Search
Advanced Search
Metrics info
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article
Share this Article info
  • StumbleUpon Facebook Connotea CiteULike Bibliography
Public Library of Science

Open Access

Research Article

A Genetic Code Alteration Is a Phenotype Diversity Generator in the Human Pathogen Candida albicans

Background

The discovery of genetic code alterations and expansions in both prokaryotes and eukaryotes abolished the hypothesis of a frozen and universal genetic code and exposed unanticipated flexibility in codon and amino acid assignments. It is now clear that codon identity alterations involve sense and non-sense codons and can occur in organisms with complex genomes and proteomes. However, the biological functions, the molecular mechanisms of evolution and the diversity of genetic code alterations remain largely unknown. In various species of the genus Candida, the leucine CUG codon is decoded as serine by a unique serine tRNA that contains a leucine 5′-CAG-3′anticodon (tRNACAGSer). We are using this codon identity redefinition as a model system to elucidate the evolution of genetic code alterations.

Methodology/Principal Findings

We have reconstructed the early stages of the Candida genetic code alteration by engineering tRNAs that partially reverted the identity of serine CUG codons back to their standard leucine meaning. Such genetic code manipulation had profound cellular consequences as it exposed important morphological variation, altered gene expression, re-arranged the karyotype, increased cell-cell adhesion and secretion of hydrolytic enzymes.

Conclusion/Significance

Our study provides the first experimental evidence for an important role of genetic code alterations as generators of phenotypic diversity of high selective potential and supports the hypothesis that they speed up evolution of new phenotypes.

Isabel Miranda, Rita Rocha, Maria C. Santos, Denisa D. Mateus, Gabriela R. Moura, Laura Carreto, Manuel A. S. Santos*

Department of Biology, Centro de Estudos do Ambiente e do Mar (CESAM), University of Aveiro, Aveiro, Portugal

Abstract Top

Background

The discovery of genetic code alterations and expansions in both prokaryotes and eukaryotes abolished the hypothesis of a frozen and universal genetic code and exposed unanticipated flexibility in codon and amino acid assignments. It is now clear that codon identity alterations involve sense and non-sense codons and can occur in organisms with complex genomes and proteomes. However, the biological functions, the molecular mechanisms of evolution and the diversity of genetic code alterations remain largely unknown. In various species of the genus Candida, the leucine CUG codon is decoded as serine by a unique serine tRNA that contains a leucine 5′-CAG-3′anticodon (tRNACAGSer). We are using this codon identity redefinition as a model system to elucidate the evolution of genetic code alterations.

Methodology/Principal Findings

We have reconstructed the early stages of the Candida genetic code alteration by engineering tRNAs that partially reverted the identity of serine CUG codons back to their standard leucine meaning. Such genetic code manipulation had profound cellular consequences as it exposed important morphological variation, altered gene expression, re-arranged the karyotype, increased cell-cell adhesion and secretion of hydrolytic enzymes.

Conclusion/Significance

Our study provides the first experimental evidence for an important role of genetic code alterations as generators of phenotypic diversity of high selective potential and supports the hypothesis that they speed up evolution of new phenotypes.

Introduction Top

A number of exceptions to the standard genetic code have been discovered in prokaryotic and eukaryotic organisms, involving nonsense-to-sense and sense-to-sense codon identity changes [1], [2]. Twenty five of such alterations have been recorded in mitochondrial genetic codes of metazoan, fungi, red algae, green plants, alveolates, stramenopiles, haptophtes and euglenozoans [3]. The most remarkable alterations involve metazoan arginine AGA and AGG (AGR) codons, which changed their identity to serine at the base of the phylogenetic tree, and later on to translation-stop in vertebrates and to glycine in urochordates [4], [5].

In bacteria and eukaryotic cytoplasmic systems, 18 genetic code alterations have also been recorded, but unlike in mitochondria, they involve, with one exception, nonsense-to-sense codon identity changes or codon unassignments (codons that vanished from genomes). For example, in Micrococcus spp., Mycoplasma spp. and Pseudomicrothorax dubius the AGA/AUA, CGG and UGA codons are unassigned, respectively. In Bacillus subtilis UGA codons are used to terminate mRNA translation (stop codons) and to insert tryptophan, creating readthrough proteins [6]. In various species of ciliates, 1 or 2 stop codons changed their identity to either glutamine (UAA and UAG), glutamate (UAA) or cysteine (UGA). Interestingly, these genetic code alterations apparently minimize nonsense errors arising from re-assembly of the ciliates fragmented genome [7][10].

Those genetic code alterations show that certain codons, namely codons that start with uridine (UNN) or adenosine (ANN), in particular stop (UAA, UAG or UGA), arginine (AGR), serine (AGY) and isoleucine (AUA) codons are more prone to identity changes than others. The only exception to this first codon base rule occurs in yeast mitochondria where cytosine starting codons (CNN), namely leucine CUN codons, changed their identity to threonine. Also, the leucine CUG codon altered its identity to serine in the cytoplasm of various Candida and Debaryomyces species [11][13]. These findings suggest that the strength of the interaction of the first codon-anticodon base pair plays an important role in the evolution of genetic code alterations. Indeed, the change of identity of UAA and UAG stop codons to glutamine in various ciliates involved first base misreading by glutamine tRNAs, which decode glutamine CAA and CAG codons [8], [14]. But, it also indicates that other forces beyond codon-anticodon interaction play important roles in codon identity redefinition.

The unexpected flexibility of the genetic code described above is further highlighted by insertion of selenocystein (21st amino acid) in the active sites of prokaryotic and eukaryotic selenoproteins and insertion of pyrrolysin (22sd amino acid) in the active site of monomethylamine methyltransferase of Methanosarcina barkeri [15], [16]. These expansions involving reprogramming of UGA and UAG stop codons, respectively, highlight the potential of genetic code alterations/expansions to generate functional innovation. This hypothesis is supported by recent artificial expansion of the genetic code through synthetic biology methodologies. Indeed, 49 non-natural amino acids have already been incorporated into E. coli, yeast and mammalian cells [17][20], to produce novel proteins of biotechnological and biomedical interest. This dramatic demonstration of genetic code flexibility also unveiled an extraordinary capacity of complex organisms to tolerate partial codon identity redefinition [21].

We are using C. albicans as a model system to elucidate the evolution of genetic code alterations. In this case, a unique serine tRNA (tRNACAGSer) decodes leucine CUG codons as serine [22][24]. However, the tRNACAGSer is recognized by both leucyl- and seryl-tRNA synthetases (LeuRS and SerRS) and it is aminoacylated in vitro with both serine (97%) and leucine (3%) [25]. This unusual dual aminoacylation of the tRNACAGSer has been preserved to the present day [26], [27], raising the intriguing possibility that it may play a role in C. albicans biology. It also provides strong support for the hypothesis that codon identity redefinition is driven through codon decoding ambiguity [28], [29]. In here, we have reconstructed the early stages of the C. albicans genetic code alteration to shed new light into those questions. This partial reversion of CUG identity from serine back to leucine triggered morphogenesis, phenotypic switching, and up-regulated expression of genes involved in cell adhesion and hyphal development and increased secretion of proteinases and phospholipases. Important karyotype alterations were also observed. The overall data suggest that C. albicans CUG ambiguity is an important phenotypic diversity generator and highlight important and yet overlooked functional roles for genetic code alterations.

Results Top

Reverting CUG identity from serine back to leucine

The CUG identity alteration from leucine to serine was initiated 272±25My ago through a mutant serine tRNA (tRNACAGSer), containing a 5′-CAG-3′ anticodon, which could decode CUG codons (see introduction) [26], [22]. Initially, this unique tRNACAGSer competed with endogenous tRNALeu, which decoded CUG codons as leucine [30], creating a new situation where both leucines and serines were inserted at CUG positions on a genome wide scale (Figure 1). For reasons not yet fully understood, the wild type tRNALeu disappeared from the Candida ancestor genome leaving CUG decoding exclusively to the mutant tRNACAGSer. Disappearance of the tRNALeu should have abolished the ambiguous status of CUG codons, however the tRNACAGSer is recognized by both LeuRS and SerRS (see above), creating a serine tRNA that exists in 2 distinct forms, namely ser-tRNACAGSer (charged with serine) and leu-tRNACAGSer (charged with leucine). This ambiguous tRNA still exists in C. albicans [25].

thumbnail

Figure 1. Reconstruction model for the Candida genetic code alteration.

The ancestor of Candida decoded the CUG codon as leucine using a single leucine tRNA (tRNALeu). This situation changed dramatically with appearance 272±25My of a mutant serine tRNA that acquired a 5′-CAG-3′anticodon (tRNACAGSer). The latter competed with the tRNALeu for decoding of CUG codons, inserting both leucine and serine, at high level, at CUG positions, on a proteome wide scale. Such ambiguity decreased over time due to disappearance of the tRNALeu gene, however charging of the tRNACAGSer with leucine and serine prevented complete change of identity of the CUG codon from leucine to serine. In order to elucidate why CUG ambiguity was preserved in C. albicans and clarify whether CUG identity could be partially reverted from serine back to leucine, we have reconstructed the early stages of CUG identity change (high level of ambiguity) in C. albicans using S. cerevisiae tRNAs that decode CUG codons as leucine.

doi:10.1371/journal.pone.0000996.g001

We have re-created in C. albicans (CAI-4 strain) the high ambiguity status of CUG codons that existed 272±25 My ago in the Candida ancestor (Figure 1). For this, we have expressed Saccharomyces cerevisiae wild type and mutant tRNAs, which decode CUG codons as leucine, in C. albicans (Figure 2A–D). These tRNAsLeu competed with the novel tRNACAGSer for CUG codons at the ribosome A-site, but were not lethal. We have hypothesized that such genetic manipulation would increase CUG ambiguity and could uncover phenotypes associated to the residual ambiguity (3%) [25] of CUG codons in C. albicans.

thumbnail

Figure 2. Transfer RNAs used in this study.

In order to reconstruct the early stages of the CUG identity alteration in C. albicans, S. cerevisiae leucine tRNAs containing the anticodons UAG or CAG were expressed in C. albicans. A) The respective tRNA genes were cloned into plasmid pUA12, which is based on the C. albicans pRM1 vector. B) A leucine tRNA gene containing the near-cognate anticodon (5′-UAG-3′) for the CUG codon was used as a low decoding efficiency tRNA (pUA13). C) Two tRNACAGLeu genes, containing anticodons cognate for the CUG codon were used for higher CUG decoding efficiency, one contained G33 (pUA14; medium decoding efficiency) and the other contained U33 (pUA15; high decoding efficiency), in the anticodon-loop. D) The S. cerevisiae tRNAAGASer gene was used as negative control (pUA16).

doi:10.1371/journal.pone.0000996.g002

Three S. cerevisiae tRNALeu genes, namely a wild type tRNAUAGLeu and two mutant tRNACAGLeu (containing U33 or G33 in the anticodon-loop), plus a control tRNAAGASer (Figure 2B–D), were successfully expressed in C. albicans CAI-4 cells, as shown by Northern blot analysis of tRNAs fractionated by acidic-PAGE, which separates charged from uncharged tRNAs [31] (Figure 3A). This is in line with previous experiments that showed that the identity elements of C. albicans and S. cerevisiae LeuRS and SerRS are identical [32], [33]. Transformation efficiency of plasmids carrying the S. cerevisiae tRNALeu genes was lower than that of control plasmids (Figure 3B) containing no tRNA gene or containing a cognate serine decoder tRNA (pUA16) (Figure 2D). In other words, the tRNALeu were slightly toxic to C. albicans, which supported the hypothesis that they were fully functional and could incorporate leucine at CUG positions. Remarkably, clones that survived transformation showed no decrease in growth rate (Figure 3C), suggesting that they adapted to increased CUG ambiguity.

thumbnail

Figure 3. Expression of S. cerevisiae tRNAleu in C. albicans.

A) Aminoacylation in vivo in C. albicans of S. cerevisiae tRNAUAG/CAGLeu and tRNAAGASer was monitored by Acidic Page and Northern Blot analysis. For this, total tRNAs were extracted under acidic conditions from pUA13, pUA14, pUA15, and pUA16 clones and fractionated on an acidic polyacrylamide gel, as described in materials and methods. These gels separated deacylated (-AA) from aminoacylated tRNAs (+AA), which were detected using a tDNALeu/Ser probe labeled with [32P]. B) Transformation efficiencies of plasmids encoding tRNALeu, which decoded the C. albicans serine CUG codons as leucine, was significantly lower that that of control plasmids (pUA12 and pUA16), indicating that the leucine tRNAs were slightly toxic. C) However, clones that survived the transformation procedure adapted readily to CUG ambiguity and showed growth rates similar to control clones (pUA12).

doi:10.1371/journal.pone.0000996.g003

Ambiguous CUG decoding generated important phenotypic diversity

Interestingly, expression of those S. cerevisiae tRNALeu genes in C. albicans triggered morphogenesis in both solid and liquid media (Figure 4). The pUA15 clones displayed extensive morphological variation (Figure 4B–C) and produced highly heterogenous cell populations containing elongated-ovoid cells, pseudohypha and true hypha (not shown). Some pUA15 clones produced hypha that occupied sectors or entire colonies. Notably, morphological events that gave rise to these phenotypes happened spontaneously without external inducing factors. As expected, control pUA12 and pUA16 clones had homogeneous morphology and formed smooth-white colonies similar to those of untransformed C. albicans CAI4 (Figure 4A). Similar results were obtained with clones pUA13 and pUA14 (data not shown). Apart from morphogenesis, CUG ambiguity also induced phenotypic switching, which is a C. albicans phenotype characterized by reversible induction of opaque or myceliated sectors in white smooth colonies [34]. High frequency of phenotypic switching (63–88%) was obtained for all clones expressing S. cerevisiae leucine tRNAs (pUA13-15), but not for control clones (pUA12 and pUA16) (Figure 4D).

thumbnail

Figure 4. Ambiguous CUG decoding triggered morphogenesis and phenotypic switching.

A) Smooth colony morphology of control clones growing on MM-uri-phloxin B (50µg/ml) agar plates. B) Ambiguous pUA15 clones formed long hyphae, even in absence of external inducers, just growing in MM-uri agar plates at 30°C. Similar results were obtained for pUA13 and pUA14 ambiguous clones (data not shown). D). Expression of S. cerevisiae tRNALeu in C. albicans also induced phenotypic switching, which is characterized by transition between different cell-phase forms, namely white-opaque and myceliated-unmyceliated, giving rise to sectored colonies. D) Phenotypic switching was quantified by counting sectored colonies grown in MM-uri, after 7 days of incubation at 30°C. For each plasmid, up to 10 clones were plated and 3000 colonies were screened.

doi:10.1371/journal.pone.0000996.g004

CUG ambiguity also increased cell adhesion in liquid and solid media (Figure 5A), and once more, this phenotype was exacerbated in pUA15 clones, as they displayed strong flocculation in liquid media (Figure 5A). Interestingly, more than 50% of the genes involved in adhesion contain CUG codons. For example, the ALS gene family which encodes cell-surface glycoproteins that mediate adhesion to host surfaces [35], contain various CUG codons (3CUGs-ALS2, ALS3, ALS8; 4CUGs-ALS4; 5CUGs-ALS1; 11CUGs-ALS6; 12CUGs-ALS9; 18CUGs-ALS7). It is not yet clear whether the change of serine (polar) for leucine (hydrophobic) at CUG positions in the Als proteins is responsible for the flocculation and exacerbated agar adhesion observed in pUA15 clones. But, the strong adhesion phenotypes resulting from expression of ALA1, EAP1 and members of the C. albicans ALS gene family, namely ALS1 and ALS5 in S. cerevisiae, support the hypothesis that the replacement of serines with leucines at CUG positions increases adhesion [36][41].

thumbnail

Figure 5. Increased CUG ambiguity resulted in higher hydrolytic activity and increased adhesion.

A) Highly ambiguous cells (pUA15) exhibited strong adhesion phenotypes both in solid and liquid media. Adhesion to the solid agar surface resulted from cell-cell and cell-agar adhesion. In liquid media, cells showed a strong flocculation phenotype and sedimented even when grown with agitation (30°C for 2 days). B–C) Cells transformed with pUA13-14 (data not shown) and with pUA15 plasmids, had higher SAP and phospholipase activity than control cells, as determined by hydrolysis of BSA and egg yolk, respectively. Hydrolytic activity was quantified by measuring precipitation zones formed around the colonies, corrected by the colony diameter, in order to obtain Pz values.

doi:10.1371/journal.pone.0000996.g005

Finally, expression of S. cerevisiae tRNALeu (pUA15) in C. albicans increased production of extracellular hydrolases, namely secreted aspartic proteinases (SAP) and phospholipases, as determined on agar plates supplemented with BSA and egg yolk, respectively (Figure 5B,C). Hydrolysis of these substrates lead to formation of an halo of precipitated peptides around the colonies, indicative of SAP and phospholipase production [42]. Since adhesion, SAPs and phospholipases are important virulence attributes [43][45], those phenotypes are relevant to C. albicans pathogenesis and indicate, for the first time, that codon ambiguity and the Candida genetic code alteration may play a role in infection. It will be most interesting to put this hypothesis to experimental test as a positive result would clearly show that the negative impact of codon decoding ambiguity could be overcome by high selective potential of novel phenotypic diversity.

Gene expression alterations

In order to elucidate how CUG ambiguity generated phenotypic diversity we have carried out gene expression profiling of C. albicans cells expressing the S. cerevisiae tRNALeu (pUA15 clones), using DNA microarrays. However, the diversity of phenotypes and permanent switching between phenotypes in culture (Figure 4) created cell variability and culture instability that prevented us from obtaining meaningful mRNA expression profiles (data not shown). To overcome this limitation, we have tried to stabilize some of the phenotypes on solid media, but, once again, this turned out to be very difficult to achieve due to very high switching between morphological forms. As the mRNA profiles represented average values of a variety of phenotypes, reproducibility was low and most genes failed to pass our microarray statistical filters. Despite this, we were able to detect 4 genes whose expression was consistently altered in the microarray data sets and were relevant to the pUA15 phenotypes, namely the hypha-specific G1 cyclin-related protein HGC1 (2.64 fold), the hypha specific gene HWP1 (41,76 fold), the white-opaque switch regulator WOR1 (7 fold) and the transcription factor MCM1 regulator of hyphal growth (-1.84 fold) (Figure 6). Expression of these genes was confirmed by Real Time PCR, as described in materials and methods.

thumbnail

Figure 6. Increased CUG ambiguity up-regulated morphogenesis genes.

Cells of pUA15 clones showed significant up-regulation of the WOR1 (7.0±2.5) gene and hyphal-specific genes CaHWP1 (41.76±9.96) and HGC1 (2.64±1.12). Since WOR1 increases the frequency of the white-opaque transition the very high percentage of opaque cells found in transformed clones may be a consequence of WOR1 up-regulation. On the other hand, expression of the hypha-specific genes, CaHWP1 and CaHGC1, supported the hypothesis that morphogenesis and hyphal growth triggered by CUG ambiguity resulted from expression of morphogenesis regulators. Induction of the CaHWP1 gene was accompanied by repression of the CaMCM1 (−1.84±0.44) gene, which controls cell morphology through the recruitment of other morphogenesis regulatory factors.

doi:10.1371/journal.pone.0000996.g006

The WOR1 gene (7 fold up-regulated) is a master regulator of white-opaque switching and its expression induced the white-opaque phase transition [46], [47]. This provides a likely explanation for the strong induction of white-opaque switching in pUA15 clones, whose cells switch at high frequency. The HWP1 gene (41,76±9,96 up-regulated) encodes a hyphal-specific cell wall mannoprotein, which is a substrate for mammalian transglutaminases and plays a crucial role in adhesion of C. albicans to epithelial cells [48]. Interestingly, HWP1 expression was correlated with MCM1 repression (-1.84 fold), confirming previous results that showed that expression of one of these genes represses expression of the other [49]. MCM1 plays an important role in cell morphology and its expression is auto-regulated by a feedback control mechanism. Since both low and high Mcm1p levels lead to hyphal formation, it may act as a recruiting regulatory factor for morphogenesis in C. albicans. Depletion of Mcm1p induced transcription of HWP1, however no Mcm1p binding site was found in the HWP1 promotor and it is not yet clear how the former activates transcription of the later. Finally, the HGC1 gene was also up-regulated (2.64 fold). This gene is crucial for hyphal formation by promoting apical bud elongation and it is strongly induced during morphogenesis. It is not required for expression of hypha-specific genes (HSGs), like HWP1, but is positively regulated by the cAMP/PKA pathways and repressed by Tup1 and Nrg1 morphogenesis repressors [50].

Increased CUG ambiguity increased C. albicans ploidy

Up-regulation of the WOR1 gene and the high percentage of opaque cells (mating competent) observed in pUA15 clones prompted the question of whether CUG ambiguity would induce mating in C. albicans. Indeed, pUA15 opaque cells formed conjugation tubes and mating figures which were readily observed by optical microscopy (Figure 7A). Furthermore, flow cytometry analysis of pUA15 clones identified sub-populations of 4N, 6N and 8N cells (Figure 7B), supporting the hypothesis that ambiguous C. albicans mated at high frequency. Since C. albicans is a diploid organism with a sexual life cycle [51], and considering that its mating locus (MTL) is heterozygotic in mating incompetent white cells (MTLa/α) and homozygotic in mating competent opaque cells (MTLa/a or MTLα/α) [52], the latter were isolated from pUA15 clones and were analysed for MTL homozygozity. All clones analysed were MTLα/α, suggesting that expression of tRNALeu (pUA15) induced biased MTLα/α homozygoty (Figure 7C), creating an excess of MTLα/α over MTLa/a cells. These results were in good agreement with up-regulation of the WOR1 gene as its expression is controlled by the MTLa1-α2 heterodimer, which, in turn, controls white-opaque transition and mating competence [46], [47]. That is, switching from white-to-opaque phase required conversion of heterozygotic MTL to homozygotic MTL inducing mating competence [52]. Therefore, it is likely that MTL homozygoty induced by tRNALeu derepressed the WOR1 gene, which, in turn, promoted the white-to-opaque transition and mating.

thumbnail

Figure 7. Ambiguous CUG decoding induced mating.

A) In pUA15 transformed cells, the number of opaque cells was very high. This phenotype is most likely explained by up-regulation of the white-opaque master regulator WOR1 gene (Figure 6). Since C. albicans white cells (most common form) are mating incompetent and opaque cells (rare cells) are mating competent, we have verified whether pUA15 opaque cells formed conjugation tubes and mating figures in liquid culture. Both were readily observed using optical microscopy (white arrows). B) In order to confirm that mating occurred, the DNA content of pUA15 cells was analyzed by flow cytometry. Since C. albicans is diploid, 4N cells were expected. Surprisingly, higher ploidies (6N, 8N) were also observed suggesting that the cultures had significant number of aneuploid and poliploid cells. C) White to opaque transition and mating induced by CUG ambiguity occurs due to MTL homozygosity. Since mating requires transition from the heterozygotic mating locus (MTL a/α) found in white cells, to the homozygotic configuration (MTLa/a or MTLα/α) found in opaque cells, detection of αα/αα cells supported the hypothesis that CUG ambiguity induced mating.

doi:10.1371/journal.pone.0000996.g007

The presence of cells with high ploidy (6N and 8N) in pUA15 opaque cultures (Figure 7B), prompted us to monitor ploidy variability. Most clones showed increased ploidy ranging from 4N to 8N (data not shown), however very large cells with remarkably high ploidy (>64N) were also observed (Figure 8A). In general, ploidy variability between clones was higher than previously described [53], [54] and raised the question of whether those high chromosome numbers could return to 2N over time. Since wild type C. albicans undergoes a process of chromosome loss after mating, which decreases its ploidy from 4N back to 2N [55][57], we hypothesized that high ploidy in pUA15 clones could also be reduced. To test this hypothesis, clones with very high ploidy (large cells) were successively re-plated on fresh agar plates and their ploidy was monitored over time by flow cytometry. Indeed, ploidy reverted to 2N or 4N after several passages on fresh agar, confirming the above hypothesis (Figure 8B).

thumbnail

Figure 8. Ambiguous CUG decoding induced karyotype rearrangements and ploidy-shift.

A) In ambiguous cell lines (pUA15) polyploidy was predominant and very high ploidy was often detected (>32N). Aneuploidy was also observed (6N). B) However, after plating cells several consecutive times on fresh agar chromosome numbers were reduced indicating that most cells returned to low ploidy (2N or 4N). Ploidy reduction after mating normally occurs by chromosome loss in C. albicans and it is likely that such mechanism also played a role in ploidy reduction in pUA15 transformed cells. C) CUG ambiguity also promoted extensive rearrangements of the R-chromosome (highlighted in white circles). Chromosomes were separated by PFGE on 0.6% agarose gels under the following conditions: 120–300 s for 24h at 80 V, then 420–900 s for 48 h at 80 V. The numbers 1–7 and R identify C. albicans chromosomes.

doi:10.1371/journal.pone.0000996.g008

The above results also prompted us to check whether transformation of C. albicans with the pUA15 plasmid destabilized its karyotype. The C. albicans karyotype is characterized by frequent chromosome rearrangements, in particular of the chromosome R, which contains rDNA cistrons [58], [59]. We wondered whether the tRNALeu would affect rRNA metabolism and protein synthesis. Indeed, various rearrangements of the R-chromosome were readily observed (Figure 8C). In particular, the size of R-chromosomes increased in some clones, decreased in others and these rearrangements affected most cells (Figure 8C). It will now be most interesting to investigate whether CUG ambiguity affects ribosome assembly and the rate of protein synthesis.

Discussion Top

The identity of CUG codons is variable in the genus Candida. Indeed, C. glabrata decodes CUGs as leucine, C. cylindracea changed their identity completely to serine and the other Candida species decode them ambiguously [13], [25], [60], [61]. These differences in CUG decoding arose from differences in the structure of the tRNACAGSer, which is the only cognate tRNA for CUG codons in Candida. Indeed, the various tRNACAGSer have identity determinants for both SerRS and LeuRS [1]. For example, the C. albicans tRNACAGSer contains identity elements for the LeuRS, namely m1G37 and the middle base of the anticodon (A35), but the discriminator base at position 73 (G73) is specific for SerRS and not for LeuRS (A73 discriminator) [62]. This base is critical for the recognition of tRNAs by aminoacyl-tRNA synthetases (aaRSs) and one would expect that the LeuRS would not recognize tRNAs with G73. Therefore, charging the tRNACAGSer with leucine [25] suggests that the Candida LeuRS may have evolved a unique mode of recognition of its cognate tRNALeu. Interestingly, the presence of a unique guanosine in the turn of the anticodon-loop (G-turn) of the tRNACAGSer (G33), a conserved position occupied by U33 (U-turn), reduced leucylation efficiency of the tRNACAGSer [25]. That is, recognition of the ancestral tRNACAGSer by the LeuRS was efficient and G33 acted as a leucine identity anti-determinant. The reason for G33 selection is not yet clear, but one possibility is that it may have decreased the toxicity of the mutant tRNACAGSer during the early stages of CUG identity alteration [27], [63].

The dual recognition of the tRNACAGSer by the LeuRS and SerRS indicates that there are two forms of the tRNACAGSer in the cytoplasm of C. albicans, namely Ser-tRNACAGSer and Leu-tRNACAGSer, which are charged with serine and leucine, respectively. These 2 tRNAs generate ambiguity at CUG codons since they compete with each other for CUGs at the ribosome A-site. Interestingly, such CUG ambiguity was not constant over the 272±25My of evolution of the genetic code alteration (see introduction) [30]. It was high during the early stages of CUG identity change (when the tRNACAGSer gene appeared), and decreased gradually due to elimination of the tRNALeu gene from the genome of the Candida ancestor [30]. Reconstruction of the high level of CUG ambiguity, which existed during the early stages of CUG identity alteration, provided the first insight on how the genetic chaos created at the onset of CUG identity change may have generated phenotypic diversity of evolutionary and adaptive relevance. In extant C. albicans, morphological variation alters cell surface antigens and it is likely that this pathogen uses its sophisticated capacity to generate morphological variation as a strategy to escape the immune system. Furthermore, secreted proteinases and phospolipases are important C. albicans virulence attributes and their increased activity in pUA15 clones may also be relevant to virulence. It will now be interesting to engineer stable high level mistranslation in C. albicans and test the virulence of the recombinant strains in mice models.

The high phenotypic diversity of pUA13, pUA14 and pUA15 clones and constant transition between phenotypes prevented us from carrying out a detailed study of the impact of CUG ambiguity on gene expression. However, the strong up-regulation of the hyphal specific gene (HWP1) and of the master regulator of the white-opaque transition (WOR1), may explain, at least in part, some of the phenotypes observed. As a hyphal specific gene (HSG), high HWP1 expression, induced by CUG ambiguity, is in agreement with spontaneous morphogenesis events that generate filamentous cell populations. Furthermore, HWP1 up-regulation may also increase adhesion since Hwp1p is a glycosylphosphatidylinositol cell wall adhesin (GPI-CWP) and mediates attachment of C. albicans cells to human endothelial and epithelial cells [44]. The observed adhesion phenotype (Figure 5A) may have also resulted from the combined up-regulation of HWP1 and WOR1 genes, since the later, previously known as EAP2 (enhanced adhesion to polystyrene), mediates C. albicans and S. cerevisiae adhesion to polystyrene and epithelial cells [41].

Apart from its putative role in adhesion, up-regulation of WOR1 may also explain the white-opaque phenotype since Wor1p is a transcriptional regulator of white-opaque switching [46], [47]. Indeed, Wor1p is present in very low amounts in white cells and accumulates in opaque cells. WOR1 is repressed by the heterodimer MTL a1/α2 and is activated by Wor1p itself when cells become homozygous MTL aa/aa or MTL αα/αα. Increased accumulation of Wor1p triggered white-opaque switching and repressed its own transcription by a feedback regulatory mechanism [46], [47]. The up-regulation of the HGC1 gene (Figure 6), which is a hypha-specific gene encoding a G1 cyclin-related protein, that plays a role in hyphal morphogenesis, was also significant. Since it is transcriptionally regulated by hypha-inducing rather than cell cycle signals [50], its up-regulation in ambiguous cells supports the hypothesis that it functions independently of other cell cycle cyclins.

CUG ambiguity also generated karyotype alterations and formation of polyploids and aneuploids. Ploidy-shift has been associated with chromosomal rearrangements [53], [54], [64] which also generates morphological variation [65][67], antifungal resistance [68], adaptation to alternative carbon sources [69], [70], or even with homozigosity of chromosome-V [71]. This suggests that part of the phenotypic diversity observed in pUA13, pUA14 and pUA15 clones may have resulted from karyotype alterations, or from a combination of up-regulation of the genes described above and karyotype destabilization. Since some clones did not have karyotype alterations (Figure 8C), but still displayed phenotypic variability, it is likely that the former does not play a main role in expression of phenotypic diversity. However, one should not exclude the hypothesis that genome destabilization contributes to exposure of hidden phenotypes through ambiguous CUG decoding. Finally, in E. coli, genetic code ambiguity induced by misreading tRNAs triggered translational stress-induced mutagenesis (TSM), due to synthesis of error-prone DNA polymerases [72]. This general mistranslation resulted in increased global error rates during DNA replication leading to heritable genetic changes. Since these hypermutagenic phenotypes result in rapid adaptation, an unexpected consequence of genetic code ambiguity (and genetic code alterations) is acceleration of genome variability and fast evolution of new phenotypes. This may explain evolution of the high plasticity of Candida morphology and the very high heterozigosity of its genome [73].

Conclusions

Genetic code alterations pose important new biological questions whose answers remain elusive. It is now clear that a number of them evolved through codon decoding ambiguity, required significant structural change of protein synthesis machineries and reprogrammed codon usage [1], [5], [30]. However, codon decoding ambiguity is toxic, decreases fitness and may ultimately lead to cell death, as is the case in multicellular organisms [19], [74]. For these reasons, evolution of genetic code alterations through codon ambiguity is most puzzling. This study unveiled possible ways of overcoming the negative impact of codon ambiguity by high selective potential generated through generation of phenotypic diversity. The molecular mechanism used to generate such phenotypic diversity remains to be elucidated. However, the adaptive potential of the unveiled phenotypes strongly suggests that CUG ambiguity may have been preserved in Candida spp. as a novel generator phenotypic diversity. We have previously shown that codon ambiguity in S. cerevisiae creates a competitive edge under stress by inducing the general stress response and pre-adapting cells to sudden environmental changes [75]. Therefore, the toxicity of codon ambiguity is not an impediment to codon identity redefinition, supporting the hypothesis that codon misreading plays a critical role in the evolution of genetic code alterations and genetic code expansion.

Materials and Methods Top

Strains and growth conditions

Escherichia coli strain JM109 (recA1 SupE44 endA1 hsdR17 gyrA96 relA1 thi Δ(Lac-proAB) F'[traD36 proAB-lacI lacZ ΔM15] was used has a host for all DNA manipulations. Candida albicans CAI4 (ura3Δ::imm434/ura3::imm434) was grown at 30°C in YEPD (2% glucose; 1% yeast extract, 1% peptone). After transformation with pUA12, pUA13, pUA14, pUA15, and pUA16 plasmids, cells were grown in minimal medium lacking uridine (MM-uri) (0.67% yeast nitrogen base without amino acids, 2% glucose, 2% agar and 100µg/ml of the required amino acids). Solid MM-uri was supplemented with phloxin B (50µg/ml) in order to detect macroscopic growth of opaque cells.

Plasmids

A multi-cloning site was inserted (NruI/EcoRV) in the low-copy C. albicans vector pRM1 [76]. The resulting vector was named pUA12. For heterologous expression of the S. cerevisiae tRNAs genes in CAI4, a genomic DNA fragment containing S. cerevisiae tRNA gene (700 bp), previously amplified by PCR, was cloned into the multi cloning site of pUA12 plasmid. S. cerevisiae Leu-tRNAUAG and a 300 bp flanking region, upstream and downstream of the gene, was amplified with the following set of primers: 5′-CCGCTCGAGCGGCGACTGTCCAGACTTAGTAAAG CT-3′ and 5′-GCTCTAGAGCCCGCTGTCGCCAGCGTTAGC-3′. Genomic DNA containing S. cerevisiae tRNAGAGLeu gene was used as a template for PCR amplification using the forward primers: 5′-GCTATGGGCCCGCCTCCGGGTAGTTGCAACGGTACTC​TGGCCGAGTGGTCTAAGGCG-3′ and 5′-GCTATGGGCCCTAGTTGCAACGG TATCTGGCCGAGTGGTCTAAGGCGTCAGGTTCAGGTCC-3​′;and reverse primer 5′-ATGCATAAAAACAAAATTTGTTGAAA-3′. These primers introduced a mutation in the first position of the anticodon changing it from 5′-GAG-3′ to 5′-CAG-3′ and allowed insertion of G or T at position 33 of the tRNA anticodon-loop. Upstream of this gene, a 250 bp fragment with the same sequence of the 5′ flanking C. albicans Ser-tRNACAG gene, was also inserted. This fragment was amplified by PCR from a XhoI/ApaI genomic DNA fragment, with the following primers: 5′-CCGCTCGAGCGGGTA TGCAATCGTTGTCTGTAATGTA-3′ and 5′-GCTATGGGCCCAAGCACAAA TGGTTATGACAATTG ATG-3′. The pUA16 control plasmid was constructed by inserting a XhoI/AvaIII genomic DNA fragment (600 bp), containing S. cerevisiae Ser-tRNAAGA gene amplified by PCR with the following pair of primers 5′-CCGC TCGAGCGGGAGGATTCCTATATCCTTGAGGAG-3′ and 5′-GGCTCGATGCATG CCAGGAAGAAATACACTGC-3′, into the multicloning site. All DNA amplifications were carried out using a Mastercycle gradient (Eppendorf) and standard PCR protocols.

Plasmid transformation

Transformation of E. coli was carried out as described by [77] CAI4 transformation was performed by the spheroplast method as described in the Manual for Preparation and Transformation of Pichia pastoris Spheroplasts (version A, Invitrogen).

Northern Blot analysis

Acidic Northern Blot analysis was performed as described by Santos et al. (1996). For total tRNA extractions, 250 ml cultures grown overnight in YEPD or MM-uri medium were harvested at an OD600 of 0.7–0.9 and the pellets were frozen at −70°C overnight. Cells were resuspended in 5 ml lysis buffer (0.3M sodium acetate, pH 4.5, 10 mM EDTA), 1 vol. phenol equilibrated with sodium citrate pH 4.5 and baked glass beads. Cell suspension was vigorously shaken >30 seconds and incubated on ice for periods longer than 30 seconds, this procedure was repeated 8 times [78]. The aqueous phase containing RNAs was separated from the phenolic phase by centrifugation at 3200×g for 20 min at 4°C and then transferred to a new Falcon tube and re-extracted with fresh phenol. Aqueous phases containing RNAs were harvested by centrifugation at 3200×g for 20 min at 4°C and applied to a 20 ml DEAE-cellulose column equilibrated with 0.1 M sodium acetate pH 4.5. tRNAs were eluted with 0.1 M sodium acetate/1 M sodium chloride and precipitated with 2.5 vol. ethanol, resuspended in 10 mM sodium acetate pH 5.0/1 mM EDTA, and stored a −20°C. The deacylated tRNAs were obtained by incubation at 37°C for 1 h in 1 M Tris pH 8, 1 mM EDTA buffer [26].

tRNAs were fractionated at 4°C in 7.5% acrylamidde-8 M urea (30 cm long, 0.8 mm thick), buffered with 0.1 M sodium acetate pH 5.0. The 7.5% acidic gels were run at 300 V until bromophenol blue dye reached the bottom [31]. Fractionated tRNAs were transferred to nitrocellulose membranes (Hybond N, Amersham). Membranes were pre-hybridized for 6 h in a Hybridization oven at 50°C in 50% formamide, 5×SSC, 1% SDS, 0.04% Ficoll, 0.04% polyvinylpyrrolidone and 250 μg/ml sheared salmon sperm DNA [79]. Hybridization was performed overnight in the above buffer using probes labelled with [α-32P]dCTP by PCR, using standard protocols [80], except that the amount of dCTP was reduced from 100 to 50 mM and 5 nmol (30 μCi) 6000 Ci/mmol [α-32P]dCTP was added to the reaction mixture. In order to decrease the background level of free radioactivity, 50 PCR cycles were performed to decrease the amount of non-incorporated [α-32P]dATP. Membranes were washed at low stringency in 1×SSC, 0.5% SDS at 50°C or at high stringency in 0.1×SSC, 0.5% SDS at 65°C for 1 h. The membranes were exposed overnight with intensifying screens and developed using a Molecular Imager FX (Biorad).

Switching frequencies and phenotypic characterization

C. albicans grown overnight at 30°C in MM-uri were serially diluted to 1000 cells per ml. Approximately 50 cells were plated onto fresh agar plates and then allowed to grow at 30°C for 7 days in a humidified incubator to prevent drying of the agar surface. Sectored colonies displaying atypical colonies were scored and the data was analyzed for statistical significance using ANOVA. Colonies were photographed using a Stemi 2000-C dissecting microscope equipped with AxioCam HRc camera and Axio Vision Software from Zeiss. Cells were photographed using a Zeiss MC80 Axioplan 2 light microscope.

Real Time RT-PCR

Total RNA was prepared from C. albicans using hot acid phenol [81]. First-strand cDNA synthesis was carried out using the Superscript II RT kit from Invitrogen and its quantification was carried out in an Applied Biosystems 7500 Real Time PCR system using the SYBR Green I dye quantification assay (Power SYBR Green PCR master Mix). Primer concentrations were tested (0,2 to 0,4 µM) to ensure the lowest threshold cycle (CT) and the highest signal magnitude against the target template and to ensure non-specific product formation, resulting from primer dimmerization. After amplification, reactions were checked for presence of non-specific products through dissociation curve analysis. Each gene was quantified using 9 replicas of both control (pUA12) and ambiguous (pUA15) clones and a mean value was calculated. Outliers were rejected using critical values of Dixon's “Q” parameter at 95% confidence level [82].

Determination of extra cellular hydrolytic activity

C. albicans strains were screened for the production of extra cellular phospholipase and secreted aspartic proteinase activity by growing cells on MM-uri agar supplemented with 10% egg yolk (Merck) and 10% bovine albumin (Sigma), respectively. A 3×2 µl suspension of 107cells/ml in PBS was plated on the surface of the agar medium and left to dry at room temperature. The culture was then incubated at 30°C for 3 days, after which the diameter of the colony and the precipitation zone around the colony was determined. Three different clones of pUA12, pUA13, pUA14 and pUA15 transformed cells were tested twice. The experiment was carried out on two different occasions. The extra cellular hydrolase activity was calculated using the formula [(1/Pz)-1], where Pz value represents the hydrolyse zone, i. e., the cloudy-zone-around-plus-colony diameter divided by the colony diameter [83]. Data obtained was submitted to an ANOVA statistical test.

Genome analysis

DNA content of C. albicans cells was determined using FACS analysis [84]. Karyotype analysis was performed using Pulsed-Field Gel Electrophoresis (PFGE) [85].

MTL analysis

PCR analysis of the MTL configuration was carried out in pUA12 and pUA15 cells, through amplification of oBPα and MTLa1 genes, respectively, using the following pairs of primers: 5′ GTGGTCAATGGAGCTGATAC 3′and 5′ ACATGTGGTCGCCCAACTCC 3′; 5′ TTGAAGCGTGAGAGGCAGGAG 3′ and 5′ ATCAATTCCCTTTCTCTTCGATTAGG 3′.

Acknowledgments Top

We are most grateful to Jorge Rino for helping with the light microscopy studies, Alexander Johnson for providing oBP primers and Concha Gil for the pRM1 plasmid.

Author Contributions Top

Conceived and designed the experiments: MS. Performed the experiments: GM RR IM MS DM. Analyzed the data: MS GM IM LC. Contributed reagents/materials/analysis tools: MS. Wrote the paper: MS IM.

References Top

  1. Santos MA, Moura G, Massey SE, Tuite MF (2004) Driving change: the evolution of alternative genetic codes. Trends Genet 20: 95–102. Find this article online
  2. Miranda I, Silva R, Santos MA (2006) Evolution of the genetic code in yeasts. Yeast 23: 203–213. Find this article online
  3. Knight RD, Landweber LF, Yarus M (2001) How mitochondria redefine the code. J Mol Evol 53: 299–313. Find this article online
  4. Castresana J, Feldmaier-Fuchs G, Paabo S (1998) Codon reassignment and amino acid composition in hemichordate mitochondria. Proc Natl Acad Sci U S A 95: 3703–3707. Find this article online
  5. Knight RD, Freeland SJ, Landweber LF (2001) Rewiring the keyboard: evolvability of the genetic code. Nat Rev Genet 2: 49–58. Find this article online
  6. Lovett PS, Ambulos NP Jr, Mulbry W, Noguchi N, Rogers EJ (1991) UGA can be decoded as tryptophan at low efficiency in Bacillus subtilis. J Bacteriol 173: 1810–1812. Find this article online
  7. Caron F, Meyer E (1985) Does Paramecium primaurelia use a different genetic code in its macronucleus? Nature 314: 185–188. Find this article online
  8. Harper DS, Jahn CL (1989) Differential use of termination codons in ciliated protozoa. Proc Natl Acad Sci U S A 86: 3252–3256. Find this article online
  9. Sanchez-Silva R, Villalobo E, Morin L, Torres A (2003) A new noncanonical nuclear genetic code: translation of UAA into glutamate. Curr Biol 13: 442–447. Find this article online
  10. Le Mouel A, Butler A, Caron F, Meyer E (2003) Developmentally regulated chromosome fragmentation linked to imprecise elimination of repeated sequences in paramecia. Eukaryot Cell 2: 1076–1090. Find this article online
  11. Tuite MF, Santos MA (1996) Codon reassignment in Candida species: an evolutionary conundrum. Biochimie 78: 993–9. Find this article online
  12. Jukes TH, Osawa S (1996) CUG codons in Candida spp. J Mol Evol 42: 321–322. Find this article online
  13. Sugita T, Nakase T (1999) Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79–86. Find this article online
  14. Hanyu N, Kuchino Y, Nishimura S, Beier H (1986) Dramatic events in ciliate evolution: alteration of UAA and UAG termination codons to glutamine codons due to anticodon mutations in two Tetrahymena tRNAs. EMBO J 5: 1307–1311. Find this article online
  15. Hao B, Gong W, Ferguson TK, James CM, Krzycki JA, et al. (2002) A new UAG-encoded residue in the structure of a methanogen methyltransferase. Science 296: 1462–1466. Find this article online
  16. Lee BJ, Worland PJ, Davis JN, Stadtman TC, Hatfield DL (1989) Identification of a selenocysteyl-tRNA(Ser) in mammalian cells that recognizes the nonsense codon, UGA. J Biol Chem 264: 9724–9727. Find this article online
  17. Bacher JM, Ellington AD (2001) Selection and characterization of Escherichia coli variants capable of growth on an otherwise toxic tryptophan analogue. J Bacteriol 183: 5414–5425. Find this article online
  18. Bacher JM, Crecy-Lagard V, Schimmel PR (2005) Inhibited cell growth and protein functional changes from an editing-defective tRNA synthetase. Proc Natl Acad Sci U S A 102: 1697–1701. Find this article online
  19. Nangle LA, Motta CM, Schimmel P (2006) Global effects of mistranslation from an editing defect in mammalian cells. Chem Biol 13: 1091–1100. Find this article online
  20. Chin JW, Cropp TA, Anderson JC, Mukherji M, Zhang Z, et al. (2003) An expanded eukaryotic genetic code. Science 301: 964–967. Find this article online
  21. Hendrickson TL, Crecy-Lagard V, Schimmel P (2004) Incorporation of nonnatural amino acids into proteins. Annu Rev Biochem 73: 147–176. Find this article online
  22. Santos MA, Perreau VM, Tuite MF (1996) Transfer RNA structural change is a key element in the reassignment of the CUG codon in Candida albicans. Embo J 15: 5060–8. Find this article online
  23. Santos MA, Tuite MF (1995) The CUG codon is decoded in vivo as serine and not leucine in Candida albicans. Nucleic Acids Res 23: 1481–1486. Find this article online
  24. Ohama T, Suzuki T, Mori M, Osawa S, Ueda T, et al. (1993) Non-universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21: 4039–45. Find this article online
  25. Suzuki T, Ueda T, Watanabe K (1997) The ‘polysemous’ codon--a codon with multiple amino acid assignment caused by dual specificity of tRNA identity. Embo J 16: 1122–34. Find this article online
  26. Santos MA, Keith G, Tuite MF (1993) Non-standard translational events in Candida albicans mediated by an unusual seryl-tRNA with a 5′-CAG-3′ (leucine) anticodon. Embo J 12: 607–16. Find this article online
  27. Perreau VM, Keith G, Holmes WM, Przykorska A, Santos MA, et al. (1999) The Candida albicans CUG-decoding ser-tRNA has an atypical anticodon stem-loop structure. J Mol Biol 293: 1039–1053. Find this article online
  28. Schultz DW, Yarus M (1996) On malleability in the genetic code. J Mol Evol 42: 597–601. Find this article online
  29. Schultz DW, Yarus M (1994) Transfer RNA mutation and the malleability of the genetic code. J Mol Biol 235: 1377–1380. Find this article online
  30. Massey SE, Moura G, Beltrao P, Almeida R, Garey JR, et al. (2003) Comparative evolutionary genomics unveils the molecular mechanism of reassignment of the CTG codon in Candida spp. Genome Res 13: 544–557. Find this article online
  31. Varshney U, Lee CP, RajBhandary UL (1991) Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J Biol Chem 266: 24712–24718. Find this article online
  32. O'Sullivan JM, Davenport JB, Tuite MF (2001) Codon reassignment and the evolving genetic code: problems and pitfalls in post-genome analysis. Trends Genet 17: 20–22. Find this article online
  33. O'Sullivan JM, Mihr MJ, Santos MA, Tuite MF (2001) Seryl-tRNA synthetase is not responsible for the evolution of CUG codon reassignment in Candida albicans. Yeast 18: 313–322. Find this article online
  34. Soll DR (2002) Phenotypic Switching. Candida and Candidiasis 123–142. Find this article online
  35. Hoyer LL (2001) The ALS gene family of Candida albicans. Trends Microbiol 9: 176–80. Find this article online
  36. Fu Y, Rieg G, Fonzi WA, Belanger PH, Edwards JE, et al. (1998) Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells. Infect Immun 66: 1783–1786. Find this article online
  37. Rauceo JM, Gaur NK, Lee KG, Edwards JE, Klotz SA, et al. (2004) Global cell surface conformational shift mediated by a Candida albicans adhesin. Infect Immun 72: 4948–4955. Find this article online
  38. Gaur NK, Smith RL, Klotz SA (2002) Candida albicans and Saccharomyces cerevisiae expressing ALA1/ALS5 adhere to accessible threonine, serine, or alanine patches. Cell Commun Adhes 9: 45–57. Find this article online
  39. Gaur NK, Klotz SA, Henderson RL (1999) Overexpression of the Candida albicans ALA1 gene in Saccharomyces cerevisiae results in aggregation following attachment of yeast cells to extracellular matrix proteins, adherence properties similar to those of Candida albicans. Infect Immun 67: 6040–6047. Find this article online
  40. Gaur NK, Klotz SA (1997) Expression, cloning, and characterization of a Candida albicans gene, ALA1, that confers adherence properties upon Saccharomyces cerevisiae for extracellular matrix proteins. Infect Immun 65: 5289–5294. Find this article online
  41. Li F, Palecek SP (2003) EAP1, a Candida albicans gene involved in binding human epithelial cells. Eukaryot Cell 2: 1266–1273. Find this article online
  42. Ibrahim AS, Mirbod F, Filler SG, Banno Y, Cole GT, et al. (1995) Evidence implicating phospholipase as a virulence factor of Candida albicans. Infect Immun 63: 1993–8. Find this article online
  43. Naglik JR, Challacombe SJ, Hube B (2003) Candida albicans Secreted Aspartyl Proteinases in Virulence and Pathogenesis. Microbiol Mol Biol Rev 67: 400–428. Find this article online
  44. Sundstrom P (2002) Adhesion in Candida spp. Cell Microbiol 4: 461–469. Find this article online
  45. Ghannoum MA (2000) Potential role of phospholipases in virulence and fungal pathogenesis. Clin Microbiol Rev 13: 122–43. Find this article online
  46. Zordan RE, Galgoczy DJ, Johnson AD (2006) Epigenetic properties of white-opaque switching in Candida albicans are based on a self-sustaining transcriptional feedback loop. Proc Natl Acad Sci U S A 103: 12807–12812. Find this article online
  47. Huang G, Wang H, Chou S, Nie X, Chen J, et al. (2006) Bistable expression of WOR1, a master regulator of white-opaque switching in Candida albicans. Proc Natl Acad Sci U S A 103: 12813–12818. Find this article online
  48. Staab JF, Bradway SD, Fidel PL, Sundstrom P (1999) Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 283: 1535–8. Find this article online
  49. Rottmann M, Dieter S, Brunner H, Rupp S (2003) A screen in Saccharomyces cerevisiae identified CaMCM1, an essential gene in Candida albicans crucial for morphogenesis. Mol Microbiol 47: 943–959. Find this article online
  50. Zheng X, Wang Y, Wang Y (2004) Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis. EMBO J 23: 1845–1856. Find this article online
  51. Hull CM, Johnson AD (1999) Identification of a mating type-like locus in the asexual pathogenic yeast Candida albicans. Science 285: 1271–5. Find this article online
  52. Miller MG, Johnson AD (2002) White-opaque switching in Candida albicans is controlled by mating-type locus homeodomain proteins and allows efficient mating. Cell 110: 293–302. Find this article online
  53. Iwaguchi SI, Kanbe T, Tohne T, Magee PT, Suzuki T (2000) High-frequency occurrence of chromosome translocation in a mutant strain of Candida albicans by a suppressor mutation of ploidy shift. Yeast 16: 411–422. Find this article online
  54. Suzuki T, Hitomi A, Magee PT, Sakaguchi S (1994) Correlation between polyploidy and auxotrophic segregation in the imperfect yeast Candida albicans. J Bacteriol 176: 3345–3353. Find this article online
  55. Bennett RJ, Johnson AD (2003) Completion of a parasexual cycle in Candida albicans by induced chromosome loss in tetraploid strains. EMBO J 22: 2505–2515. Find this article online
  56. Magee BB, Magee PT (2000) Induction of mating in Candida albicans by construction of MTLa and MTLalpha strains. Science 289: 310–3. Find this article online
  57. Hull CM, Raisner RM, Johnson AD (2000) Evidence for mating of the “asexual” yeast Candida albicans in a mammalian host. Science 289: 307–10. Find this article online
  58. Lasker BA, Carle GF, Kobayashi GS, Medoff G (1989) Comparison of the separation of Candida albicans chromosome-sized DNA by pulsed-field gel electrophoresis techniques. Nucleic Acids Res 17: 3783–3793. Find this article online
  59. Magee BB, Magee PT (1987) Electrophoretic karyotypes and chromosome numbers in Candida species. J Gen Microbiol 133: 425–430. Find this article online
  60. Santos MA, Ueda T, Watanabe K, Tuite MF (1997) The non-standard genetic code of Candida spp.: an evolving genetic code or a novel mechanism for adaptation? Mol Microbiol 26: 423–431. Find this article online
  61. O'Sullivan JM, Santos MA, Tuite MF (2002) Standard and nonstandard mRNA decoding in Candida. Candida and Candidiasis 279–292. Find this article online
  62. Breitschopf K, Gross HJ (1994) The exchange of the discriminator base A73 for G is alone sufficient to convert human tRNA(Leu) into a serine-acceptor in vitro. EMBO J 13: 3166–3167. Find this article online
  63. Santos MA, Perreau VM, Tuite MF (1996) Transfer RNA structural change is a key element in the reassignment of the CUG codon in Candida albicans. EMBO J 15: 5060–5068. Find this article online
  64. Selmecki A, Bergmann S, Berman J (2005) Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol Microbiol 55: 1553–1565. Find this article online
  65. Rustchenko-Bulgac EP, Howard DH (1993) Multiple chromosomal and phenotypic changes in spontaneous mutants of Candida albicans. J Gen Microbiol 139 Pt 6: 1195–1207. Find this article online
  66. Rustchenko-Bulgac EP, Sherman F, Hicks JB (1990) Chromosomal rearrangements associated with morphological mutants provide a means for genetic variation of Candida albicans. J Bacteriol 172: 1276–83. Find this article online
  67. Suzuki T, Kobayashi I, Kanbe T, Tanaka K (1989) High frequency variation of colony morphology and chromosome reorganization in the pathogenic yeast Candida albicans. J Gen Microbiol 135: 425–434. Find this article online
  68. Perepnikhatka V, Fischer FJ, Niimi M, Baker RA, Cannon RD, et al. (1999) Specific chromosome alterations in fluconazole-resistant mutants of Candida albicans. J Bacteriol 181: 4041–4049. Find this article online
  69. Rustchenko EP, Howard DH, Sherman F (1997) Variation in assimilating functions occurs in spontaneous Candida albicans mutants having chromosomal alterations. Microbiology 143 ( Pt 5): 1765–1778. Find this article online
  70. Janbon G, Sherman F, Rustchenko E (1998) Monosomy of a specific chromosome determines L-sorbose utilization: a novel regulatory mechanism in Candida albicans. Proc Natl Acad Sci U S A 95: 5150–5155. Find this article online
  71. Legrand M, Lephart P, Forche A, Mueller FM, Walsh T, et al. (2004) Homozygosity at the MTL locus in clinical strains of Candida albicans: karyotypic rearrangements and tetraploid formation. Mol Microbiol 52: 1451–1462. Find this article online
  72. Dorazi R, Lingutla JJ, Humayun MZ (2002) Expression of mutant alanine tRNAs increases spontaneous mutagenesis in Escherichia coli. Mol Microbiol 44: 131–141. Find this article online
  73. Jones T, Federspiel NA, Chibana H, Dungan J, Kalman S, et al. (2004) The diploid genome sequence of Candida albicans. Proc Natl Acad Sci U S A 101: 7329–7334. Find this article online
  74. Lee JW, Beebe K, Nangle LA, Jang J, Longo-Guess CM, et al. (2006) Editing-defective tRNA synthetase causes protein misfolding and neurodegeneration. Nature 443: 50–55. Find this article online
  75. Santos MA, Cheesman C, Costa V, Moradas-Ferreira P, Tuite MF (1999) Selective advantages created by codon ambiguity allowed for the evolution of an alternative genetic code in Candida spp. Mol Microbiol 31: 937–947. Find this article online
  76. Pla J, Gil C, Monteoliva L, Navarro-Garcia F, Sanchez M, et al. (1996) Understanding Candida albicans at the molecular level. Yeast 12: 1677–702. Find this article online
  77. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
  78. Weygand-Durasevic I, Nalaskowska M, Soll D (1994) Coexpression of eukaryotic tRNASer and yeast seryl-tRNA synthetase leads to functional amber suppression in Escherichia coli. J Bacteriol 176: 232–239. Find this article online
  79. Heitzler J, Marechal-Drouard L, Dirheimer G, Keith G (1992) Use of a dot blot hybridization method for identification of pure tRNA species on different membranes. Biochim Biophys Acta 1129: 273–277. Find this article online
  80. Innis MA, Gelfand DH, Sninsky JJ, White TJ (1990) PCR protocols: A Guide to Methods and Applications.
  81. Kohrer K, Domdey H (1991) Preparation of high molecular weight RNA. Methods Enzymol 194: 398–405. Find this article online
  82. Rorabacher DB (1991) Statistical Treatment for Rejection of Deviant Values - Critical-Values of Dixon Q Parameter and Related Subrange Ratios at the 95-Percent Confidence Level. Analytical Chemistry 63: 139–146. Find this article online
  83. Samaranayake LP, Raeside JM, MacFarlane TW (1984) Factors affecting the phospholipase activity of Candida species in vitro. Sabouraudia 22: 201–207. Find this article online
  84. Fortuna M, Sousa MJ, Côrte-Real M, Leão C, Salvador A, et al. (2000) Cell Cycle Analysis of Yeasts. Current Protocols in Cytometry 11.13.1–11.13.9. Find this article online
  85. Chu WS, Magee BB, Magee PT (1993) Construction of an SfiI macrorestriction map of the Candida albicans genome. J Bacteriol 175: 6637–6651. Find this article online
Post Your Note (For Public Viewing)
Compose Your Note
 
Declare any competing interests.

Notes and Corrections can include the following markup tags:

Emphasis: ''italic''  '''bold'''  '''''bold italic'''''

Other: ^^superscript^^  ~~subscript~~

Add a note to this text.
Please follow our guidelines for notes and comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  • Remarks that could be interpreted as allegations of misconduct
  • Unsupported assertions or statements
  • Inflammatory or insulting language
Add a note to this text.
You must be logged in to add a note to an article. You may log in by clicking here or cancel this note.
Add a note to this text.
You cannot annotate this area of the document. Close
Add a note to this text.
You cannot create an annotation that spans different sections of the document; please adjust your selection.
Close
Rate This Article
Please follow our guidelines for rating and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  1. Remarks that could be interpreted as allegations of misconduct
  2. Unsupported assertions or statements
  3. Inflammatory or insulting language
Compose Your Annotation
 
Declare any competing interests.

Ratings can include the following markup tags:

Emphasis: ''italic''  '''bold'''  '''''bold italic'''''

Other: ^^superscript^^  ~~subscript~~

All site content, except where otherwise noted, is licensed under a Creative Commons Attribution License.