Search
Advanced Search
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article

Open Access

Research Article

A Revision of Malagasy Species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae)

Brian L. Fisher1*, M. Alex Smith2*

1 Department of Entomology, California Academy of Sciences, San Francisco, California, United States of America, 2 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada

Abstract

Species inventories are essential for documenting global diversity and generating necessary material for taxonomic study and conservation planning. However, for inventories to be immediately relevant, the taxonomic process must reduce the time to describe and identify specimens. To address these concerns for the inventory of arthropods across the Malagasy region, we present here a collaborative approach to taxonomy where collectors, morphologists and DNA barcoders using cytochrome c oxidase 1 (CO1) participate collectively in a team-driven taxonomic process. We evaluate the role of DNA barcoding as a tool to accelerate species identification and description.

This revision is primarily based on arthropod surveys throughout the Malagasy region from 1992 to 2006. The revision is based on morphological and CO1 DNA barcode analysis of 500 individuals. In the region, five species of Anochetus (A. boltoni sp. nov., A. goodmani sp. nov., A. grandidieri, and A. madagascarensis from Madagascar, and A. pattersoni sp. nov. from Seychelles) and three species of Odontomachus (O. coquereli, O. troglodytes and O. simillimus) are recognized. DNA barcoding (using cytochrome c oxidase 1 (CO1)) facilitated caste association and type designation, and highlighted population structure associated with reproductive strategy, biogeographic and evolutionary patterns for future exploration.

This study provides an example of collaborative taxonomy, where morphology is combined with DNA barcoding. We demonstrate that CO1 DNA barcoding is a practical tool that allows formalized alpha-taxonomy at a speed, detail, precision, and scale unattainable by employing morphology alone.

Introduction

Anochetus and Odontomachus were treated globally by Brown [1], [2]. This paper revises the genera for the Island of Madagascar and also includes new records from the Seychelles and Comoro Islands. The revision is based on morphological and CO1 sequence analysis of 500 individuals. We evaluate the role of DNA barcoding as a tool to accelerate species identification and description.

Anochetus and Odontomachus are closely related genera [1], [3], [4] characterized by long and straight mandibles inserted just on either side of the cephalic midline and with two or three large teeth near tip arranged in a vertical series (Figure 1a,b). The single tooth or spine at the apex of the petiole separates Odontomachus from the closely related genus Anochetus (which has two teeth or rounded margin). Odontomachus and Anochetus can also be easily distinguished by the characters on the back of the head. With head viewed from back near neck of pronotum, Odontomachus has dark, inverted V-shaped apophyseal lines that converge to form a distinct, sometimes shallow groove or ridge on upper back of head. In Anochetus, the V-shaped apophyseal lines are absent. In the same region of the back of head, however, nuchal carinae in Anochetus form an uninterrupted, inverted U-shaped ridge. In the field, small members of Anochetus might also be mistaken for Strumigenys, from which they may be distinguished by their one-segmented waist (vs. two segments in Strumigenys).

thumbnail

Figure 1. oblique dorsal view of head.

A, Anochetus madagascarensis. B, Odontomachus coquereli.

doi:10.1371/journal.pone.0001787.g001

The utility of a standardized single gene for species recognition (but not phylogenetics) has been tested in an increasing swath of life. Here we tested how well a cytochrome c oxidase 1 (CO1) DNA barcode resolved species within Malagasy Anochetus and Odontomachus. In Madagascar, these ponerine genera are known to include species with independent colony formation by ergatoid (wingless) queens – and therefore are expected be a challenge for DNA barcoding using a single mitochondrial marker – but also include cases where prior taxonomy has not linked males with females and workers, nor has resolved obvious worker dimorphism as either caste variation or provisional species.

Species level taxonomy in these genera can be quite difficult. Brown [2] noted that males provide a useful source for species level delimitation. Males, however, are rarely associated with the worker castes. Brown [2:553] states: “Unfortunately, males found associated in the nest with the female castes are known only for a minority of the species. Additional kinds of males are known from collections at light or by Malaise trap, but it has not yet been possible to link any of these securely to worker-based species.”

In this study, we used CO1 barcode sequences to associate worker, queen and male castes. We conclude that DNA barcoding will enable species delimitation, linking a greater range of the morphological diversity in ants (castes and sex), and further will provide a set of molecular characters that improve species delimitation and identification while making these hypotheses transparent and reproducible.

Methods

This revision is primarily based on arthropod surveys in Madagascar that included over 6,000 leaf litter samples, 4,000 pitfall traps, and 8,000 additional hand collecting events throughout Madagascar from 1992 through 2006 [5]. Also included are specimens from museums in Genoa, Geneva, Paris, London, Berlin, Tervuren, and Basel and the extensive collection of Gary D. Alpert located at the MCZC. Overall, this revision included the study of approximately 1,700 specimens of Anochetus and Odontomachus from 1014 recorded collecting events from throughout Madagascar with additional samples from Comoros and Seychelles. Roy Snelling (LACM) provided the records of O. simillimus from his work on the ants of Seychelles. Samples were selected for CO1 sequencing throughout the geographic range of each species. In total, 501 specimens were sequenced. Specimens examined from Madagascar are listed by increasing latitude within provinces.

All species and type material examined in this study have been imaged and are available on AntWeb (www.antweb.org). Material was deposited at the California Academy of Sciences, San Francisco (CASC); British Museum of Natural History, London (BMNH); and Museum of Comparative Zoology, Harvard University, Cambridge, Massachusetts (MCZC). All sequences, oligonucleotides and electropherograms are deposited in BOLD (www.barcodinglife.org), and sequence data has been deposited on Genbank.

In accordance with section 8.6 of the ICZN's International Code of Zoological Nomenclature, we have deposited copies of this article at the following five publicly accessible libraries: Natural History Museum, London, UK; American Museum of Natural History, New York, USA; Museum National d'Histoire Naturelle, Paris, France; Russian Academy of Sciences, Moscow, Russia; Academia Sinica, Taipei, Taiwan. The three new species names established herein have been prospectively registered in ZooBank [6][8], the official online registration system for the ICZN. The ZooBank publication LSID (Life Science Identifier) for the new species described herein can be viewed through any standard web browser by appending the LSID to the prefix “http://zoobank.org/”.

New specific names in this work are attributive genitive nouns and thus invariant. Each specimen discussed below is uniquely identified with a specimen-level code (e.g. CASENT0003099) affixed to each pin. In addition, each specimen may include a collection code, which is a field number that uniquely identifies collecting events (e.g. BLF01652). Collection codes, when available, are associated with a collector and follow the collector's name.

Digital color images were created using a JVC KY-F75 digital camera and Syncroscopy Auto-Montage (v 5.0) software. All measurements were taken at 80× power with a Leica MZ APO microscope using an orthogonal pair of micrometers, recorded to the nearest 0.001 mm, and rounded to two decimal places for presentation. When more than one specimen was measured, minimum and maximum measurements and indices are presented. Measurements follow those used by Brown [1], [2]. Abdominal segments are noted by “A” and the segment number, such as A2 for the petiole and A3 for the first gastral segment.

Abbreviations used:

HL

Head length: measured in full-face view; maximum longitudinal length from the anteriormost portion of the projecting mandible joint (the dorsal socket where the mandible turns) to the midpoint of a line across the posterior margin. (male: including ocelli)

HW

Head width: Anochetus: maximum width of head; Odontomachus: HW (across upper eye margin): maximum width of head measured across posterior margin of eyes; HW (across vertex): maximum width of head measured across temporal prominences. In O. coquereli, which lacks temporal prominences, the measurement is taken across the part of the vertex at which the sides are nearly parallel near or a little behind the midlength of the head. (male: including eyes)

ML

Mandible length: The straight-line length of the mandible at full closure, measured in the same plane for which the HL measurement is taken (full face view), from the mandibular apex to the anterior clypeal margin, or to the transverse line connecting the anterior most points in those taxa where the margin is concave medially.

EL

Eye length: maximum length of eye as measured normally in oblique view of the head to show full surface of eye.

SL

Scape length: maximum chord length excluding basal condyle and neck.

WL

Weber's length (Mesosoma length): in lateral view of the mesosoma, diagonal length from posteroventral corner of propodeum to the farthest point on anterior face of pronotum, excluding the neck.

PW

Pronotum width: in dorsal view, maximum width of pronotum.

FL

Femur length: Maximum length of hind femur.

CI

Cephalic index: HW/HL×100.

SI

Scape index: SL/HW×100.

MI

Mandible Index: ML/HL×100

Specimens of Anochetus and Odontomachus were examined from the following collections:

BMNH

Natural History Museum, London, U. K.

CASC

California Academy of Sciences, San Francisco, CA, USA

LACM

Los Angles County Museum, Los Angeles, CA, USA

MCZC

Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA

MHNG

Muséum d'Histoire Naturelle, Geneva, Switzerland

MNHN

Muséum National d'Histoire Naturelle, Paris, France

MRAC

Musée Royal de l'Afrique Centrale, Tervuren, Belgium

MSNG

Museo Civico de Historia Natural “Giacomo Doria”, Genoa, Italy

NHMB

Naturhistorisches Museum, Basel, Switzerland

PSWC

P. S. Ward Collection, University of California at Davis, CA, USA

CO1 methods

Specimens were preserved in 95% ethanol in Madagascar and upon return to California were loaded into ScrewTop TrakMates® boxes (Matrix Technologies) and shipped to the University of Guelph. There, DNA was extracted from tissues rich in mitochondria (e.g. legs), employing primers with high universality, and amplifying a PCR product approximately 600 bp in length. Total genomic DNA extracts were prepared from small pieces (≤1 mm) of tissue using the NucleoSpin® 96 Tissue kit (Macherey-Nagel Duren, Germany), following the manufacturer's protocols. Extracts were resuspended in 30 µl of dH2O, and a 650base-pair (bp) region near the 5′ terminus of the CO1 gene was amplified following standard protocol [9]. Briefly, full length sequences were amplified using primers (LF1-ATTCAACCAATCATAAAGATATTGG and LR1-TGATTTTTTGGACATCCAGAAGTTTA [10]). In cases where a 650 bp product was not successfully generated, internal primer pairs (LF1–ANTMR1-(see Table 1)) and (MLF1 – GCTTTCCCACGAATAAATAATA [11] – LR) were employed to generate shorter overlapping sequences that allowed the creation of a composite sequence (contig). PCR reactions were carried out in 96 well plates in 12.5 µl reaction volumes containing: 2.5 mM MgCl2, 5 pmol of each primer, 20 µM dNTPs, 10 mM Tris HCl (pH 8.3), 50 mM KCl, 10–20 ng (1–2 µl) of genomic DNA, and 1 unit of TaqDNA polymerase (Platinum® Taq DNA Polymerase - Invitrogen) using a thermocycling profile of one cycle of 2 min at 94°C, five cycles of 40 sec at 94°C, 40 sec at 45°C, and 1 min at 72°C, followed by 36 cycles of 40 sec at 94°C, 40 sec at 51°C, and 1 min at 72°C, with a final step of 5 min at 72°C. Products were visualized on a 2% agarose E-Gel® 96-well system (Invitrogen) and samples containing clean single bands were bidirectionally sequenced using BigDye v3.1 on an ABI 3730xl DNA Analyzer (Applied Biosystems). Contigs were made using Sequencher v4.0.5 (Gene Codes) and were subsequently aligned by eye in Bioedit [12]. Sequence divergences were calculated using the K2P distance model [13] and a NJ tree of distances [14] was created to provide a graphic representation of the patterning among-species divergences using MEGA3 [15], and BOLD [16]. Sequence neutrality [Tajima's D - 17] and rates of substitution were calculated with DnaSP v.3 [18]. Sequences and other specimen information are available in the project file “Revision of Malagasy Anochetus and Odontomachus” in the Published Projects section of the Barcode of Life website (www.barcodinglife.org) with complete collection information for each specimen deposited at www.antweb.org. All sequences from the barcode region have been deposited in Genebank (CO1: EF610629: EF611041, EF999925-EF999945).

thumbnail

Table 1. Primers used to generate sequences and molecular tests.

doi:10.1371/journal.pone.0001787.t001

A composite representation of variation within the CO1 DNA barcode for each of the eight species revised here is presented in Figures 15 and 16. We used the online program Fingerprint [19 - http://evol.mcmaster.ca/fingerprint] to illustrate the heterogeneity at a specific site within the barcode region as a percentage of the vertical line drawn to represent each base pair.

Diagnostic base pairs (or combination of base pairs) for each species within the Malagasy region are presented. This more cladistic interpretation of the DNA barcode data is very sensitive to the number of specimens analyzed – and the fewer specimens incorporated, the greater the likelihood that a rare haplotype is not reflected in the data. We present this method of analysis not to that our coverage of each species is sufficient to reflect the variation within a species, but rather to demonstrate that such an analysis is possible within a group of taxa or region, when there is good representation of the variability within a species. The nucleotide position given refers to the barcode region, and can be compared to their full mitochondrial position by adding 48 (as aligned to the Bos taurus complete mitochondrial genome sequence Genbank ref AY676873). The standard IUPAC ambiguity codes are used to denote intra-specific variation.

Complementary genetic analyses. In addition to the CO1 barcode, for some specimens we amplified portions of the rRNA gene regions: 18S, 28S (D2) and ITS1. Within the variable D2 region of 28S, the forward primer corresponds to positions 3549–3568 in Drosophila melanogaster reference sequence (Genbank M21017). Within the 18S sequence, the forward primer corresponds to positions 375–406 in Drosophila melanogaster reference sequence while the ITS1 sequence was generated using primers where the forward primer corresponds to positions 1822–1843 in Drosophila melanogaster reference sequence. Representative sequences have been deposited in Genbank: 18S: EU041960-EU042009; 28S: EU042010-EU042038, EU073708:EU073711; ITS1: EU042039-EU042097, EU073664: EU073707). Primers used to generate these fragments are listed in Table 1. In some cases we utilized a standard PCR diagnostic to test for Wolbachia [20]. Wolbachia are obligate intracellular endosymbiotic bacteria that cause reproductive incompatibility between infected and uninfected lineages, resulting in an increased proportion of infected maternal lineages that cannot reproduce.

Results

Taxonomic synopsis

Check-List of Malagasy Anochetus Species

  1. boltoni sp. nov.

  2. goodmani sp. nov.

  3. grandidieri Forel, 1891

  4. = madecassus Santschi, 1928

  5. madagascarensis Forel, 1887

  6. = africanus var. friederichsi Forel, 1918

  7. pattersoni sp. nov.

Key to workers and queens of Malagasy Anochetus

  1. Inner mandibular blade without preapical teeth and denticles (Figs 3a, 4a). . .2

    Inner mandibular blade with at least four preapical teeth and denticles (Figs 2a,e). . .4

  2. Worker compound eye large, >0.15 mm long. In full face view, antennal scape extends beyond posterior margins of occipital lobe. Dorsal surface of head and mesosoma with or without numerous short setae. . .3

    Worker compound eyes small, <0.15 mm long. In full face view, antennal scape usually fail to reach, and never surpass, posterior margin of occipital lobe. Dorsal surface of head with numerous short setae (Fig. 3a). . .grandidieri

  3. Dorsal surface of head and mesosoma without numerous short setae (Fig. 3a). Pronotal dorsum glassy smooth. . .madagascarensis

    Dorsal surface of head and mesosoma with numerous short setae (Figs 7a,b). Pronotal dorsum with punctures anteriorly and longitudinal ridges posteriorly (Aldabra). . .pattersoni

  4. Petiolar node as seen from front or rear with apical margin deeply concave, lateral corner forming long spine (Fig. 5a). . .boltoni

    Petiolar node as seen from front or rear with apical margin rounded, or slightly flattened, the lateral corner without spine (Fig. 5b). . .goodmani

thumbnail

Figure 2. Anochetus spp. full face and lateral view.

A–B, boltoni worker CASENT0104542. C–D, boltoni male CASENT0063847. E–F, goodmani worker CASENT0104543. G–H, goodmani ergatoid queen CASENT0454531.

doi:10.1371/journal.pone.0001787.g002
thumbnail

Figure 3. Anochetus grandidieri full face and lateral view.

A–B, large worker CASENT0497580. C–D, small worker CASENT0033463. E–F, large queen CASENT0041177. G–H, small queen CASENT0498467. I–J, male CASENT0049858.

doi:10.1371/journal.pone.0001787.g003
thumbnail

Figure 4. Anochetus madagascarensis full face and lateral view.

A–B, worker CASENT0104547. C–D, queen CASENT0498419. E–F, male CASENT0049282.

doi:10.1371/journal.pone.0001787.g004
thumbnail

Figure 5. Anochetus workers, upper part of petiole from front view.

A, boltoni CASENT0104542. B, goodmani CASENT0104543. C, grandidieri (large form) CASENT0497580. D, madagascarensis CASENT0498309.

doi:10.1371/journal.pone.0001787.g005

Key to males of Malagasy Anochetus (males of goodmani unknown and not included)

  1. Shortest distance between lateral ocellus and margin of compound eye smaller than maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners rounded, without acute spine or sharp tooth. . .2

    Shortest distance between lateral ocellus and margin of compound eye distinctly greater than maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners with acute spine or tooth. . .3

  2. Body yellowish brown. Petiolar node as seen from front or rear with apical margin concave. Paramere simple with rounded apex (Fig. 8c). . .madagascarensis

    Body dark brown, black. Petiolar node as seen from front or rear with apical margin more or less flat. Paramere constricted apically into a ventrally-directed digitiform lobe (Fig. 8d). . .pattersoni

  3. Head and mesoscutum with dense reticulate sculpture, opaque, not smooth or shiny. Declivitous surface of propodeum abrupt, about as long as dorsal surface. . .grandidieri

    Head and mesoscutum with week sculpture, smooth and shiny areas present. Declivitous surface of propodeum gradually sloping posteriorly, indistinctly delimited from dorsal surface. . .boltoni

Anochetus boltoni Fisher sp. nov.

urn:lsid:zoobank.org:act:B6C072CF-1CA6-40C7-8396-534E91EF7FBB

Figures: worker 2a,b, 5a; male 2c,d, 8a; map 6a

Type Material: Holotype worker, MADAGASCAR: Antsiranana, Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina, 14°26′12″S, 049°46′30″E, 450 m, sifted litter, rainforest, 12–15 Nov 2003 (coll. B. L. Fisher et al.), comma collection code: BLF08985 pin code: CASENT0104542 (CASC). Paratype. 8 workers with same data as holotype but pins coded, CASENT0487895, CASENT0487896, CASENT0487897, CASENT0006943. (BMNH, MCZ, CAS); CO1 Barcode from paratype collection and coded CASENT0487895-D01

Worker measurements: maximum and minimum based on all specimens, n = 20, (holotype): HL 1.80–2.08 (1.95), HW 1.61–1.89 (1.71), CI 87–98 (88), EL 0.33–0.41 (0.36), ML 1.15–1.25 (1.20), MI 59–66 (61), SL 1.83–1.96 (1.84) SI 101–115 (107), WL 2.63–2.89 (2.73), FL 1.97–2.13 (2.03), PW 0.95–1.06 (1.00).

Male measurements: maximum and minimum based on n = 2 from Madagascar: HL 0.89–0.91, HW 1.05–1.13, CI 118–125, EL 0.56–0.62, SL 0.24, SI 21–23, WL 2.20–2.24, FL 1.75–1.80

Worker Diagnosis: Blade of mandible with five teeth and denticles located along distal two thirds of blade's length. Propodeum with short teeth (Fig. 5a). Dorsolateral margin of petiole with long spine (Fig. 5a). In frontal view, petiolar margin deeply U-shaped. Pilosity, sculpture as in Figures 2a,b.

Male caste: Dorsolateral margin of petiole with acute spine.

The species is most similar to A. goodmani, but can be easily distinguished by its petiole node with a pair of large apical spines.

Distribution and biology. The distribution is limited to collections made between 450 m and 750 m in rainforest in Parc National de Marojejy and 240 m from Ambanitaza near Antalaha (Fig. 4a). It has been collected three times in rotten logs and once in a leaf litter sample. Males have been collected in malaise samples on 20–25 Dec 2004 at 488 m in Parc National de Marojejy

CO1. The two populations where collections have been made to date are characterized by a deep divergence within the DNA barcode region (Maximum – 8%) (Fig. 15).

Diagnostic barcoding loci. A. boltoni: ATCT-42-45 & RTTAR-66-70

Discussion: Specimens from Ambanitaza differ notably in shape of propodeal spines and length of spines on petiole from those of the type locality. Though these localities are quite close (40 km apart), these character differences are noticeable, and correspond to significant differences in CO1 (34 base pairs) and ITS1. While specimens from each location were invariant within 18S, there is a 7 bp insertion within ITS1 that is characteristic of the Ambanitaza population which is missing from all specimens from Marojejy. Ultimately, more collections need to be made and evaluated in order to test the hypothesis that these populations represent separate species. One important factor to consider in the testing of that hypothesis is reproductive strategy, which is, to our knowledge, through fission. Though the queen caste is not known, based on overall similarity of workers with A. goodmani, it is likely that the queen of boltoni is wingless. Queens have never been collected during the 12 month malaise trap sampling even though males were collected. Species that reproduce by fission may show greater geographic differences in morphology and CO1.

Additional material examined for Anochetus boltoni: In addition to the type material, specimens from 4 additional collecting events from the following three localities were examined in this study. MADAGASCAR: Province Antsiranana: Parc National de Marojejy, Manantenina River, 27.6 km 35° NE Andapa; Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa; Forêt Ambanitaza, 26.1 km 347° Antalaha. This material shows greater variation in number of denticles along blade of mandible, ranging from 5–7, compared to the paratypic material.

Anochetus goodmani Fisher sp. nov.

urn:lsid:zoobank.org:act:C7D27B95-E1F0-41AC-968C-76BCF3886010

Figures: worker 2e,f; queen 2g,h; map 6a

Type Material: Holotype worker, MADAGASCAR, Forêt de Binara, 7.5 km 230° SW Daraina, 13°15′18″S, 049°37′00″E, 375 m, 1–4 Dec 2003 (coll. B. L. Fisher et al.), collection code: BLF09638, pin code: CASENT0498309 (CAS). Paratypes: 8 workers with same data as holotype but pins coded, CASENT104548, CASENT0498310, CASENT0498311, CASENT0006944, CASENT0006945 (BMNH, MCZ, CAS); CO1 Barcode from paratype collection and coded CASENT0498310-D01.

Worker measurements: maximum and minimum based on all specimens, n = 15, (holotype): HL 1.77–2.01 (1.92), HW 1.55–1.81 (1.77), CI 86–92 (92), EL 0.35–0.43 (0.42), ML 1.04–1.15 (1.11), MI 56–66 (58), SL 1.68–1.97 (1.79) SI 101–109 (101), WL 2.52–2.89 (2.66), FL 1.85–2.17 (2.03), PW 0.92–1.06 (1.01).

Queen (ergatoid) measurements: maximum and minimum based on n = 5. HL 1.62–1.79, HW 1.49–1.65, CI 91–93, EL 0.37–0.41, ML 0.92–1.02, MI 55–59, SL 1.56–1.71, SI 99–106, WL 2.33–2.55, FL 1.77–1.91, PW 0.88–0.99.

Worker Diagnosis: Blade of mandible with five teeth and denticles located at the distal half of the blade length. Petiole dorsal margin without spines. In front view, the dorsal petiolar margin flat with lateral margin rounded (Fig. 6b). Pilosity, sculpture as in Figures 2e,f.

thumbnail

Figure 6. collection localities of Anochetus specimens in Madagascar.

Map shows major ecoregions: east (light gray): rainforest, central (dark gray): montane forest; west (white): tropical dry forest; southwest (medium gray): desert spiny bush thicket.

doi:10.1371/journal.pone.0001787.g006

The species is most similar to A. boltoni but can be easily distinguished by its petiole node without apical spines.

No winged queens are known. Ergatoid queens were collected at six localities. In four of the collections, three ergatoid queens were collected in the same locality. They are very similar in size and shape to workers (Figs 2g,h), and have no ocelli (Fig. 2g). Males are not known.

Distribution and biology. A. goodmani is endemic to Madagascar and is widespread in northern and western parts of the island. It has been collected in dry forest and rainforest as low as 30 m in altitude and also in montane rainforest at the altitude 960 m on Montagne d'Ambre (Fig. 6a), most frequently under stones (12 collections) and sifted litter (7), but also at light (1), beating low vegetation (3), rot pocket (1), in rotten log (6), ground foragers (1), ground nest (9), Malaise trap (1), on low vegetation (1), and pitfall traps (4).

CO1. Average intraspecific sequence divergence of 6.37%. There is strong geographic coherence in the divergence patterns (Figs 9, 15, Table 2) with deep divergences occurring between separate regions isolated by habitat and mountains.

thumbnail

Table 2. Anochetus goodmani within-species pair-wise partitioning of genetic variance for the CO1 DNA barcode. K2P distances are beneath the diagonal and the number of substitutions are above the diagonal.

doi:10.1371/journal.pone.0001787.t002

Diagnostic barcoding loci. A. goodmani: Y-231 (madagascarensis and grandidieri A; boltoni and pattersoni T), W-233 (all others A), RWR-368-370 (others are all ATG), Y-541 (others are all T), R-543 (others are all A), W-546 (others are all T), W-585 (others are all T), M-634 (others are all C). RWCW-42-45 & WTTAG-66-70 (this distinguishes goodmani from all (including boltoni) except some madagascarensis), & GT-83-84 (madagascarensis is TA).

Discussion. Anochetus goodmani is characterized by extreme divergence within the barcode region. To date, sequencing complementary nuclear markers has provided some degree of support for the deepest CO1 divergences (between the north and south-west of Madagascar) as being separate species. Importantly however, ITS1 sequences as divergent have been produced from the same individual (Appendix S1 and Table 3). Although CO1 supports more than one operational unit within A. goodmani the hypothesis of cryptic species in relatively isolated environments requires further evidence with less ambiguity.

thumbnail

Table 3. Comparison of the utility of various complimentary nuclear markers for species diagnosis in the ponerine ants of the Malagasy.

doi:10.1371/journal.pone.0001787.t003

Additional material examined for Anochetus goodmani: In addition to the type material, specimens from 56 additional collecting events from the following 18 localities were examined in this study. MADAGASCAR: Province Antsiranana: Montagne des Français, 7.2 km 142° SE Antsiranana; Parc National Montagne d'Ambre; Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord; Réserve Spéciale de l'Ankarana, 22.9 km 224° SW Anivorano Nord; Forêt d'Ampondrabe, 26.3 km 10° NNE Daraina; Forêt d' Andavakoera, 21.4 km 75° ENE Ambilobe; 4.6 km 356° N Betsiaka; Forêt d' Antsahabe, 11.4 km 275° W Daraina; Forêt de Binara, 7.5 km 230° SW Daraina; Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha; Forêt d'Anabohazo, 21.6 km 247° WSW Maromandia; Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy; Parc National Tsingy de Bemaraha, 10.6 km ESE 123° Antsalova; Parc National Tsingy de Bemaraha, 2.5 km 62° ENE Bekopaka, Ankidrodroa River; Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba. Province Toliara: Parc National de Kirindy Mite, 16.3 km 127° SE Belo sur Mer.

Anochetus grandidieri Forel

Figures: worker 3a–d, 5c; queen 3e–h; male 3i–j, 8b; map 6b

Type material:

Anochetus grandidieri Forel, 1891: 108 [21]. Lectotype: worker, Madagascar, Forest of the east coast (M. Humblot) (MHNG), present designation [examined], AntWeb CASENT0101819. Brown, 1978: 606 [2] (description of worker).

Anochetus madecassus Santschi, 1928: 54 [22]. Lectotype: dealate queen, Madagascar, Nossi-Bé (Descarpentries) (NHMB) Lectotype by present designation [examined] AntWeb CASENT0101098. Synonymized with grandidieri by Brown, 1978: 557 [2].

Worker measurements: maximum and minimum based on all specimens, n = 20. HL 0.79–1.19, HW 0.71–1.06, CI 85–95, EL 0.08–0.13, ML 0.33–0.57, MI 41–54, SL 0.57–0.88, SI 78–86, WL 0.87–1.35, FL 0.57–0.90, PW 0.44–0.62.

Queen measurements: maximum and minimum based on n = 5. HL 0.88–1.15, HW 0.81–1.07, CI 92–96, EL 0.17–0.23, ML 0.39–0.56, MI 44–49, SL 0.62–0.87, SI 77–81, WL 1.08–1.46. FL 0.68–0.96, PW 0.60–0.78.

Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.58–0.73, HW 0.78–0.94, CI 129–135, EL 0.37–0.46, SL 0.10–0.15, SI 13–16, WL 1.17–1.52, FL 0.78–1.08

Worker diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05–0.11 mm), projecting dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and sculpture as in Figures 3 a–d.

Queens alate: Very similar to workers, only slightly larger than respective size class (Figs 3e–h). Ergatoid queens not recorded.

Within a single locality, two size classes of workers, queens and males are present in this species, but the differences within a site do not hold up when variation across all sites is included. These differences suggest that two reproductive and developmental pathways can occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger the development of small and large castes.