Novel Bread Wheat Lines Enriched in Carotenoids Carrying Hordeum chilense Chromosome Arms in the ph1b Background

María-Dolores Rey; María-Carmen Calderón; María Jesús Rodrigo; Lorenzo Zacarías; Enriqueta Alós; Pilar Prieto

doi:10.1371/journal.pone.0134598

Abstract

The use of crop wild relative species to improve major crops performance is well established. Hordeum chilense has a high potential as a genetic donor to increase the carotenoid content of wheat. Crosses between the 7H^ch H. chilense substitution lines in wheat and the wheat pairing homoeologous1b (ph1b) mutant allowed the development of wheat-H. chilense translocation lines for both 7H^chα and 7H^chβ chromosome arms in the wheat background. These translocation lines were characterized by in situ hybridization and using molecular markers. In addition, reverse phase chromatography (HPLC) analysis was carried out to evaluate the carotenoid content and both 7H^chα∙7AL and 7AS∙7H^chβ disomic translocation lines. The carotenoid content in 7H^chα∙7AL and 7AS∙7H^chβ disomic translocation lines was higher than the wheat-7H^ch addition line and double amount of carotenoids than the wheat itself. A proteomic analysis confirmed that the presence of chromosome 7H^ch introgressions in wheat scarcely altered the proteomic profile of the wheat flour. The Psy1 (Phytoene Synthase1) gene, which is the first committed step in the carotenoid biosynthetic pathway, was also cytogenetically mapped on the 7H^chα chromosome arm. These new wheat-H. chilense translocation lines can be used as a powerful tool in wheat breeding programs to enrich the diet in bioactive compounds.

Citation: Rey M-D, Calderón M-C, Rodrigo MJ, Zacarías L, Alós E, Prieto P (2015) Novel Bread Wheat Lines Enriched in Carotenoids Carrying Hordeum chilense Chromosome Arms in the ph1b Background. PLoS ONE 10(8): e0134598. https://doi.org/10.1371/journal.pone.0134598

Editor: Wujun Ma, Murdoch University, AUSTRALIA

Received: May 22, 2015; Accepted: July 13, 2015; Published: August 4, 2015

Copyright: © 2015 Rey et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by the ERC Starting Grant 243118 (http://www.ias.csic.es/ercstg-superwheatcrops/).

Competing interests: The authors have declared that no competing interests exist.

Introduction

Wild species of bread wheat Triticum aestivum (2n = 6x = 42, genome AABBDD) are important resources for broadening the genetic variability of crop plants and useful traits have been transferred from these species to wheat [1]. Hordeum chilense (2n = 2x = 14, genome H^chH^ch) is an extremely polymorphic diploid wild barley from South of America. It has high crossability with other members of the Triticeae tribe and presents several agronomical characteristics which could be transferred into wheat, such as high carotenoid content among others [2–6]. Hordeum chilense addition and substitution lines in wheat [7–9] are generally used as a bridge to generate wheat-H. chilense translocation or recombinant lines [10–11]. However, pairing between wheat and related chromosomes from these species is rare [12]. Chromosome pairing between homoeologous (related) chromosomes can be achieved using the ph1b mutant [10]. The Ph1 locus, which is located on the 5BL chromosome arm, ensures chromosome pairing and recombination between homologous (identical) chromosomes [13–16]. In the absence of the Ph1 locus (pairing homoeologous1 locus; ph1b mutant) unspecific chromosome associations can occur between related chromosomes and therefore can be used to induce homoeologous recombination [17]. An extensive molecular analysis of the region including the Ph1 locus has been carried out, and the Ph1 locus has been restricted to a 2.5 Mb region containing a cluster of Cdk-2 (cyclin dependent kinase-2) related genes [18], and regulates premeiotic replication, chromatin condensation, transcription of the earliest meiotic gene (Asy1), homologue pairing/synapsis, resolution of incorrect pairing at pachytene and recombination [19–21].

The ph1b mutant can be used to facilitate interspecific recombination between chromosomes from wheat and those chromosomes from related species to transfer desirable agronomics traits from those relatives into wheat [22]. For example, bread wheat has lower carotenoid contents than other plant species [23]. Carotenoids are a diverse family of natural isoprenoid pigments responsible of the characteristic color, from pale yellow to red, of different plant tissues and organs [24]. Carotenoids play crucial roles in many plant physiological processes and are essential for animals since some of them are the precursors of vitamin A and have a broad range of function, as antioxidants and other health-related properties [25]. Since carotenoids are almost exclusively synthetized by plants, and certain fungi and bacteria, animals and humans rely upon the diet as the source of these compounds. Carotenoids can be grouped in two main classes: carotenes, which are tetraterpenoid hydrocarbons, and xanthophylls, which are carotenoids with one or more oxygenated groups in the molecule. Lutein, a xanthophyll which accumulates in eye macula and plays an essential role in human vision, is the main carotenoid found in wheat, and is, in most cases, accompanied by lower amounts of zeaxanthin, β-cryptoxanthin and β-carotene [26–29]. The chromosomal location of genes involved in carotenoid synthesis in H. chilense was deciphered using H. chilense addition lines in wheat [2]. The presence of chromosome 7H^ch of H. chilense increased the carotenoid content in wheat, and moreover, the ditelosomic addition line for 7H^chα chromosome arm showed greater influence on the pigment content [2]. A chromosomal region on the distal part of chromosome 7H^chβ of H. chilense related to the carotenoid content has been recently reported [30]. New genes controlling the carotenoid content were also found in the genome of H. chilense, such as Carot1 and Zds (codifying for a zeta-carotene desaturase) genes, located on the centromeric region of chromosome 2H^ch and the Psy1 (Phytoene synthase 1) gene, which was located on the 7H^chα chromosome arm [30–32]. In fact, the enzyme PSY catalyses the first step of the carotenoids biosynthetic pathway and it is considered a limiting factor for carotenoid production [33].

Genomic in situ hybridization (GISH) is the most efficient and accurate technique to estimate the amount of alien chromatin introgressed in wheat [34]. Moreover, fluorescence in situ hybridization (FISH) combined with GISH enables the determination of the exact chromosomal compositions and resolutions of the chromosome arms involved in wheat-H. chilense translocations [35]. In situ hybridization can be also used to physically map single-copy genes on mitotic chromosomes [36].

Classical genetic breeding can result in undesirable side-effects as a consequence of the alteration of the genomic composition. Thus it is important to evaluate the quality of the introgression lines produced by conventional breeding. Ten to fifteen percent of the wheat grain dry weight are proteins, mainly storage proteins, which are the major responsible of dough properties, and also other minority proteins which might modify flour quality and/or be involved in hypersensitivity reactions such as food allergy and celiac disease [37–42]. Hence, deciphering the composition of the endosperm proteins through proteomics approaches is useful to evaluate the potential interest of wheat introgression lines.

In this paper, we describe the development and characterization of new wheat-H. chilense translocation lines for both 7H^chα and 7H^chβ chromosome arms with the aim of increasing the wheat carotenoid content. In addition, the Psy1 gene, the first committed step in the carotenoid biosynthetic pathway, was cytogenetically mapped on H. chilense chromosome 7H^ch. The study is supplemented by an analysis of the proteomic profile of the flour of these new wheat-H. chilense translocation lines with a higher carotene content.

Material and Methods

Plant material

Hordeum chilense substitution lines for chromosome 7H^ch in bread wheat [7] were used as parental lines in initial crosses with the wheat line deficient for the Ph1 locus (Triticum aestivum cv. `Chinese Spring´ (CS), ph1bph1b genotype; [22, 43]). The descendence was backcrossed by the wheat ph1b mutant to obtain chromosome 7H^ch in the ph1b mutant background as described in Fig 1. Seeds from the descendence of the backcrosses were germinated in Petri dishes on wet filter papers in darkness for 5 days at 4°C followed by 24 hours incubation at 25°C. Roots about 1 cm long were cut, incubated for 4 hours in a 0.05% colchicine solution at 25°C and then fixed in 100% ethanol- acetic acid, 3:1 (v/v). Fixed roots were stored at 4°C for at least 1 month to perform cytogenetic experiments. All plants were grown in a greenhouse at 26°C (day) and 22°C at night with a photoperiod of long days (16 h of daylight—8 h of darkness).

Download:

Fig 1. Development of H. chilense introgression lines in hexaploid wheat in the ph1b mutant background.

Crosses between the 7H^ch substitution line in bread wheat and the ph1b mutant were developed and backcrossed to the ph1b mutant to obtain Hordeum translocation in the absence of the Ph1 locus.

https://doi.org/10.1371/journal.pone.0134598.g001

Characterization of the translocation lines using molecular markers

Genomic DNA was extracted from frozen young leaf tissue using the cetyltrimethylammonium bromide (CTAB) method [44] with some modifications according to [45]. Bread wheat ph1b mutants were checked for the ph1b deletion using the ABC₉₂₀ SCAR marker as previously described [46]. The PCR reactions were performed in 30 μl of reaction mixture containing 1x PCR buffer with MgCl₂ (Bioline USA, Taunton, MA), 0.25 mM dNTPs, 5 pmol primers, 0.02 U/ μl of Taq DNA polymerase (Bioline USA, Taunton, MA). The PCR cocktail was initially denatured at 94°C for 5 min, and then the amplification reaction consisted in 35 cycles of 1 min at 94°C, 1 min at 51°C and 1 min at 72°C, followed by a final extension reaction of 7 min at 72°C. The PCR products were solved on 1% agarose gels in 1xTBE and visualized by ethidium bromide staining under UV light. The presence of both 7H^chα and 7H^chβ chromosome arms was analyzed using the microsatellites BAWU550 and BAWU763, respectively, as described in [47]. The confirmation of the wheat chromosome involved in chromosome translocations (chromosome 7A) was also carried out using the microsatellites Xgwm471-7AS, Xgwm332-7AL as described in [48].

Cytogenetic analysis

GISH experiments were performed according to [49] using genomic H. chilense DNA as probe to confirm the presence of chromosome 7H^ch. Sonicated salmon sperm DNA was used as blocking DNA (salmon sperm DNA: DNA probe, 2:1). The identification of the 7H^chα or 7H^chβ chromosomes arms was also confirmed by FISH using the pAs1 sequences [50–51]. The wheat chromosome arms involved in inter-specific translocations with the H. chilense chromosome 7H^ch were also identified using both the GAA-satellite sequence [52–53] and the pAs1 probe [51] as described in [54].

Physical mapping of Psy1

Physical localization of Psy1 gene from the carotenoid biosynthetic pathway was performed by in situ hybridization. A 2538bp genomic region of the Psy1 gene was amplified by PCR in a (7A)7H^ch substitution line in bread wheat to be used as a probe in further in situ hybridization experiments. A pair of primers was designed using the Primer3plus software [55] based on the Psy1 sequence previously described in H. chilense (GenBank accession number HM598415) [32, 56–57]. The sequences for the forward and reverse primers used for Psy1 amplification were, 5’AGTGGTGAATCCATCCCTTG3’ and 5’CCTTCCTCTTCTTGCACTGG3’, respectively. PCR amplification for Psy1 gene was performed using MyFi DNA polymerase (Bioline USA, Taunton, MA) according to the manufacturer´s instructions as follows: 3 min 94°C, 35 cycles of 15 s at 94°C, 15 s at 60°C and 3.5 min at 72°C. PCR products were resolved on 1% agarose gels in 1xTBE and stained with ethidium bromide and visualized under UV light. The PCR fragments corresponding to the Pys1 locus amplified from both H. chilense (used as a positive control) and the (7A)7H^ch substitution line, were sequenced to confirm the identity of the gene probe.

Chromosome spreads from root tips of germinated wheat seeds, probe labelling and in situ hybridization were carried as described by [35]. Detection of hybridization signals was carried out using the Tyramide Signal Amplification Kit (TSA, PerkinElmer Life and Analytical Sciences, Inc., Waltham, MA, USA). To identify wheat chromosomes with positive signals, samples were re-hybridized using the pAs1 repetitive sequence and GAA-satellite sequence as probes [51–52]. Individual slides were observed under a Nikon Eclipse 80i, microscope (Nikon Instruments Europe BV, UK). Images were captured with a Nikon CCD camera using the appropriate Nikon 3.0 software and processed with Photoshop 4.0 software (Adobe Systems Inc., San Jose, California, USA).

Analysis of the carotenoid content in wheat-H. chilense translocation lines

Carotenoids from mature grains were determined according to [29]. Grains of each line were milled to fine flour and 1 g of flour per replicate was extracted to analyze the carotenoid composition. Three biological replicates per line were analyzed. Briefly, samples were extracted in 4 mL acetone containing 0.1% BHT (butylated hydroxytoluene) by vortexing for 2 min and additionally sonicated for 5 min at room temperature. The mixture was centrifuged at 4500 rpm at 4°C for 10 min and the supernatant was recovered. The sediment was re-extracted with 4 mL of acetone until supernatant was colorless. Acetone extracts were pooled and dried under nitrogen stream. Dried extracts were stored at -25°C until HPLC analysis.

Composition of each sample was analyzed by HPLC as described in [58] by using a Waters liquid chromatography system equipped with a 600E pump, a 2998 photodiode array detector, and the Empower software (Waters). A C30 carotenoid column (250 x 4.6 mm, 5 μm) coupled to a C30 guard column (20 x 4.0 mm, 5 μm; YMC Europe GmbH, Germany) was used. Samples were prepared for HPLC by dissolving the dried carotenoid extracts in methanol: acetone (1:1 v:v). A ternary (methanol, water and methyl tert-butyl ether) gradient elution was used for carotenoid separation as is described in [58]. The flow rate was 1 mL min^-1, column temperature was set to 25°C and the injection volume was 20 μL. The photodiode array detector was set to scan from 250 to 540 nm, and for each elution a Maxplot chromatogram, which plots each carotenoid peak at its corresponding maximum absorbance wavelength, was obtained. Carotenoids were identified by their retention time, absorption and fine spectra [59–62]. The carotenoid peaks were integrated at their individual maxima wavelength and their content were calculated using calibration curves of lutein (Sigma, St. Louis, MO, USA) for free and esterified lutein, and zeaxanthin (Extrasynthese). All operations were carried out on ice under dim light to prevent photodegradation, isomerizations and structural changes of the carotenoids.

Statistical analysis

Statistical analyses were performed using STATISTIX 9.0 software (Analytical Software, Tallahassee, FL, USA). The analysis of variance (ANOVA) was based on randomised blocks. Means were separated using the Least Significant Difference (LSD) test with a probability level of 0.05.

Protein extraction and quantification

Proteins were extracted following a phenol-based protocol described in [63] with slight modifications. Briefly, from each genotype two independent samples composed of a pool of 2–3 seeds was ground into a fine powder using a Star-Beater mill (VWR Company, Darmstadt, Germany). The ground tissue was resuspended in phenol extraction buffer (0.9 M sucrose, 0.5 M Tris-HCl, 50 mM EDTA, 0.1 M KCl, Milli-Q water and freshly added 1% Triton X-100, 2% β-mercaptoethanol and 1% protease inhibitor cocktail set VI (Merck KGaA, Darmstadt, Germany), pH 8) and homogenized on ice using Eppendorf micropestles. Samples were subsequently mixed with one volume of phenol solution equilibrated with 10 mM Tris HCl pH 8, 1 mM EDTA (Sigma, St. Louis, MO, USA), shaken for 1 min, incubated for 20 min in a tube rotator at 4°C and centrifuged at 18000 × g for 10 min at 4°C. The upper phenolic phase was collected and proteins were precipitated by adding five volumes of ice cold 0.1 M ammonium acetate and 13 mM DTT in methanol at -80°C for 2 h. A pellet of proteins was obtained by centrifugation at 20000 × g for 20 min at 4°C. Then, the pellet was washed once with ice cold 0.1 M ammonium acetate, 13 mM DTT in methanol and twice with 80% ice cold acetone. Finally, the pellet was air dried, dissolved in denaturing buffer (6 M urea, 50 mM ammonium bicarbonate pH 8) and stored at -80°C. Protein concentration was determined with the BCA Protein Assay Kit (Pierce Chemical Co., Rockford, EL), using BSA as a standard according to manufacturer’s instructions for the microplate procedure. Protein quality was checked by 1D-SDS-PAGE using Mini-Protean cell (Bio-Rad Laboratories, Richmond, CA) and 12% Mini-PROTEAN TGX precast polyacrylamide gels (Bio-Rad Laboratories, Richmond, CA) stained with Coomassie Blue G250.

Reverse phase-liquid chromatography RP-LC-MS/MS analysis

Protein extracts in 6 M urea and 50 mM ammonium bicarbonate pH 8 were reduced and alkylated. Disulfide bonds from cysteinyl residues were reduced with 10 mM DTT for 1 h at 37°C, and then thiol groups were alkylated with 50 mM iodoacetamide for 1 h at room temperature in the dark. Samples were diluted to reduce urea concentrations below 1.4 M and digested using sequencing grade trypsin (Promega, Madison, WI) overnight at 37°C in a trypsin/protein ratio of 1:5 (w/w). Digestion was stopped by the addition of 1% TFA. Then, the supernatants were dried down and desalted onto ZipTip C18 Pipette tips (EMD Millipore Corporation, Billerica, MA) until mass spectrometric analysis.

Desalted digested proteins were dried out, resuspended in 0.1% formic acid and analyzed by RP-LC-MS/MS in an Easy-nLC II system coupled to an ion trap LTQ-Orbitrap-Velos-Pro mass spectrometer (Thermo Fisher Scientific Inc., Waltham, MA). The peptides were concentrated (on-line) by reverse phase chromatography using a 0.1 mm × 20 mm C18 RP precolumn (Acclaim PepMap100 nanoViper, Dionex), and then separated using a 0.075 mm × 100 mm C18 RP column (Acclaim PepMap100 nanoViper, Dionex) operating at 0.3 μl/min. Peptides from a 5 μg aliquot of the protein extract were eluted in a 180-min gradient of 5 to 40% solvent B (solvent A: 0.1% formic acid in water, solvent B: 0.1% formic acid, 80% acetonitrile in water). ESI ionization was carried out using a Nano-bore emitters Stainless Steel ID 30 μm (Proxeon) interface. The Orbitrap resolution was set at 30.000. Peptides were detected in survey scans from 400 to 1600 amu (1 μscan), followed by twenty data dependent MS/MS scans (Top 20), using an isolation width of 2 u (in mass-to-charge ratio units), normalized collision energy of 35%, and dynamic exclusion mode applied during 30 s periods. Peptide identification from raw data was carried out using the SEQUEST algorithm (Proteome Discoverer 1.4, Thermo Scientific). Database search was performed against Uniprot_Viridiplantae. The following constraints were used for the searches: tryptic cleavage after Arg and Lys, up to two missed cleavage sites, and tolerances of 10 ppm for precursor ions and 0.8 Da for MS/MS fragment ions. Searches were performed allowing optional Met oxidation and Cys carbamidomethylation. Search against decoy database (integrated decoy approach) was performed using false discovery rate (FDR) < 0.01. Protein identification by nLC-MS/MS was carried out at the CBMSO protein chemistry facility, a member of ProteoRed network.

Bioinformatics and functional analysis of identified proteins

The output accessions obtained with the Proteome Discoverer software were exported to Microsoft Excel for data analysis. Firstly, a table containing information of all the proteins identified in the four genotypes analyzed was generated (S1 Table). The data obtained from the Uniprot-Viridiplantae search revealed that there were 372 proteins whose best hit was a protein with unknown function, meaning 50% of the proteins identified. Hence, to improve the information about the peptides matching proteins with unknown function a manual blastp was carried out. This analysis consisted on the blastp of the protein with unknown function with the Uniprot database; this allowed the identification of highly homologous proteins with an assigned function (identity with the protein with the best hit and the protein with described function > 80%).

In addition, a table containing the proteins exclusively identified in the genotypes with increased carotenoid content was created (Table 1). To this end, only the proteins that were present in the two replicates of each line were considered for the comparison between lines. Exceptionally, interesting proteins that were not exclusively found in one of the lines or in the two replicates of the proteomics experiments were also included in the list because they could have a relationship with the accumulation of carotenoids. These exceptions are indicated in the table and marked with asterisks.

Download:

Table 1. List of proteins exclusively identified in the protein extracts of the lines with enhanced carotenoid accumulation.

Unless otherwise stated the proteins were identified in the two replicates of the lines and not in any other protein extracts. The Uniprot identification number (ID; http://www.uniprot.org/) and the protein name of the best matches of the identified peptides are included. When the best match corresponded to a protein with a yet unassigned function the protein with the highest homology (>80% identity) was also indicated in brackets. The proteins with a possible implication in carotenoid enrichment are highlighted in bold.

https://doi.org/10.1371/journal.pone.0134598.t001

Results

Development of wheat- chromosome 7H^ch translocation lines in hexaploid wheat

Crosses between chromosome 7H^ch substitution line in wheat and the ph1b mutant in hexaploid wheat were made with the aim to introgress chromosome 7H^ch in the background of the wheat ph1b mutant, to promote interespecific chromosome associations between chromosome 7H^ch and its 7A wheat homoeologous and to reduce the size of chromosome 7H^ch in the wheat background (Fig 1) [22]. Screening and characterization of plants carrying introgressions from H. chilense chromosome 7H^ch were carried out by molecular markers and multicolor in situ hybridization. BAWU550 and BAWU763 microsatellites were used to identify several plants carrying chromosome 7H^ch introgressions (Fig 2). The presence of both molecular markers indicated the presence of the whole chromosome 7H^ch but could not discern between a whole chromosome introgression or heterozygous Robertsonian translocations between the H. chilense and the wheat homoeologous chromosomes, carrying one copy of 7H^chα-7AL translocation and one copy of 7AS-7H^chβ translocation. Translocations between chromosome 7H^ch and wheat chromosomes were detected by GISH (Fig 3). The use of molecular markers combined with GISH and FISH experiments enabled the determination of the exact chromosomal compositions and resolution of the chromosome arms involved in wheat-chromosome 7H^ch translocations (Figs 2 and 3). Heterozygous 7H^chα·7AL and 7AS·7H^chβ robertsonian translocations were only detected by in situ hybridization. Several homozygous 7H^chα·7AL and 7AS·7H^chβ translocation lines were obtained in the final selfed population.

Download:

Fig 2. Identification of 7H^chα or 7H^chβ chromosome arms in the wheat background and characterization of the wheat chromosome involved in chromosome translocations.

The presence of A) 7H^chα, B) 7H^chβ, C) 7AS and D) 7AL chromosome arms is detected using BAWU550, BAWU763, Xgwm471 and Xgwm332 markers, respectively. Positive controls 7H^chα and 7H^chβ in panels A) and B) represent the wheat lines carrying either the 7H^chα or the 7H^chβ telosomic chromosomes in the wheat background. Lanes 1–6 in A) and 1–8 in B) corresponds to several 7H^chα∙7AL and 7AS∙7 H^chβ translocation lines, respectively. The polymorphic band in D) has been arrowed. L, ladder; CS, T. aestivum cv. Chinese Spring; H1, H. chilense; L(7A)7D, T. turgidum cv. Langdon (LDN) in which a pair of chromosome 7A has been substituted by chromosome 7D from CS; L(7B)7D, T. turgidum cv. Langdon (LDN) in which a pair of chromosome 7B has been substituted by chromosome 7D from CS; CS(7A)7H^ch, T. aestivum cv. Chinese Spring (CS) in which a pair of chromosome 7A has been substituted by a pair of chromosome 7H^ch from H. chilense, 7H^chα∙7AL and 7AS∙7H^chβ, disomic translocation lines in wheat.

https://doi.org/10.1371/journal.pone.0134598.g002

Download:

Fig 3. Example of H. chilense chromosome introgressions in the progeny derived from the crosses (7A)7H^ch substitution lines x ph1b mutant*2 and physical location of the Psy1 gene on H. chilense chromosome 7H^ch of bread wheat CS-H. chilense (7A)7H^ch substitution line.

Genomic in situ hybridization (GISH) was carried out using total H. chilense genomic DNA as a probe (detected in green). In fluorescence in situ hybridization (FISH) experiments, the pAs1 and the GAA sequences were used as probes (detected in green and red, respectively) to identify chromosomes involves in H. chilense-wheat translocations. A PCR amplification product (2538bp) of the Psy1 gene was used as a probe for physical mapping of the Psy1 locus. The DNA was counterstained with DAPI (blue). A) GISH and B) FISH pattern of a mitotic metaphase carrying two copies of the 7H^chα∙7AL Robertsonian translocation (arrowed). C) GISH and D) FISH of a mitotic metaphase carrying two copies of 7AS∙7H^chβ Robertsonian translocation (arrowed). E) GISH and F) FISH of a (7A)7H^ch substitution line showing two positive signals corresponding to the Psy1 locus only on the two H. chilense chromosomes (arrowed). Scale Bar in F represents 10μm in all panels.

https://doi.org/10.1371/journal.pone.0134598.g003

In addition, the physical localization of Psy1 gene was performed by fluorescence in situ hybridization using a 2538bp fragment of the Pys1 genomic DNA sequence as a probe. Based on the Psy1 DNA sequence, primers were designed as described in the materials and methods section, to amplify the 2538bp fragment of the Psy1 gene in H. chilense. As expected, the Psy1 locus was visualized on H. chilense chromosome 7H^chand no signals were detected on the homoeologous wheat chromosomes (Fig 3).

Analysis of the carotenoid composition in wheat-H. chilense translocation lines

The carotenoid profile was determined in H. chilense translocation lines for chromosome 7H^ch in wheat and compared to wheat. The main carotenoids identified in all samples were lutein (free and esterified with fatty acids) and zeaxanthin, accounting for more than 95% of the total carotenoids. Trace amounts of β-carotene were additionally detected in some of the samples but were below the quantification threshold. Quantification of individual carotenoids and the amount of total carotenoids are showed in Table 2. Total carotenoids (1215 ± 13 ng g^-1 dry weight (DW)) content in the 7H^chα∙7AL translocation line was double than the wheat control and similar to that of the 7AS∙7H^chβ translocation line (1133 ± 68 ng g^-1 DW). As expected, the carotenoid content of the bread flour was the lowest (603 ± 59 ng g^-1 DW), followed by the chromosome 7H^ch addition line in bread wheat (803 ± 58 ng g^-1 DW). Thus, the maximum carotenoid content was detected in the translocation lines for both 7H^chα or 7H^chβ chromosome arms in the background of ph1b mutant. The maximum content for zeaxanthin was detected in the 7AS∙7H^chβ translocation line, although this line showed the minimum content in esterified lutein. Our results clearly indicate that the new translocation lines generated showed higher carotenoid content than both bread wheat and the wheat line carrying the addition of a pair of the whole chromosome 7H^ch, mainly due to the higher accumulation of free lutein.

Download:

Table 2. Carotenoid content in bread wheat, wheat-7H^ch addition lines, and H. chilense-wheat translocation lines.

Data are mean ± SE of three biological replicates. The letters in italics indicate statistical significance (P < 0.05).

https://doi.org/10.1371/journal.pone.0134598.t002

Comparison of the seed proteomic profile among wheat and the introgression lines with carotenoid-enriched seeds

Seed proteins were extracted from bread wheat and the three introgression lines with carotenoid enriched-seeds: the wheat lines carrying the addition of chromosome 7H^ch, the translocation of 7H^chα chromosome arm (7H^chα∙7AL translocation) and the translocation of 7H^chβ chromosome arm (7AS∙7H^chβ translocation). The protein extraction protocol consisted on the extraction from two replicates of each line with a phenol-based buffer followed by precipitation with ammonium acetate. The quality and the complexity of the extracted proteins were checked by sodium dodecyl sulfate polyacrylamide gel electrophoresis (1D-SDS-PAGE) prior to Nano-scale liquid chromatographic tandem mass spectrometry (nLC-MS/MS). The band pattern of the seed extracts was highly similar among lines (S1 Fig). Then, a high sensitive system of reverse-phase nLC coupled to a high resolution and mass accuracy mass spectrometer (LTQ-Orbitrap-Velos-Pro) was used to analyse the samples. To minimise the number of false positives or misidentifications a high level of confidence was applied for protein identification. Thus, only peptides with 5 to 30 amino acids and a minimum of two peptides per protein allowed a positive identification. A false discovery rate (FDR) < 0.01 was also set. As a result, 741 different proteins were identified from all the seed extracts analysed (S1 Table).

Only proteins that were present in the two replicates of each line were considered for further analysis (368). Ninety percent of the proteins (328) were common to the bread wheat and the introgression lines, while only ten percent of the proteins (40) were specifically present in some of the lines (Fig 4). Twelve proteins were only identified in either the addition or in each of the translocation lines but not in the wild type. Out of them 7 proteins had as best hit a protein with unknown function, therefore to increase the information about these proteins manual blastp were performed in an attempt to find highly similar proteins with an assigned function. Only those proteins showing at least 80% identity were considered (S1 Table).

Download:

Fig 4. Venn diagram summarizing the proteins identified in seed extracts of bread wheat and carotenoid-enriched lines.

Only peptides with 5 to 30 amino acids and a minimum of two peptides per protein allowed positive identifications, and peptide FDR < 0.01

https://doi.org/10.1371/journal.pone.0134598.g004

The search for proteins with functions that could be potentially related to the regulation of carotenoid accumulation was carried out by searching at the whole set of proteins that were not present in bread wheat but in some of the other lines with higher carotenoid contents. This analysis led to the selection of a 14-3-3 protein, a small heat shock protein (sHSP, 26.4 kDa), and a HSP70-HSP90 organizing protein (O49996, A5A8UA, and D2E9R6, respectively).

Discussion

Most mapping studies in wheat agree that quantitative trait loci (QTL) located on group 7 chromosomes largely determine the yellow pigment content of the grains (YPC). The Psy1 gene, which encodes for the first reaction of the carotenoid biosynthetic pathway, was considered a candidate gene to explain the YPC of wheat grain since it maps to chromosomes 7A and 7B of durum and bread wheat [64].

Tritordeums, which are amphiploids obtained after chromosome doubling of the hybrid between diploid, tetraploid or hexaploid wheat and Hordeum chilense, have higher carotenoid pigment content than durum or bread wheat [32]. Analysis of the flour pigment content in wheat-H. chilense addition lines led to the conclusion that chromosome 7H^ch from H. chilense confers the capacity to accumulate higher carotene concentration in seeds [2] Moreover, the Psy1 gene is the only gene related with the carotenoid biosynthetic pathway physically mapped in H. chilense [33]. Taking into account all this information, we developed crosses between the (7A)7H^ch substitution line in wheat and the wheat ph1b mutant to facilitate chromosome associations and recombination between chromosome 7H^ch and those from the wheat homoeologous group 7. Homozygous 7H^chα·7AL and 7AS∙7H^chβ translocation lines in hexaploid wheat were obtained and the evaluation of the pigment content in this translocation lines was carried out. The 7H^chα∙7AL translocation lines showed higher carotenoid content than bread wheat as expected because Psy1 gene is located in 7H^chα chromosome arm from H. chilense [30]. This Psy1 locus has been cytogenetically mapped on chromosome 7H^ch in a (7A)7H^ch substitution line in bread wheat using the biotinyl tyramide system (Tyr-FISH) (Fig 3), and seemed to be specific from H. chilense as no signals were detected in any of the related wheat chromosomes 7A, 7B or 7D. In addition, the 7AS∙7H^chβ translocation line also showed higher total carotenoid content than the wheat control and similar to the 7H^chα∙7AL. The high carotenoid levels in the 7AS∙7H^chβ line can be related to the presence of a QTL in the distal part of the 7H^chβ chromosome arm associated with the increment of YPC, although so far, there are no candidate genes described in this region related to YPC [30].

The proteomics analysis comparing the endosperm proteome of the addition of 7H^ch and the translocation of the 7H^chβ chromosome arms revealed the presence of 14-3-3 and heat shock proteins (HSPs, Table 1). Both 14-3-3 and HSPs were previously described to be required for the translocation of nucleus-encoded chloroplast precursor proteins into the chloroplast [65]. For example, plant DXP reductoisomerase (DXR) which catalyses the second step in the MEP pathway has an N-terminal transit domain with a putative motif for a 14-3-3 binding site [66]. Therefore, the post-translational modifications of biosynthetic proteins due to the interaction with 14-3-3 proteins and/or HSPs could be involved in the accumulation of carotenoids observed in the introgressed lines (Table 2). Furthermore, several studies in tomato and grapefruit have revealed that HSPs are related to carotenoid accumulation [67–69]. The 26.4 KDa heat-shock protein (A5A8U9), which was present in the line with the addition of 7H^ch could also be playing a key role in the accumulation of carotenoids as small heat shock proteins were found to be the most abundant proteins present in the carotenoid-protein complexes of cassava roots, suggesting their involvement in the accumulation of these pigments. [70].

Conclusions

The translocation lines developed in this work are an important tool to enrich the carotenoid content in bread wheat. Moreover, there are not available neither substitution/addition lines nor translocation lines for chromosome 7H^ch in durum wheat. Thus, these translocation lines are also a useful tool to transfer these chromosome arms into durum wheat, and therefore, to enrich carotenoid content in durum wheat.

The comparison of the proteomic profile of the wheat introgression lines with bread wheat CS revealed that the overall protein content was scarcely altered by the introgression of H. chilense chromosome 7H^ch or 7H^chα and 7H^chβ chromosome arms and suggested that HSPs and a 14-3-3-like protein could play a key role in the enhancement of carotenoid accumulation in seeds.

Supporting Information

S1 Fig. SDS-PAGE of seed protein extracts from bread wheat and carotenoid-enriched lines.

SDS-PAGE stained with Coomassie Brilliant Blue G250 of the seed protein extracts obtained from bread wheat (CS, lane 1), wheat-7H^ch disomic addition line (lane 2), and the 7H^chα·7AL (lane 3) and 7AS·7H^chβ (lane 4) disomic translocation lines.

https://doi.org/10.1371/journal.pone.0134598.s001

(TIF)

S1 Table. Proteins identified by nLC-MS/MS.

Proteins identified in seeds of bread wheat, wheat-7H^ch disomic addition line, and the 7H^chα·7AL and 7AS·7H^chβ disomic translocation lines analyzed by nLC-MS/MS. Uniprot accession number, description, sequence of identified peptides, number of amino acids (AAs) of the identified protein, molecular weight of the identified protein, and number of peptides identified in each line are described.

https://doi.org/10.1371/journal.pone.0134598.s002

(XLSX)

Acknowledgments

The authors are grateful to Steve Reader (John Innes Centre, Norwich, UK) for the gift of the necessary cytogenetic stocks. Protein identification by LC/MS/MS was carried out in the CBMSO PROTEIN CHEMISTRY FACILITY that belongs to ProteoRed, PRB2-ISCIII.

Author Contributions

Conceived and designed the experiments: MDR PP. Performed the experiments: MDR MCC MJR LZ EA PP. Analyzed the data: MDR MCC MJR LZ EA PP. Contributed reagents/materials/analysis tools: MDR MCC MJR LZ EA PP. Wrote the paper: MDR PP.

References

1. Jiang J, Friebe B,Gill BS. Recent advances in alien gene transfer in wheat. Euphytica. 1994; 73: 199–212.
- View Article
- Google Scholar
2. Alvarez JB, Martín LM, Martín A. Chromosomal localization of genes for carotenoid pigments using addition lines of Hordeum chilense in wheat. Plant Breeding. 1998; 117: 287–289.
- View Article
- Google Scholar
3. Fosrter BP, Phillips MS, Miller TE, Baird E, Powell W. Chromosome location of genes controlling tolerance to salt (NaCl) and vigour in Hordeum vulgare and H. chilense. Heredity. 1990;65: 99–107.
- View Article
- Google Scholar
4. Martín A, Martín LM, Cabrera A, Ramirez MC, Jimenez MJ, Rubiales D,et al. The potential of Hordeum chilense in breeding Triticeae species. In Triticeae III. 1998; 377–386.
5. Rubiales D, Reader SM, Martín A. Chromosomal location of resistance of Septoria tritici in Hordeum chilense determined by the study of chromosomal addition and substitution lines in “Chinese Spring” wheat. Euphytica. 2000;115: 221–224.
- View Article
- Google Scholar
6. Martín A, Cabrera A. Cytogenetics of Hordeum chilense: current status and considerations with reference to breeding. Cytogenetic and Genome Research. 2005;109: 378–384. pmid:15753600
- View Article
- PubMed/NCBI
- Google Scholar
7. Miller TE, Reader SM, Chapman V. addition of Hordeum chilense chromosomes to wheat. In Induced variability in plant breeding: Internat. Symp. of the Sect. Mutation and Polyploidy of the European Assoc. for Research on Plant Breeding, Wageningen. 1982; 79–81.
8. Islam AKMR. Production and characterization of wheat-barley addition lines. In Proceedings of the 5^th International Wheat genetics Symposium. (Edited by: Ramanujam S). 1978; 356–371.
9. Islam AKMR, Shepherd KW, Sparrow DHB. Isolation and characterization of euplasmic wheat-barley chromosome addition lines. Heredity. 1981;46: 161–174.
- View Article
- Google Scholar
10. Sears ER. Agropyron-wheat transfer through induced homoeologous pairing. Canadian Journal of Genetics and Cytology. 1972;14: 746.
- View Article
- Google Scholar
11. Sears ER. Transfer of alien genetic material to wheat. Wheat Science-today and tomorrow. 1981; 75–89.
- View Article
- Google Scholar
12. Islam AKMR, Shepherd KW. Induced pairing between wheat and barley chromosomes. In Proceedings of the 7^th International Wheat Genet Symposium. (Edited by: Miller TE, Koebner RMD). 1988; 309–314.
13. Okamoto M. A synaptic effect of chromosome V. Wheat Information Service. 1957;5: 6.
- View Article
- Google Scholar
14. Riley R. Genetic control of cytologically diploid behaviour of hexaploid wheat. Nature. 1958;182: 713–715.
- View Article
- Google Scholar
15. Riley R. The diploidization of polyploidy wheat. Heredity 1960;15: 407–429.
- View Article
- Google Scholar
16. Sears ER, Okamoto M. Intergenomic chromosomes relationships in hexaploid wheat. In Proceeding Tenth International Congress of Genetics 1958;2: 258–259.
- View Article
- Google Scholar
17. Sears ER. Induced mutant with homoeologous pairing in common wheat. Canadian Journal of Genetics and Cytology. 1977;19: 583–593.
- View Article
- Google Scholar
18. Griffiths S, Sharp R, Foote TN, Bertin I, Wanous M, Reader S, et al. Molecular characterization of Ph1 as a major chromosome pairing locus in polyploid wheat. Nature. 2006;439: 749–752. pmid:16467840
- View Article
- PubMed/NCBI
- Google Scholar
19. Rey MD, Prieto P. Dynamics of DNA replication during premeiosis and early meiosis in wheat. PLoS ONE. 2014;9: (10)e107714.
- View Article
- Google Scholar
20. Greer E, Martín AC, Pendle A, Colas I, Jones AME, Moore G et al. The Ph1 locus suppresses cdk2-type activity during premeiosis and meiosis in wheat. The Plant Cell. 2012;24: 152–162. pmid:22274628
- View Article
- PubMed/NCBI
- Google Scholar
21. Yousafzai FK, Al-Kaff N, Moore G. The molecular features of chromosome pairing at meiosis: the polyploidy challenge using wheat as a reference. Functional and Integrative Genomics. 2010;10: 147–156. pmid:20422242
- View Article
- PubMed/NCBI
- Google Scholar
22. Rey MD, Calderon MC, Prieto P. The use of the ph1b mutant to induce recombination between the chromosomes of wheat and barley. Frontiers in Plant Science. 2015;6: 160. pmid:25852713
- View Article
- PubMed/NCBI
- Google Scholar
23. Halvorsen BL, Holte K, Myhrstad MCW, Barikmo I, Hvattum E, Remberg SF, et al. A systematic screening of total antioxidants in dietary plants. The Journal of Nutrition. 2002;132: 461–471. pmid:11880572
- View Article
- PubMed/NCBI
- Google Scholar
24. Farré G, Sanahuja G, Naqvi S, Bai C, Capell T, Zhu C et al. Travel advice on the road to carotenoids in plants. Plant Science. 2010;179: 28–48.
- View Article
- Google Scholar
25. Fraser PD, Bramley PM. The biosynthesis and nutritional uses of carotenoids. Progress in Lipids Research. 2004;43: 228–265.
- View Article
- Google Scholar
26. Rodríguez-Suárez C, Mellado-Ortega E, Hornero-Méndez D, Atienza SG. Increase in transcript accumulation of Psy1 and e-Lcy genes in grain development is associated with differences in seed carotenoid content between durum Wheat and tritordeum. Plant Molecular Biology. 2014:84: 659–673. pmid:24306494
- View Article
- PubMed/NCBI
- Google Scholar
27. Lepage M, Sims RPA. Carotenoids of wheat flour: Their identification and composition. Cereal Chemistry. 1968;45: 600–604.
- View Article
- Google Scholar
28. Kaneko S, Nagamine T, Yamada T. Esterification of endosperm lutein with fatty acids during the storage of wheat seeds. Bioscience, Biotechnology, and Biochemistry. 1995;59: 1–4.
- View Article
- Google Scholar
29. Hentschel V, Katja K, Hollmann J, Lindhauer MG, Böhm V, Bitsch R. Spectrophotometric determination of yellow pigment content and evaluation of carotenoids by high-performance liquid chromatography in durum wheat grain. Journal of Agricultural and Food Chemistry. 2002;50: 6663–6668. pmid:12405758
- View Article
- PubMed/NCBI
- Google Scholar
30. Rodríguez-Suárez C, Atienza SG. Hordeum chilense genome, a useful tool to investigate the endosperm yellow pigment content in the Triticeae. BMC Plant Biology. 2012b;12: 200.
- View Article
- Google Scholar
31. Atienza SG, Ávila CM, Martín A. The development of a PCR-based marker for PSY1 from Hordeum chilense, a candidate gene for carotenoid content accumulation in tritordeum seeds. Crop and Pasture Science. 2007;58: 767–773.
- View Article
- Google Scholar
32. Atienza SG, Ramírez CM, Hernández P, Martín A. Chromosomal location of genes for carotenoid pigments in Hordeum chilense. Plant Breeding. 2004;123: 303–304.
- View Article
- Google Scholar
33. Li F, Vallabhaneni R, Wurtzel ET. PSY3, a new member of the phytoene synthase gene family conserved in the Poaceae and regulator of abiotic stress-induced root carotenogenesis. Plant Physiology. 2008;146: 1333–1345. pmid:18162592
- View Article
- PubMed/NCBI
- Google Scholar
34. Schwarzacher T, Leitch AR, Bennett MD, Heslop-Harrison JS. In situ localization of parental genomes in a wild hybrid. Annals of Botany. 1989;64: 315–324.
- View Article
- Google Scholar
35. Prieto P, Ramírez MC, J. Ballesteros J,Cabrera A. Identification of intergenomic translocations involving wheat, Hordeum vulgare and Hordeum chilense chromosomes by FISH. Hereditas. 2001;135: 171–174.
- View Article
- Google Scholar
36. van Gijlswijk RP, Zijlmans HJ, Weigant J, Bobrow MN, Erickson TJ, Adler KE, et al. Fuorochrome-labeled tyramides: use in immunocytochemistry and fluorescence in situ hybridization. Journal of Histochemistry and Cytochemistry. 1997;45: 375–382. pmid:9071319
- View Article
- PubMed/NCBI
- Google Scholar
37. Dinesh Y, Nagendra KS. Wheat triticin: a potential target for nutritional quality improvement. Asian Journal of Biotechnology. 2011;3: 1–21.
- View Article
- Google Scholar
38. Tasleem-Tahir A, Nadaud I, Girousse C, Martre P, Marion D, Branlard G. Proteomic analysis of peripheral layers during wheat (Triticum aestivum L.) grain development. Proteomics. 2011;11: 371–379. pmid:21268267
- View Article
- PubMed/NCBI
- Google Scholar
39. Larré C, Lupi R, Gombaud G, Brossard C, Branlard G, Moneret-Vautrin DA, et al. Assessment of allergenicity of diploid and hexaploid wheat genotypes: identification of allergens in the albumin/globulin fraction. Journal of Proteomics. 2011;74: 1279–1289.
- View Article
- Google Scholar
40. Altenbach SB, Vensel WH, Dupont FM: The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86. BMC Research Notes. 2011;4: 242. pmid:21774824
- View Article
- PubMed/NCBI
- Google Scholar
41. Nadolska-Orczyk A, Gasparis S, Orczyk W. The determinants of grain texture in cereals. Journal of Applied Genetics. 2009;50: 185–97. pmid:19638673
- View Article
- PubMed/NCBI
- Google Scholar
42. De Angelis M, Minervini F, Caputo L, Cassone A, Coda R, Calasso MP,et al. Proteomic analysis by two-dimensional gel electrophoresis and starch characterization of Triticum turgidum L. var. durum cultivars for pasta making. Journal of Agricultural and Food Chemistry. 2008;56: 8619–8628. pmid:18754666
- View Article
- PubMed/NCBI
- Google Scholar
43. Sears ER. Genetic control of chromosome pairing in wheat. Annual Review of Genetic. 1976:10: 31–51.
- View Article
- Google Scholar
44. Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 1980;8: 4321–4326. pmid:7433111
- View Article
- PubMed/NCBI
- Google Scholar
45. Hernández P, Dorado G, Prieto P, Jiménez MJ, Ramírez MC, Laurie DA, et al. A core genetic map of Hordeum chilense and comparisons with maps of barley (Hordeum vulgare) and wheat (Triticum aestivum). Theoretical and Applied Genetics. 2001;102: 1259–1264
- View Article
- Google Scholar
46. Wang X, Lai J, Liu G, Chen F. Development of a Scar marker for the Ph1 locus in common wheat and its application. Crop Science. 2002;42: 1365–1368.
- View Article
- Google Scholar
47. Hagras AA, Kishii K, Tanaka K, Sato K, Tsujimoto H. Genomic differentiation of Hordeum chilense from H. vulgare a revealed by repetitive and EST sequences. Genes and Genetic Systems. 2005;80: 147–159. pmid:16172528
- View Article
- PubMed/NCBI
- Google Scholar
48. Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier MH, Leroy P, et al. A microsatellite map of wheat. Genetics. 1998;149: 2007–2023. pmid:9691054
- View Article
- PubMed/NCBI
- Google Scholar
49. Prieto P, Martín A, Cabrera A. Chromosomal distribution of telomeric and telomeric-associated sequences in Hordeum chilense by in situ hybridization. Hereditas. 2004;141: 122–127. pmid:15660972
- View Article
- PubMed/NCBI
- Google Scholar
50. Cabrera A, Friebe B, Jiang J, Gill BS. Characterization of Hordeum chilense chromosomes by C-banding and in situ hybridization using highly repeated DNA probes. Genome. 1995;38: 435–442. pmid:18470181
- View Article
- PubMed/NCBI
- Google Scholar
51. Rayburn AL, Gill BS. Isolation of a D-genome specific repeated DNA sequence from Aegilops squarrosa. Plant Molecular Biology Reporter. 1986;4: 102–109.
- View Article
- Google Scholar
52. Pedersen C, Langridge P. Identification of the entire chromosome complement of bread wheat by two-color FISH. Genome. 1997;40: 589–593. pmid:18464850
- View Article
- PubMed/NCBI
- Google Scholar
53. Pedersen C, Rasmussen SK, Linde-Laursen I. Genome and chromosome identification in cultivated barley and related species of the Triticeae (Poaceae) by in situ hybridization with the GAA-satellite sequence. Genome. 1996;39: 93–104. pmid:8851798
- View Article
- PubMed/NCBI
- Google Scholar
54. Calderón MDC, Ramirez MDC, Martín A,Prieto P. Development of Hordeum chilense 4H^ch introgression lines in durum wheat: a tool for breeders and complex trait analysis. Plant Breeding. 2012;131: 733–738.
- View Article
- Google Scholar
55. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA: Pimer3plus, an enhanced web interface to Primer3. Nucleic Acids Research. 2007;35: W71–W74
- View Article
- Google Scholar
56. Rodríguez-Suárez C, Giménez MJ, Gutiérrez N, Ávila CM, Machado A, Huttner E, et al. Development of wild barley (Hordeum chilense)-derived DArT markers and their use into genetic and physical mapping. Theoretical and Applied Genetics. 2012a;124: 713–722. pmid:22048641
- View Article
- PubMed/NCBI
- Google Scholar
57. Zhang C, Dong C, He X, Zhang L, Xia X, He Z. Allelic variants at the TaZds-D1 locus on wheat chromosome 2DL and their association with yellow pigment content. Crop Science. 2011;51: 1580–1590.
- View Article
- Google Scholar
58. Carmona L, Zacarías L, Rodrigo MJ. Stimulation of coloration and carotenoid biosynthesis during postharvest storage of ‘Navelina’ orange fruit at 12°C. Postharvest Biology and Technology. 2012;74: 108–117.
- View Article
- Google Scholar
59. Rodrigo MJ, Marcos JF, Zacarías L. Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation. Journal of Agricultural and Food Chemistry. 2004;52: 6724–6731. pmid:15506808
- View Article
- PubMed/NCBI
- Google Scholar
60. Rodrigo MJ, Marcos JF, Alferez F, Mallent MD, Zacarías L. Characterization of Pinalate, a novel Citrus sinensis mutant with a fruit-specific alteration that results in yellow pigmentation and decreased ABA content. Journal of Experimental Botany. 2003;54: 727–738. pmid:12554716
- View Article
- PubMed/NCBI
- Google Scholar
61. Britton G. Overwiew of carotenoid biosynthesis. In Carotenoids: Biosynthesis and Metabolism. (Edited by: Britton G, LiaaenJensen S and Pfander H). 1998;3: 384–389
- View Article
- Google Scholar
62. Rouseff R, Raley L, Hofsommer HJ. Application of diode array detection with a C-30 reversed phase column for the separation and identification of saponified orange juice carotenoids. Journal of Agricultural and Food Chemistry. 1996;44: 2176–2181.
- View Article
- Google Scholar
63. Collado-Romero M, Alós E, Prieto P. Unravelling the proteomic profile of rice meiocytes during early meiosis. Frontiers in Plant Science. 2014; 5: 356. pmid:25104955
- View Article
- PubMed/NCBI
- Google Scholar
64. Rodríguez-Suárez C, Giménez MJ, Atienza SG. Progress and perspectives for carotenoid accumulation in selected Triticeae species. Crop and Pasture Science. 2010;61: 743–751.
- View Article
- Google Scholar
65. May T,Soll J.14-3-3 proteins form a guidance complex with chloroplast precursor proteins in plants. The Plant Cell. 2010;12: 53–63.
- View Article
- Google Scholar
66. Fung PK, Krushkal J, Weathers PJ. Computational analysis of the evolution of 1-deoxy-D-xylulose-5-phosphate Reductoisomerase, an important enzyme in plant terpene biosynthesis. Chemistry and Biodiversity. 2010;7: 1098–1110. pmid:20491066
- View Article
- PubMed/NCBI
- Google Scholar
67. Neta-Sharir I, Isaacson T, Lurie S, Weiss D. Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting colour changes during fruit maturation. The Plant Cell. 2005;17: 1829–1838. pmid:15879560
- View Article
- PubMed/NCBI
- Google Scholar
68. Lado J, Cronje P, Alquézar B, Page A, Manzi M, Gómez-Cadenas A, et al. Fruit shading enhances peel colour, carotenes accumulation and chromoplast differentiation in red grapefruit. Physiologia Plantarum. 2015.
- View Article
- Google Scholar
69. Karlova R, Rosin FM, Busscher-Lange J, Parapunova V, Do PT, Fernier AR, et al. Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening. The Plant Cell. 2011;23: 923–941. pmid:21398570
- View Article
- PubMed/NCBI
- Google Scholar
70. Carvalho LJCB, Lippolis J, Chen S, de Souza CRB, Vieira EA, Anderson JV.Characterization of carotenoid-protein complexes and gene expression analysis associated with carotenoid sequestration in pigmented cassava (Manihot Esculenta Crantz) storage root. The Open Biochemistry Journal. 2012; 6: 116–130. pmid:23230451
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Jiang J, Friebe B,Gill BS. Recent advances in alien gene transfer in wheat. Euphytica. 1994; 73: 199–212.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Alvarez JB, Martín LM, Martín A. Chromosomal localization of genes for carotenoid pigments using addition lines of Hordeum chilense in wheat. Plant Breeding. 1998; 117: 287–289.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Fosrter BP, Phillips MS, Miller TE, Baird E, Powell W. Chromosome location of genes controlling tolerance to salt (NaCl) and vigour in Hordeum vulgare and H. chilense. Heredity. 1990;65: 99–107.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Martín A, Martín LM, Cabrera A, Ramirez MC, Jimenez MJ, Rubiales D,et al. The potential of Hordeum chilense in breeding Triticeae species. In Triticeae III. 1998; 377–386.

[ref5] 5. Rubiales D, Reader SM, Martín A. Chromosomal location of resistance of Septoria tritici in Hordeum chilense determined by the study of chromosomal addition and substitution lines in “Chinese Spring” wheat. Euphytica. 2000;115: 221–224.
View Article
Google Scholar

[12] View Article

[13] Google Scholar

[ref6] 6. Martín A, Cabrera A. Cytogenetics of Hordeum chilense: current status and considerations with reference to breeding. Cytogenetic and Genome Research. 2005;109: 378–384. pmid:15753600
View Article
PubMed/NCBI
Google Scholar

[15] View Article

[16] PubMed/NCBI

[17] Google Scholar

[ref7] 7. Miller TE, Reader SM, Chapman V. addition of Hordeum chilense chromosomes to wheat. In Induced variability in plant breeding: Internat. Symp. of the Sect. Mutation and Polyploidy of the European Assoc. for Research on Plant Breeding, Wageningen. 1982; 79–81.

[ref8] 8. Islam AKMR. Production and characterization of wheat-barley addition lines. In Proceedings of the 5^th International Wheat genetics Symposium. (Edited by: Ramanujam S). 1978; 356–371.

[ref9] 9. Islam AKMR, Shepherd KW, Sparrow DHB. Isolation and characterization of euplasmic wheat-barley chromosome addition lines. Heredity. 1981;46: 161–174.
View Article
Google Scholar

[21] View Article

[22] Google Scholar

[ref10] 10. Sears ER. Agropyron-wheat transfer through induced homoeologous pairing. Canadian Journal of Genetics and Cytology. 1972;14: 746.
View Article
Google Scholar

[24] View Article

[25] Google Scholar

[ref11] 11. Sears ER. Transfer of alien genetic material to wheat. Wheat Science-today and tomorrow. 1981; 75–89.
View Article
Google Scholar

[27] View Article

[28] Google Scholar

[ref12] 12. Islam AKMR, Shepherd KW. Induced pairing between wheat and barley chromosomes. In Proceedings of the 7^th International Wheat Genet Symposium. (Edited by: Miller TE, Koebner RMD). 1988; 309–314.

[ref13] 13. Okamoto M. A synaptic effect of chromosome V. Wheat Information Service. 1957;5: 6.
View Article
Google Scholar

[31] View Article

[32] Google Scholar

[ref14] 14. Riley R. Genetic control of cytologically diploid behaviour of hexaploid wheat. Nature. 1958;182: 713–715.
View Article
Google Scholar

[34] View Article

[35] Google Scholar

[ref15] 15. Riley R. The diploidization of polyploidy wheat. Heredity 1960;15: 407–429.
View Article
Google Scholar

[37] View Article

[38] Google Scholar

[ref16] 16. Sears ER, Okamoto M. Intergenomic chromosomes relationships in hexaploid wheat. In Proceeding Tenth International Congress of Genetics 1958;2: 258–259.
View Article
Google Scholar

[40] View Article

[41] Google Scholar

[ref17] 17. Sears ER. Induced mutant with homoeologous pairing in common wheat. Canadian Journal of Genetics and Cytology. 1977;19: 583–593.
View Article
Google Scholar

[43] View Article

[44] Google Scholar

[ref18] 18. Griffiths S, Sharp R, Foote TN, Bertin I, Wanous M, Reader S, et al. Molecular characterization of Ph1 as a major chromosome pairing locus in polyploid wheat. Nature. 2006;439: 749–752. pmid:16467840
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref19] 19. Rey MD, Prieto P. Dynamics of DNA replication during premeiosis and early meiosis in wheat. PLoS ONE. 2014;9: (10)e107714.
View Article
Google Scholar

[50] View Article

[51] Google Scholar

[ref20] 20. Greer E, Martín AC, Pendle A, Colas I, Jones AME, Moore G et al. The Ph1 locus suppresses cdk2-type activity during premeiosis and meiosis in wheat. The Plant Cell. 2012;24: 152–162. pmid:22274628
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref21] 21. Yousafzai FK, Al-Kaff N, Moore G. The molecular features of chromosome pairing at meiosis: the polyploidy challenge using wheat as a reference. Functional and Integrative Genomics. 2010;10: 147–156. pmid:20422242
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref22] 22. Rey MD, Calderon MC, Prieto P. The use of the ph1b mutant to induce recombination between the chromosomes of wheat and barley. Frontiers in Plant Science. 2015;6: 160. pmid:25852713
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref23] 23. Halvorsen BL, Holte K, Myhrstad MCW, Barikmo I, Hvattum E, Remberg SF, et al. A systematic screening of total antioxidants in dietary plants. The Journal of Nutrition. 2002;132: 461–471. pmid:11880572
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref24] 24. Farré G, Sanahuja G, Naqvi S, Bai C, Capell T, Zhu C et al. Travel advice on the road to carotenoids in plants. Plant Science. 2010;179: 28–48.
View Article
Google Scholar

[69] View Article

[70] Google Scholar

[ref25] 25. Fraser PD, Bramley PM. The biosynthesis and nutritional uses of carotenoids. Progress in Lipids Research. 2004;43: 228–265.
View Article
Google Scholar

[72] View Article

[73] Google Scholar

[ref26] 26. Rodríguez-Suárez C, Mellado-Ortega E, Hornero-Méndez D, Atienza SG. Increase in transcript accumulation of Psy1 and e-Lcy genes in grain development is associated with differences in seed carotenoid content between durum Wheat and tritordeum. Plant Molecular Biology. 2014:84: 659–673. pmid:24306494
View Article
PubMed/NCBI
Google Scholar

[75] View Article

[76] PubMed/NCBI

[77] Google Scholar

[ref27] 27. Lepage M, Sims RPA. Carotenoids of wheat flour: Their identification and composition. Cereal Chemistry. 1968;45: 600–604.
View Article
Google Scholar

[79] View Article

[80] Google Scholar

[ref28] 28. Kaneko S, Nagamine T, Yamada T. Esterification of endosperm lutein with fatty acids during the storage of wheat seeds. Bioscience, Biotechnology, and Biochemistry. 1995;59: 1–4.
View Article
Google Scholar

[82] View Article

[83] Google Scholar

[ref29] 29. Hentschel V, Katja K, Hollmann J, Lindhauer MG, Böhm V, Bitsch R. Spectrophotometric determination of yellow pigment content and evaluation of carotenoids by high-performance liquid chromatography in durum wheat grain. Journal of Agricultural and Food Chemistry. 2002;50: 6663–6668. pmid:12405758
View Article
PubMed/NCBI
Google Scholar

[85] View Article

[86] PubMed/NCBI

[87] Google Scholar

[ref30] 30. Rodríguez-Suárez C, Atienza SG. Hordeum chilense genome, a useful tool to investigate the endosperm yellow pigment content in the Triticeae. BMC Plant Biology. 2012b;12: 200.
View Article
Google Scholar

[89] View Article

[90] Google Scholar

[ref31] 31. Atienza SG, Ávila CM, Martín A. The development of a PCR-based marker for PSY1 from Hordeum chilense, a candidate gene for carotenoid content accumulation in tritordeum seeds. Crop and Pasture Science. 2007;58: 767–773.
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref32] 32. Atienza SG, Ramírez CM, Hernández P, Martín A. Chromosomal location of genes for carotenoid pigments in Hordeum chilense. Plant Breeding. 2004;123: 303–304.
View Article
Google Scholar

[95] View Article

[96] Google Scholar

[ref33] 33. Li F, Vallabhaneni R, Wurtzel ET. PSY3, a new member of the phytoene synthase gene family conserved in the Poaceae and regulator of abiotic stress-induced root carotenogenesis. Plant Physiology. 2008;146: 1333–1345. pmid:18162592
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref34] 34. Schwarzacher T, Leitch AR, Bennett MD, Heslop-Harrison JS. In situ localization of parental genomes in a wild hybrid. Annals of Botany. 1989;64: 315–324.
View Article
Google Scholar

[102] View Article

[103] Google Scholar

[ref35] 35. Prieto P, Ramírez MC, J. Ballesteros J,Cabrera A. Identification of intergenomic translocations involving wheat, Hordeum vulgare and Hordeum chilense chromosomes by FISH. Hereditas. 2001;135: 171–174.
View Article
Google Scholar

[105] View Article

[106] Google Scholar

[ref36] 36. van Gijlswijk RP, Zijlmans HJ, Weigant J, Bobrow MN, Erickson TJ, Adler KE, et al. Fuorochrome-labeled tyramides: use in immunocytochemistry and fluorescence in situ hybridization. Journal of Histochemistry and Cytochemistry. 1997;45: 375–382. pmid:9071319
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref37] 37. Dinesh Y, Nagendra KS. Wheat triticin: a potential target for nutritional quality improvement. Asian Journal of Biotechnology. 2011;3: 1–21.
View Article
Google Scholar

[112] View Article

[113] Google Scholar

[ref38] 38. Tasleem-Tahir A, Nadaud I, Girousse C, Martre P, Marion D, Branlard G. Proteomic analysis of peripheral layers during wheat (Triticum aestivum L.) grain development. Proteomics. 2011;11: 371–379. pmid:21268267
View Article
PubMed/NCBI
Google Scholar

[115] View Article

[116] PubMed/NCBI

[117] Google Scholar

[ref39] 39. Larré C, Lupi R, Gombaud G, Brossard C, Branlard G, Moneret-Vautrin DA, et al. Assessment of allergenicity of diploid and hexaploid wheat genotypes: identification of allergens in the albumin/globulin fraction. Journal of Proteomics. 2011;74: 1279–1289.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref40] 40. Altenbach SB, Vensel WH, Dupont FM: The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86. BMC Research Notes. 2011;4: 242. pmid:21774824
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref41] 41. Nadolska-Orczyk A, Gasparis S, Orczyk W. The determinants of grain texture in cereals. Journal of Applied Genetics. 2009;50: 185–97. pmid:19638673
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref42] 42. De Angelis M, Minervini F, Caputo L, Cassone A, Coda R, Calasso MP,et al. Proteomic analysis by two-dimensional gel electrophoresis and starch characterization of Triticum turgidum L. var. durum cultivars for pasta making. Journal of Agricultural and Food Chemistry. 2008;56: 8619–8628. pmid:18754666
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref43] 43. Sears ER. Genetic control of chromosome pairing in wheat. Annual Review of Genetic. 1976:10: 31–51.
View Article
Google Scholar

[134] View Article

[135] Google Scholar

[ref44] 44. Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 1980;8: 4321–4326. pmid:7433111
View Article
PubMed/NCBI
Google Scholar

[137] View Article

[138] PubMed/NCBI

[139] Google Scholar

[ref45] 45. Hernández P, Dorado G, Prieto P, Jiménez MJ, Ramírez MC, Laurie DA, et al. A core genetic map of Hordeum chilense and comparisons with maps of barley (Hordeum vulgare) and wheat (Triticum aestivum). Theoretical and Applied Genetics. 2001;102: 1259–1264
View Article
Google Scholar

[141] View Article

[142] Google Scholar

[ref46] 46. Wang X, Lai J, Liu G, Chen F. Development of a Scar marker for the Ph1 locus in common wheat and its application. Crop Science. 2002;42: 1365–1368.
View Article
Google Scholar

[144] View Article

[145] Google Scholar

[ref47] 47. Hagras AA, Kishii K, Tanaka K, Sato K, Tsujimoto H. Genomic differentiation of Hordeum chilense from H. vulgare a revealed by repetitive and EST sequences. Genes and Genetic Systems. 2005;80: 147–159. pmid:16172528
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref48] 48. Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier MH, Leroy P, et al. A microsatellite map of wheat. Genetics. 1998;149: 2007–2023. pmid:9691054
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref49] 49. Prieto P, Martín A, Cabrera A. Chromosomal distribution of telomeric and telomeric-associated sequences in Hordeum chilense by in situ hybridization. Hereditas. 2004;141: 122–127. pmid:15660972
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref50] 50. Cabrera A, Friebe B, Jiang J, Gill BS. Characterization of Hordeum chilense chromosomes by C-banding and in situ hybridization using highly repeated DNA probes. Genome. 1995;38: 435–442. pmid:18470181
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref51] 51. Rayburn AL, Gill BS. Isolation of a D-genome specific repeated DNA sequence from Aegilops squarrosa. Plant Molecular Biology Reporter. 1986;4: 102–109.
View Article
Google Scholar

[163] View Article

[164] Google Scholar

[ref52] 52. Pedersen C, Langridge P. Identification of the entire chromosome complement of bread wheat by two-color FISH. Genome. 1997;40: 589–593. pmid:18464850
View Article
PubMed/NCBI
Google Scholar

[166] View Article

[167] PubMed/NCBI

[168] Google Scholar

[ref53] 53. Pedersen C, Rasmussen SK, Linde-Laursen I. Genome and chromosome identification in cultivated barley and related species of the Triticeae (Poaceae) by in situ hybridization with the GAA-satellite sequence. Genome. 1996;39: 93–104. pmid:8851798
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref54] 54. Calderón MDC, Ramirez MDC, Martín A,Prieto P. Development of Hordeum chilense 4H^ch introgression lines in durum wheat: a tool for breeders and complex trait analysis. Plant Breeding. 2012;131: 733–738.
View Article
Google Scholar

[174] View Article

[175] Google Scholar

[ref55] 55. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA: Pimer3plus, an enhanced web interface to Primer3. Nucleic Acids Research. 2007;35: W71–W74
View Article
Google Scholar

[177] View Article

[178] Google Scholar

[ref56] 56. Rodríguez-Suárez C, Giménez MJ, Gutiérrez N, Ávila CM, Machado A, Huttner E, et al. Development of wild barley (Hordeum chilense)-derived DArT markers and their use into genetic and physical mapping. Theoretical and Applied Genetics. 2012a;124: 713–722. pmid:22048641
View Article
PubMed/NCBI
Google Scholar

[180] View Article

[181] PubMed/NCBI

[182] Google Scholar

[ref57] 57. Zhang C, Dong C, He X, Zhang L, Xia X, He Z. Allelic variants at the TaZds-D1 locus on wheat chromosome 2DL and their association with yellow pigment content. Crop Science. 2011;51: 1580–1590.
View Article
Google Scholar

[184] View Article

[185] Google Scholar

[ref58] 58. Carmona L, Zacarías L, Rodrigo MJ. Stimulation of coloration and carotenoid biosynthesis during postharvest storage of ‘Navelina’ orange fruit at 12°C. Postharvest Biology and Technology. 2012;74: 108–117.
View Article
Google Scholar

[187] View Article

[188] Google Scholar

[ref59] 59. Rodrigo MJ, Marcos JF, Zacarías L. Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation. Journal of Agricultural and Food Chemistry. 2004;52: 6724–6731. pmid:15506808
View Article
PubMed/NCBI
Google Scholar

[190] View Article

[191] PubMed/NCBI

[192] Google Scholar

[ref60] 60. Rodrigo MJ, Marcos JF, Alferez F, Mallent MD, Zacarías L. Characterization of Pinalate, a novel Citrus sinensis mutant with a fruit-specific alteration that results in yellow pigmentation and decreased ABA content. Journal of Experimental Botany. 2003;54: 727–738. pmid:12554716
View Article
PubMed/NCBI
Google Scholar

[194] View Article

[195] PubMed/NCBI

[196] Google Scholar

[ref61] 61. Britton G. Overwiew of carotenoid biosynthesis. In Carotenoids: Biosynthesis and Metabolism. (Edited by: Britton G, LiaaenJensen S and Pfander H). 1998;3: 384–389
View Article
Google Scholar

[198] View Article

[199] Google Scholar

[ref62] 62. Rouseff R, Raley L, Hofsommer HJ. Application of diode array detection with a C-30 reversed phase column for the separation and identification of saponified orange juice carotenoids. Journal of Agricultural and Food Chemistry. 1996;44: 2176–2181.
View Article
Google Scholar

[201] View Article

[202] Google Scholar

[ref63] 63. Collado-Romero M, Alós E, Prieto P. Unravelling the proteomic profile of rice meiocytes during early meiosis. Frontiers in Plant Science. 2014; 5: 356. pmid:25104955
View Article
PubMed/NCBI
Google Scholar

[204] View Article

[205] PubMed/NCBI

[206] Google Scholar

[ref64] 64. Rodríguez-Suárez C, Giménez MJ, Atienza SG. Progress and perspectives for carotenoid accumulation in selected Triticeae species. Crop and Pasture Science. 2010;61: 743–751.
View Article
Google Scholar

[208] View Article

[209] Google Scholar

[ref65] 65. May T,Soll J.14-3-3 proteins form a guidance complex with chloroplast precursor proteins in plants. The Plant Cell. 2010;12: 53–63.
View Article
Google Scholar

[211] View Article

[212] Google Scholar

[ref66] 66. Fung PK, Krushkal J, Weathers PJ. Computational analysis of the evolution of 1-deoxy-D-xylulose-5-phosphate Reductoisomerase, an important enzyme in plant terpene biosynthesis. Chemistry and Biodiversity. 2010;7: 1098–1110. pmid:20491066
View Article
PubMed/NCBI
Google Scholar

[214] View Article

[215] PubMed/NCBI

[216] Google Scholar

[ref67] 67. Neta-Sharir I, Isaacson T, Lurie S, Weiss D. Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting colour changes during fruit maturation. The Plant Cell. 2005;17: 1829–1838. pmid:15879560
View Article
PubMed/NCBI
Google Scholar

[218] View Article

[219] PubMed/NCBI

[220] Google Scholar

[ref68] 68. Lado J, Cronje P, Alquézar B, Page A, Manzi M, Gómez-Cadenas A, et al. Fruit shading enhances peel colour, carotenes accumulation and chromoplast differentiation in red grapefruit. Physiologia Plantarum. 2015.
View Article
Google Scholar

[222] View Article

[223] Google Scholar

[ref69] 69. Karlova R, Rosin FM, Busscher-Lange J, Parapunova V, Do PT, Fernier AR, et al. Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening. The Plant Cell. 2011;23: 923–941. pmid:21398570
View Article
PubMed/NCBI
Google Scholar

[225] View Article

[226] PubMed/NCBI

[227] Google Scholar

[ref70] 70. Carvalho LJCB, Lippolis J, Chen S, de Souza CRB, Vieira EA, Anderson JV.Characterization of carotenoid-protein complexes and gene expression analysis associated with carotenoid sequestration in pigmented cassava (Manihot Esculenta Crantz) storage root. The Open Biochemistry Journal. 2012; 6: 116–130. pmid:23230451
View Article
PubMed/NCBI
Google Scholar

[229] View Article

[230] PubMed/NCBI

[231] Google Scholar

Figures

Abstract

Introduction

Material and Methods

Plant material

Characterization of the translocation lines using molecular markers

Cytogenetic analysis

Physical mapping of Psy1

Analysis of the carotenoid content in wheat-H. chilense translocation lines

Statistical analysis

Protein extraction and quantification

Reverse phase-liquid chromatography RP-LC-MS/MS analysis

Bioinformatics and functional analysis of identified proteins

Results

Development of wheat- chromosome 7Hch translocation lines in hexaploid wheat

Analysis of the carotenoid composition in wheat-H. chilense translocation lines

Comparison of the seed proteomic profile among wheat and the introgression lines with carotenoid-enriched seeds

Discussion

Conclusions

Supporting Information

S1 Fig. SDS-PAGE of seed protein extracts from bread wheat and carotenoid-enriched lines.

S1 Table. Proteins identified by nLC-MS/MS.

Acknowledgments

Author Contributions

References

Development of wheat- chromosome 7H^ch translocation lines in hexaploid wheat