Objectives

The objective of this study is to investigate the presence of XMRV nucleic acid in seminal plasma. We hypothesize that XMRV could be present in this compartment, as it has been indisputably found in prostate cancer tissues. We choose to analyse samples from HIV-1 infected men, as they have a higher chance of contracting sexually transmitted pathogens than non-HIV-1 infected men. In addition, the concurrent detection of HIV-1 in the seminal plasma samples can serve as a control for the integrity of retroviral nucleic acid. For 39 patients, a sample from another time-point was available. As virus shedding might not be continuous, those samples were also tested. So, a total of 93 samples from 54 patients were analysed for the presence of XMRV.

Participants

Seminal plasma was separated from semen collected from either MSM participating in a study examining the semen quality in HIV-1 infected men [16], or from HIV-1 infected heterosexual men undergoing sperm-washing procedures for fertility treatment (for a review of this topic, see [17]). Patients of the latter group were mainly HIV-1 infected by heterosexual contacts, 2 patients were haemophiliacs infected by blood products, and one patient had injected drugs in the past. Patients of the MSM group were not treated with antiretroviral therapy, before or at the sampling moment, while most men in the second group were treated with diverse regimens of antiretroviral drugs. Patient characteristics are summarized in Table 1.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Characteristics of patients and virus detection results.

https://doi.org/10.1371/journal.pone.0012040.t001

Ethics

The MSM were enrolled in a study protocol on the effect of HAART on semen quality. The study was approved by the Institutional Review Board (IRB) of the Academic Medical Centre (AMC) of the University of Amsterdam and all patients gave written informed consent for their semen to be used in general research. Since 2003, the Academic Medical Centre of the University of Amsterdam offers intrauterine insemination (IUI) of HIV-1- serodiscordant couples with a HIV-1 positive man and proven HIV-1 negative woman, and patients are informed that there is no 100% guarantee that infection with HIV-1 will not take place during treatment. All patients sign informed consent.

No specific approval by the IRB of the AMC for the XMRV study was needed in The Netherlands, because the body materials for this study were collected under medical treatment, and can be used for further scientific research when the patients have given consent and samples are analysed anonymously, as was the case here (Code of Conduct as implemented by the Committee on Regulation of Research COREON of the Netherlands Epidemiological Society and the Dutch Federation of Biomedical Scientific Societies that is followed by the IRB of the AMC).

Nucleic acid isolation

Semen samples were diluted 1∶1 in Hanks balanced salt solution (HBSS; Sigma, St. Louis, MO, USA) and separated by centrifugation at 350 g for 10 minutes. The supernatant ( =  seminal plasma) was stored directly at −80°C, and thawed only once (for this study). Total nucleic acid was extracted from 200 µl of the seminal plasma samples with a method using silica and guanidium thiocyanate [18]. MS2 RNA was added before the extraction, reverse transcribed and subsequently PCR amplified, as an extraction and PCR control. One tenth of the total isolated nucleic acid was reverse transcribed with Superscript III (Invitrogen Corporation, Carlsbad, CA, USA) before performing PCR reactions, such that both viral DNA and RNA will be amplified.

HIV-1 detection

HIV-1 RNA in seminal plasma was detected with a single PCR amplifying a 723 nt fragment of the env gene. PCR primers for env gene detection were ED31 [19] and 5′ ATGGGAGGGGCATACATTGCT 3′ and PCR reactions were performed with the Superscript™ III One-step RT-PCR System with Platinum® Taq High Fidelity (Invitrogen Corporation Carlsbad, Calif., USA). Amplification was performed for 45 cycles, each cycle involved three steps: 15 sec at 94°C, 30 sec at 55°C, and 1 min at 68°C, plus a final extension of 5 min at 68°C. In addition, seminal plasma samples that were positive for HIV were quantified with a real-time PCR targeting a fragment of the pol gene as described previously [20]. In both assays the limit of detection was 50 copies HIV-1 RNA/ml. HIV-1 blood plasma viral load measurements were done at the Laboratory of Clinical Virology at the AMC (Amsterdam, The Netherlands) with the Versant HIV-1 RNA 3.0 assay (Bayer Diagnostics Division Tarrytown, N.Y.).

XMRV detection

To detect XMRV sequences in the seminal plasma samples, a reverse-transcriptase (RT) reaction was performed with SuperScript III (Invitrogen, Carlsbad, CA, USA) of 1/10 of the isolated nucleic acid, corresponding to 10 µl of the undiluted seminal plasma sample and the downstream outer primer used in the subsequent first PCR reaction; 5′ GCCGCCTCTTCTTCATTGTTCTC 3′ [1]. A first PCR amplification was performed in a total reaction volume of 50 µL with 1U Taq DNA polymerase (5U/µl, Roche Applied Science, Basel, Switzerland) and the outer primers described by Lombardi et al. [1]: 5′ATCAGTTAACCTACCCGAGTCGGAC 3′ and 5 GCCGCCTCTTCTTCATTGTTCTC 3′, amplifying a fragment of 730 nt of XMRV gag. A second PCR in a total reaction volume of 25 µL containing 5 µL of the first PCR reaction was done with the nested primers 5′GTCTTTAAGTGTTCTCGAGA 3′ and 5′ GGCTTAGGAGGTTTGGACTT 3′, amplifying a fragment of 450 nt of the gag gene of XMRV. Amplification was done for 40 cycles in the first PCR and 30 cycles for the second PCR. Each cycle involved three steps: 1 min at 95°C, 1 min at 55°C, and 2 min at 72°C, plus a final extension of 10 min at 72°C. Samples were tested twice. The detection limit of the XMRV-gag PCR is 5–10 copies input in the PCR reaction, and was assessed with the 730 nt XMRV gag fragment obtained from the 22Rv1 cell line. This fragment was cloned into the TOPO TA vector (Invitrogen, Carlsbad, CA, USA). Gag clones were confirmed by sequencing. Plasmid DNA was isolated, digested with Eco RI and fragments were excised from a 1.5% agarose gel and eluted with the NucleoSpin Extract II system (Macherey-Nagel, Dueren, Germany). Fragment concentration was determined with the Qubit™ Quantitation Platform following the manufacturers' instructions (Invitrogen, Carlsbad, CA, USA); copy numbers were subsequently calculated. As a positive PCR control, we used diluted total nucleic acid extracted from the prostate carcinoma cell line 22Rv1, containing approximately 10 copies of integrated XMRV DNA and producing viral RNA, in each PCR reaction series.

Limitations

None of the homosexual men studied here were treated with anti-retroviral drugs, but from the heterosexual men, an argument for not detecting XMRV could be that 90% of them are taking antiretroviral therapy, resulting in HIV-1 viral RNA levels in blood plasma below the detection limit. Although protease inhibitors specifically designed to inhibit HIV-encoded protease do not affect XMRV infection and replication, nor do non-nucleoside reverse-transcriptase inhibitors (NNRTI), XMRV is susceptible to the nucleoside reverse-transcriptase inhibitors (NRTI) azidothymidine (AZT) but not tenofovir in one study [22], or to AZT and tenofovir in another study [23]. In our heterosexual patient group, at least 4 patients were taking drug regimens containing AZT, which could obstruct the detection of XMRV. Tenofovir use, however, was not documented. Also, XMRV was found to be susceptible to the integrase inhibitor raltegravir [24]. Raltegravir was approved by the U.S. Food and Drug Administration (FDA) in 2007. As the patients were sampled well before that time, raltegravir use is not an explanation for not detecting XMRV.

A second alternative for not detecting XMRV in seminal plasma could be that the virus is cell-associated, and might be found in semen, but not in seminal plasma. Then, sexual transmission of the virus could still be possible. Or, it could be that XMRV is not excreted at all by the prostate.

A third alternative for the absence of XMRV in our samples could be that the XMRV found in other studies is an inadvertent laboratory contaminant, which has been reported before for other viruses, including another MuLV-related virus [25].

Taken together our results suggest that either XMRV has a low prevalence in this mainly Dutch patient group, as it cannot be found in seminal plasma of 54 HIV-1 infected men, a group with an increased possibility of acquiring sexually transmitted pathogens, or that it is not naturally present in the seminal plasma.