was not surprising (Figure S1). However, the development of a novel intrauterine injection technique afforded us the possibility to study the role of TAT-MafA in a much more relevant in vivo model. In essence, using an ultrasound-guided approach, protein can be injected directly into the heart of embryos, from where it is distributed to all tissues, including the pancreas. This system offers a critical advantage over the in vitro setting, as the effects of the treatment can be observed without disturbing the native environment of the developing organ. Such advantage is especially significant for the study of late-stage pancreatic progenitors, because, as mentioned above, the large size of the pancreas at this time makes it difficult to establish viable organotypic cultures. This technology could also be potentially used in the context of human pre-natal therapy for a variety of conditions requiring in utero interventions (see Discussion).

We used a labeled TAT-fused version of β-galactosidase (TAT-βgal) to establish the technique. Thus, Alexa Fluor 568-labeled TAT-βgal was injected directly into the heart of e17.5 embryos as described in Methods. Viability remains high and most embryos go to term normally (data not shown). In these preliminary experiments, the embryos were retrieved 4 h after the injection and their pancreata examined by multi-photon confocal microscopy. Figure S2 shows that the pervasion of TAT-βgal throughout the majority of the organ is quite evident. Next, we repeated these experiments with our protein of interest (TAT-MafA), also labeled in the same fashion. As shown in figure 3, TAT-MafA accumulates effectively both in the liver and the pancreas, but very little in other peripheral organs such as the brain, the kidney or the heart. We therefore demonstrate that intra-cardial injection allows for the relatively selective mobilization of the protein to the hepato-pancreatic region.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. In vivo penetrability of TAT-fused proteins after in utero intra-cardiac injection.

Examined organs are indicated. A, B and C represent Alexa Fluor 568-labeled TAT-βMafA (red), phase contrast of tissue, and composite image, respectively. Images were obtained 4 h after the injection by two-photon confocal microscopy. Size bar: 500 µm.

https://doi.org/10.1371/journal.pone.0022364.g003

Injection of TAT-MafA to developing embryos in vivo induces changes in pancreatic development

In order to test the above hypothesis, we injected e17.5 embryos with purified TAT-MafA and allowed them to go to term. Controls were injected with the same vehicle used for the protein. All the embryos retrieved from each mother (4 females/group, 7–8 embryos/female) were pooled and considered an individual n for statistical analyses. This sample size (n = 4) was determined to have adequate power to detect statistical differences with an alpha error level of 5% and beta error level of 50%. Upon birth, pups were sacrificed and their pancreata collected for further analysis. No significant differences could be observed either in the size or the gross anatomy of the embryos from each group. The pancreata were similar at the macroscopic level. Tissue samples were taken for qRT-PCR, insulin extraction and immunofluorescence (IF). As shown in figure 4a, the level of expression of all the pancreatic markers analyzed by quantitative real-time RT-PCR was elevated in the experimental group vs. the control. This increase was statistically significant for the endocrine cell markers glucagon (P = 0.0254), insulin 1 (P = 0.0043) and insulin 2 (P = 0.0363). The pancreatic content of insulin in the TAT-MafA-treated embryos doubled that found in controls, as measured by ELISA (n = 4; P = 0.0009) (figure 4b). IF analysis confirmed some of these findings. Islets from TAT-MafA-treated embryos are rounded and compact, with bright insulin and glucagon staining (figure 5b and d). Control pancreata, in contrast, exhibit smaller, more ragged and less organized islets, with weaker insulin and glucagon signal (figure 5a and c). No differences in proliferation were noted (data not shown). Immunostaining for prohormone convertase 1 (PC1/3, encoded by the Pcsk1 gene), an enzyme critically involved in the biosynthesis of insulin, appears to be similar in both groups despite a trend towards higher gene expression levels in the experimental group (figure 5c and d). However, staining for the glucose transporter 2 (Glut-2) could be observed in TAT-MafA-treated pancreata co-localizing with hormone-positive cells (figure 5f) but it was virtually undetectable in the control group (figure 5e). This is in agreement with the trends observed in the gene expression analyses.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Gene and protein expression analysis of TAT-MafA-treated pancreata in neonate pups.

(A) qRT-PCR of pancreatic markers in pancreata explanted from neonate pups. Grey columns: controls (embryos injected with vehicle). Black columns: TAT-MafA-treated embryos. Bars: standard error. Y axis: -fold increase over control ( = 1). (B) Total insulin extraction of pancreata explanted from neonate embryos injected in utero with vehicle (open column) or TAT-MafA (black column). Y axis: units of insulin (pM).

https://doi.org/10.1371/journal.pone.0022364.g004

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Histological analysis of TAT-MafA-treated pancreata in neonate pups.

(A) Representative section of a control pancreas (in utero injection: vehicle), showing a disorganized pattern of β cell expression (red) in islets. (B) Representative section of a pancreas of a neonate pup treated in utero with TAT-MafA. Islets are larger, rounder and more organized than in controls. Size bars: 500 µm. (C–D) High magnification confocal microphotograph of control neonatal (C) and TAT-MafA-treated (D) pancreata. While the former exhibits small islets in the process of coalescence, islets from the latter are already larger in size. Prohormone convertase (PC) 1/3 staining (green) was similar in both samples despite a trend in favor of the experimental group by qRT-PCR (fig. 4). Glucagon staining (purple) was stronger in (D) at the same exposure. Size bars: 75 µm. (E) Glut-2 staining (green) is not evident in control samples, but can be observed in TAT-MafA samples (F). Size bars: 75 µm.

https://doi.org/10.1371/journal.pone.0022364.g005

Protein subcloning and purification

The gene sequence of human MafA was optimized for expression in E. coli by Genscript (Piscataway, NJ) and then cloned into the multicloning site of pTAT-2.1 (pET28) expression vector (kindly given by S. Dowdy, UCSD) using SacI and HindIII sites. BL21 E. coli bacteria were transformed with the plasmid, which also contains a 6xHis tag for affinity purification. Bacteria were cultured in LB medium with kanamycin (50 µg/ml) at 37°C to OD_{600 nm} = 0.8. Protein expression was induced with 1 mM IPTG (isopropyl β-D-thiogalactopyranoside) for 4 hours. After induction, the cells were harvested by centrifugation at 5,000 g for 15 min and washed with 1× PBS. The pellet was frozen at −80°C and subsequently resuspended in urea Buffer (6 M urea, 20 mM Hepes, 500 mM NaCL, 5 mM imidazole, pH 7.14) plus protease inhibitor (1 mM), lysozyme and benzonase. After incubation on ice (40 min), the pellet was sonicated (21 s pulse with 1 min between each pulse) and then centrifuged for 25 min at 12,000 g. Solubilized protein was purified by affinity chromatography on a 1 ml His-Trap column under denaturing conditions and elution in non-denaturing buffer. Chromatography was performed in three consecutive steps using a GE Healthcare Äkta purifier System (Waukeska, WI). First step: starting buffer (6 M urea, 20 mM Hepes, 500 mM NaCL, 5 mM imidazole, pH 7.14), end buffer (6 M urea, 20 mM Hepes, 500 mM NaCL, 100 mM imidazole, pH 7.14). Second step: starting buffer (6 M urea, 20 mM Hepes, 500 mM NaCL, 100 mM imidazole, pH 7.14), end buffer (20 mM Hepes, 500 mM NaCL, 100 mM imidazole, pH 7.14). Third step: starting buffer (20 mM Hepes, 500 mM NaCL, 100 mM imidazole, pH 7.14), elution buffer (20 mM Hepes, 250 mM NaCL, 750 mM imidazole, pH 7.14).

Electrophoretic mobility shift assay (EMSA)

To study the DNA-binding specificity of TAT-MafA, we used the Pierce LightShift® Chemiluminescent EMSA Kit (Cat. 20148). DNA oligos were custom ordered from Sigma-Aldrich (St Louis, MO). Hybridization of complementary DNA chains was carried out according to the thermocycler method in Technical Tip # 45 from Thermo Scientific. To determine the proper concentration of labeled DNA, the 1 pM stock of biotin-labeled DNA was diluted to various concentrations, 20 ul of which were run in a Lonza PAGEr® Gold Precast Gel (Cat. 58525) at 100 V until the dye had migrated 2/3 of the way down the gel. The gel was then transferred to a nylon membrane and biotin-labeled DNA was detected by chemiluminiscence. A dilution of 200 fmol/µl was deemed optimal for imaging. Unlabeled DNA was used as a competitor at a concentration of 10 pmol/µl for the entire procedure. TAT-MafA phosphorylation was carried out by treatment with ERK2 kinase [49] (New England Biolabs, Ipswich, MA) according to the manufacturer's instructions. Protein was treated with kinase or PBS (control). In addition, kinase alone, where PBS was used instead of TAT-MafA protein, was also included as a control. These samples were subsequently used for preparation of the three main experimental EMSA binding reactions (PBS treated TAT-MafA; ERK2 kinase treated TAT-MafA; ERK2 kinase alone). 82.15 µg of TAT-MafA protein were used. Incubation with the kinase was done at 37°C for 1 h. During the incubation, the binding reactions were prepared from the Pierce EMSA Kit along with the three kit control reactions. Phosphorylation reaction products were then subjected to an additional 20 minute incubation for protein-DNA binding. 5 µl of loading buffer were added and samples run until the dye front was ¾ of the total length of the gel. Following transfer to a nylon membrane, the samples were cross-linked and analyzed by chemiluminiscence.

In vitro culture of embryonic pancreatic buds and intrauterine embryo injection

All methods herein described involving the use of animals have been approved by the University of Miami IACUC. C57BL/6 mice (20–25 g body weight) were used for all animal experiments. Mating of the animals was set later in the day, and the following day the females were checked for vaginal plugs. Noon of that day was considered to be gestational time point e0.5. Pancreatic buds at e14.5 were explanted and cultured as described in [34]. For intrauterine embryo injection, pregnancy was confirmed by ultrasound imaging (Vevo 770, VisualSonics, Toronto, ON, Canada) at e17.5. At this time, pregnant females were anesthetized by inhalation of 2% isofluorane and placed on a preheated platform in the supine position with ECG electrodes taped to their legs to monitor the heart rate. Body temperature was maintained with the heating pad between 36°C and 38°C. Hair was removed from the abdomen using a chemical hair remover (Nair, Carter-Horner, Mississauga, ON, Canada). To provide a coupling medium for the transducer, a prewarmed ultrasound gel (Allegiance; Cardinal Health, McGaw Park, Illinois) was spread over the abdominal wall. For TAT-β-galactosidase injection experiments, protein (2 µg/ml) was labeled with Alexa Fluor 568 labeling kit (Invitrogen, Carlsbad, CA). Each visualized e17.5 embryo was injected intracardially with using a 500 µL syringe (Hamilton Company, catalogue No 81242, Reno, NV). The needle was guided using an ultrasound bio-microscope with B-mode image (Vevo 770, VisualSonics, Toronto, ON, Canada). Total volume of protein for each embryo was 10 µl. The mothers were sacrificed 4 h later and the pancreata of the embryos microdissected and examined using a multi-photon confocal microscope (Leica) to study the distribution of labeled TAT-β-galactosidase. For TAT-MafA experiments, seven to eight embryos per animal were injected with TAT-MafA (2.1 ug/µl) or protein vehicle (control). TAT alone was not used in controls because we and others have previously established that the TAT peptide is inert from a biological point of view [26], [50]. Pancreata were isolated for analysis immediately after birth (about e19.5–20.5).

Quantitative Real-Time PCR

Total RNA was purified using Qiagen kits (QIAShredder, RNeasy and DNase-free). The First-Strand system (Roche, Basel, Switzerland) was used to generate cDNA (random oligomers). Relative gene expression was calculated using Taqman assays in either 7500 Fast, StepOne Plus or 7900 Real Time PCR cyclers (Applied Biosystems, Life Technologies, Carlsbad, CA). The latter was used to run custom-made Taqman® Low Density Microarray (TLDA) cards, which allow the simultaneous qRT-PCR analysis of up to 384 samples. The ΔCt method for relative quantification was deemed optimal for our application after discussion with Applied Biosystems researchers. All assays are designed to span exon-exon junctions, thus eliminating the possibility of genomic DNA contamination. qRT-PCR results are the average of several independent experiments. In addition, in each experiment each marker was analyzed in triplicates. Gene expression was normalized against 18S rRNA. This endogenous control has been validated in our system and proven extremely stable and more accurate than other standards.

Total insulin extraction

Pancreata were lysed by ultrafreezing in the presence of 180 µl of T-PER (Thermo Scientific) and 20 µl of anti-protease (Roche), followed by physical maceration. Insulin was quantified by the LincoPlex endocrine panel kit (Linco-Invitrogen) using a Bioplex platform (Bio-Rad Laboratories, Inc).

Western blots and immunofluorescence

Western blots were done according to standard methods [50]. The primary antibody for Maf-A was Abcam ab17976 (Cambridge, MA), used at a 1∶20,000 dilution. For immunofluorescence, embryonic pancreata were fixed in 4% paraformaldehyde overnight at 4°C and then embedded in OCT for 10 µm-thick sectioning. Staining was done with primary antibodies against anti-Prohormone Convertase PC1/PC3 (AB10553; Millipore, Billerica, MA) (1∶25 dilution), GLUT2 (ab85715; Abcam, 10 mg/mL), glucacon (A0565; Dako, Glostrup, Denmark) (1∶250 dilution) and insulin (A0564; Dako) (1∶250 dilution). Secondary antibodies: Donkey anti-rabbit 488, donkey anti-mouse 647 (both from Molecular Probes/Invitrogen, Carlsbad, CA) and DyLight 594 donkey anti-guinea pig (Jackson ImmunoResearch, West Grove, PA) (1∶400 dilution). Nucleus counter-staining was done with 4′,6-diamidino-2-phenylindole (DAPI) (St. Louis, MO). Images were captured using a Leica SP5 inverted confocal microscope with motorized stage (20× dry).

Statistical analyses

Results are expressed as mean ± standard deviation (SD). The statistical significance of differences was assessed by the two-tailed Student's t test. In all comparisons, a value of P<0.05 was considered statistically significant. Sample size was determined by power analysis (5% alpha error level, 50% beta error level).