Plant Materials, growth Conditions and treatments

Arabidopsis (Arabidopsis thaliana) Col-0 seeds were surface sterilized and grown in potting soil (Soilrite) or MS-agar by following the growth conditions described previously [19]. Surface sterilized tobacco seeds (Nicotiana benthamiana) were germinated on MS-agar media and two-weeks-old seedlings were then transferred in the potting soil and maintained in the growth chamber under 16-h-light/8-h-dark periods with a temperature regime of 25–28°C. The atpolλ-1 and atpolλ-3 mutant lines were described previously [21]. The AtPolλ-C-TAP (DKLAT1G10520.1) and AtHSP90.1-C-TAP (DKLAT5G52640) (pLIC6 plant expression vector expressing C-terminal-TAP-tag AtPolλ or AtHSP90.1 under the CaMV-35S promoter) constructs were obtained from the ABRC, Ohio State University.

For the generation of transgenic atpolλ-1 mutant lines expressing Pol λ-Del 2 or Pol λ-Del 3 cDNA fragments, the 1.26-kb Pol λ-Del 2 and 996 bp Pol λ-Del 3 cDNA fragments were amplified using the gene-specific primers (Polλ-Del2Fw: 5’CGAGGATCCAAAATTGACTCAGAAGAAGTT3’ and AtPolRev: 5’GTTGAGCTCTCAGAGATTCCTCTCGTGT3’; Polλ-Del3Fw: (5’ACGTGGATCCGATTTGAACAGAAATATCACTGA3’) and AtPolRev: 5’GTTGAGCTCTCAGAGATTCCTCTCGTGT3’) and cloned into the BamHI-SacI sites (underlined) of pCAMBIA 1201 binary vector under the control of the CaMV-35S constitutive promoter. Plants were transformed by Agrobacterium mediated floral dip method.

To examine the possibility of UV-B induced aggregation of DNA Pol λ, protoplasts isolated from leaf mesophyll cells of 25-28-days-old wild-type Arabidopsis, transgenic atpolλ-1^Polλ-Del2ox, atpolλ-1^Polλ-Del3ox seedlings (atpolλ-1 null mutant seedlings expressing either Polλ-Del2 or Polλ-Del3 cDNA under the CaMV-35S constitutive promoter) and tobacco (Nicotiana benthamiana) leaves (transiently expressing full length C terminal TAP AtPolλ under the constitutive 35S CaMV promoter in pLIC6 plant expression vector) were irradiated with UV-B light following the method described previously [22–23] with some modifications (S1 File).

Protoplast Preparation from Arabidopsis and tobacco leaf mesophyll cells and infiltration of tobacco leaves with Agrobacteria

Protoplast isolation from Arabidopsis and tobacco (Nicotiana benthamiana) leaves were carried out following Salvucci and Anderson (1987) and Kim and Somers (2010) with minor modifications [24–25] (S1 File). For in planta analysis of the possibility of aggregation of Pol λ in presence of salinity stress, AtPolλ protein was transiently expressed in tobacco (Nicotiana benthamiana) leaves by infiltration of tobacco leaves with Agrobacteria following the procedure described previously [26] (S1 File).

Protein analysis

Details of protein extraction, immunoblot procedures, immunoprecipitation and co-immunoprecipitation are provided in S1 File.

Expression, and Purification of recombinant full length and N terminal deletion fragments of Polλ

The molecular cloning and expression of full length recombinant Arabidopsis thaliana DNA polymerase λ (AtPolλ) and its N-terminal deletion constructs in E coli cells have been described previously [21]. Details of the purification techniques of the recombinant proteins are provided in S1 File.

UV-B irradiation and salt treatment of recombinant Pol λ

The UV-B irradiation experiments were performed in a 1 cm light-path quartz cuvette and following the method described previously [27–28] with some modifications. ~500 μl protein samples (stored at -80°C) were brought to room temperature (25°C) ~1 h before UV-treatment, then centrifuged briefly at 5000 rpm for 5 min at 25°C and the supernatant was irradiated with an UV-B dose of 200 J/m² for different time points up to 4 h in the dark at 25°C. Precautions were taken so that temperature variation of protein samples during UV irradiation did not exceed 1–2°C. UV-B dose in the range between 250–300 J/m² and beyond produced severe photo chromatic effects, and therefore UV-B dose beyond 200 J/m² was avoided. For salt treatment, the purified recombinant protein samples were incubated in presence of different concentrations of NaCl for 4 h or various time points at room temperature (25°C).

Tryptophan Fluorescence Spectroscopy

Tryptophan fluorescence spectra were measured in a Jasco Spectrofluorometer FP—8500. Control or treated protein sample (0.05 mg/mL purified protein in a final volume of 600 μL of 50 mM Tric-HCl buffer, pH 7.5 containing 1 mM β-ME and 1 mM PMSF) was taken in a quartz cuvette (4 X 4 mm). Tryptophan fluorescence emission spectra were scanned between 300–400 nm using excitation wavelength of 295 nm. Both excitation and emission slits were set at 5 nm. Each spectrum was an average of three scans. Respective control buffer (no protein) spectrum was subtracted from sample spectrum to generate the fluorescence spectrum of the protein. UV-B mediated oxidation of tryptophan residues to N-formylkynurenine was measured using fluorometry with excitation wavelength of 365 nm and the emission wavelengths ranging from 390 to 530 nm, respectively [27].

Acrylamide and Iodide Fluorescence Quenching assays

Tryptophan fluorescence quenching assay was carried out by titration of protein sample (untreated control or treated) with 5 M freshly prepared acrylamide or potassium iodide solution, in 50 mM Tric-HCl buffer, pH 7.5 containing 1 mM β-ME and 1 mM PMSF. 2.0 ml of 0.05 mg/ml protein solution was taken in a 3-ml quartz cuvette. Small aliquots of freshly prepared 5 M acrylamide or potassium iodide (quencher) was added to the protein sample in the cuvette, after each addition solution was mixed by gentle pipetting and left to attain equilibrium for 2 min and then the emission spectrum was recorded. The fluorescence spectral readings for all concentrations of the titrant were corrected for the “dilution effect” because of addition of the titrant. The spectral readings were also corrected for the ‘inner filter effect’ following Eq 1: (1) Here, F and F_corr stand for the uncorrected and corrected fluorescence, while A_ex and A_em indicate the absorbance of the solution at the excitation and emission wavelengths, respectively. The quenching data were analyzed by using the Stern-Volmer plot (Eq 2). (2) where F_o and F indicate the fluorescence intensities in absence and presence of the quencher and [Q] indicates the molar concentration of the quencher. A plot of F_o /F versus [Q] yields a straight line with a slope of K_SV, called the Stern-Volmer constant.

Bis-ANS binding analysis

Bis-ANS (4,4’-dianilino-1,1’-binaphthyl-5,5- disulfonic acid) binding study was carried out by following the method described previously [29]. Purified recombinant full length Pol λ or each of the N-terminal deletion fragment (0.02 mg/ml, either untreated control or 4 h UV-B irradiated or incubated in presence of 500 mM NaCl for 2 h at 25°C) was taken in a 3 ml quartz cuvette. The fluorimeter cuvette was placed inside a Jasco Spectrofluorometer FP—8500 and the sample was titrated with an aqueous solution of 300 μM Bis-ANS by adding a small aliquot at a time. After each addition, the solution was mixed by gentle pipetting and left for 2 min to attain equilibrium. The fluorescence emission spectrum was then recorded between 450 and 550 nm by using an excitation wavelength of 390 nm. For analyzing the data according to the Scatchard equation, a titration of 0.2 μM Bis-ANS using 10.0 mg/ml or 4.0 mg/ml of recombinant protein was performed. The reverse titration data were used to obtain the quantitative relationship between fluorescence intensity change and bound Bis-ANS [30].

Urea Unfolding assay

Equilibrium urea unfolding experiments were carried out to assess the thermodynamic stability of the purified recombinant full length and N-terminal deletion fragments (Del2 and Del3) of Pol λ under stress conditions (UV-B and salt treatment) at 25°C by following the method described previously [31] with some modifications. 0.05 mg/ml of purified protein sample (untreated control, UV-B irradiated for 4 h or pre-incubated in presence of 500 mM NaCl for 2 h at room temperature), was incubated in presence of 0–8 M urea at room temperature (25°C) for 16 h. Tryptophan fluorescence spectra of the samples were scanned from 300–400 nm using excitation wavelength of 295 nm. Corresponding control buffer spectra were subtracted from each sample spectra for each set of assay to generate the fluorescence spectra of the protein samples at different urea concentrations. The unfolding profiles were constructed by plotting the intensity ratio at 337 and 350 nm (I₃₃₇/I₃₅₀) as a function of urea concentration. The urea unfolding profiles were further analyzed according to three-state transition, and the free energy of unfolding was determined by employing a global fit [29, 31]. The experimental data were fitted to the following equation using Microcal Origin 6.0 software: Here I₀, I₁, and I_∞ represent the fluorescence signal intensities for 100% native (at 0 M urea), proposed intermediate and unfolded (at 8 M urea) form respectively. ΔG⁰_NI, ΔG⁰_IU and ΔG⁰ refer to the standard free energy change between native and intermediate, intermediate and unfolded, and native and unfolded forms, respectively.

Circular dichroism (CD) spectroscopy

CD spectroscopy of control, UV-B irradiated and high salt treated purified recombinant protein samples were performed by following the protocol described previously [32–33] with some modifications. Protein samples were dialyzed separately against 5 mM sodium phosphate buffer, pH 7.5, overnight at 4°C with three changes. Far-UV CD spectroscopy was carried out with ~0.5 mg/ml purified recombinant full length Pol λ, Pol λ-Del2 and Pol λ-Del3 proteins in a total 1.5 mL reaction volume. Protein samples were UV-B irradiated with a dose of ~200 J/m² for 4 h at 25°C or pre-incubated in presence of 500 mM NaCl for 2 h at 25°C. The far-UV CD spectra was recorded at 25°C in the wavelength range of 200–260 nm in a JASCO-810 Spectropolarimeter using a 1 mm path-length rectangular cell. Five scans were recorded at 0.5 data pitch with 20 nm/min scan speed, 4.0 nm band width and 1 s time constant respectively. All spectra were buffer corrected. The CD results were expressed in terms of milideg (θ).

Fourier transform infrared (FT-IR) spectroscopy

FT-IR spectroscopy was carried out by following the method described previously [31, 34] with some modifications. For FT-IR measurement, 50 μl of ~7.5 μg of purified recombinant protein sample (full length or deletion versions of Pol λ) was taken in a microcon filter device fitted with a 3-kDa cut-off membrane. The protein sample was diluted with ~200 μl D₂O (Sigma). The sample was then centrifuged at 14000 rpm for 8 to 10 min at 4°C until the sample volume reached ~50 μl. It was further diluted with ~200 μl D₂O and again centrifuged. This D₂O exchange process was repeated 3–4 times. Finally, the D₂O exchanged protein sample (10 μl) was carefully placed in between two clean CaF₂ windows separated by a 50 μm thick teflon spacer. FT-IR scans were collected in the range of 1600–1700 cm^-1 at the resolution of 2 cm^-1 using a Spectrum 100 FT-IR spectrometer (Perkin Elmer). Spectrum of D₂O containing buffer was subtracted from each sample spectrum. Fourier self-deconvolution was used to resolve the peak positions in the broad amide I contour. Curve fitting of the original amide I contours was performed using Thermo GRAMS AI software [31, 34]. The percentage of each secondary structure was calculated by dividing the area of the corresponding peak with the total area of the amide I contour.

Light scattering measurements for in vitro protein aggregation studies

UV-B and salinity induced aggregation of purified recombinant proteins (0.1 mg/ml) was monitored by measuring static light scattering using a spectrophotometer (Shimadzu UVPC v 3.9) [29, 31]. Reactions were carried out in a 1 cm light-path black masked quartz microcuvette in a total volume of 500 μL at room temperature (25°C). Apparent O.D. of the samples was measured at 360 nm over a period of 240 min.

Tryptophan fluorescence studies of recombinant DNA Pol λ under genotoxic stress

Previously we have demonstrated that UV-B irradiation enhances the expression of Pol λ in Arabidopsis seedlings and reported its involvement in repair of UV-B induced DNA damage via nucleotide excision repair pathway [19]. In addition, our recent findings have established role of Pol λ in repair of high salinity induced DNA double strand breaks (DSBs) in Arabidopsis [21]. Based on this information, we were next interested to specifically examine the effects of genotoxic stress like UV-B irradiation and high salinity on the structural properties of Pol λ to understand the stability of this important nuclear DNA damage repair protein under genotoxic stress in plant genome. To address this issue, we first studied the tryptophan fluorescence spectra of the bacterially expressed purified recombinant full length Arabidopsis DNA Pol λ (wild-type) under control condition and after UV-B exposure or in presence of added salt to monitor whether the protein undergoes any conformational changes under such stress conditions. We have also utilized three other recombinant purified distinct N-terminal deletion mutants of this protein, lacking the N-terminal NLS sequence (Del 1), the BRCT module (Del 2) and the Ser/Pro rich (S-P) domain (Del 3) respectively, in the similar set of experiments to understand the relative influence of the N-terminal domains on the conformational stability of the highly conserved C-terminal catalytic core domain (PolX region, Del 3) and the full length protein as a whole (S1 Fig).

In case of UV-B stress, recombinant purified protein samples were exposed to UV-B light (200 J/m²) for up to 4 h as described under ‘Materials and Methods’. As shown in Fig 1, with increasing time of exposure to UV-B radiation, the tryptophan fluorescence intensity gradually decreased in both full length Pol λ and its N-terminal deletion mutant proteins. The emission maxima in almost all cases remained nearly constant at around 340 nm indicating that the polarity of the tryptophan microenvironment remained largely unaltered (Fig 1A–1D). We reasoned that the change in the tryptophan fluorescence intensity following UV-B exposure could either be due to conformational changes within the protein molecule or as a result of degradation of tryptophan residues or due to both. At this point, the analysis of the change in fluorescence intensities of the protein samples became slightly complicated as the full length Pol λ and the N-terminal mutants have different number of tryptophan residues—the full length Pol λ and Del 1 have 5 each while Del 2 and Del 3 have three tryptophan residues each, respectively (S1B Fig). Therefore, in order to compare the difference in tryptophan fluorescence intensities of full length Pol λ and the other N-terminal deletion mutants, we used normalized tryptophan fluorescence intensity per tryptophan residue for control and UV-B irradiated proteins (Fig 1E and 1F). Under control condition (without UV-B exposure), full length Pol λ showed the maximum intensity with emission maximum at 340 nm (Fig 1E). Elimination of the nuclear localization signal residues (Del 1) caused no significant change in the spectrum, indicating that the signal residues have no prominent effect on the microenvironment of the tryptophan residues. On the other hand, further elimination of the BRCT domain (Del 2) led to an appreciable decrease in the normalized fluorescence intensity (Fig 1E), while the elimination of the additional S-P domain from Del 2 had no further influence on the tryptophan spectrum in Del 3, suggesting that the two tryptophan residues in the BRCT domain had higher contribution to tryptophan fluorescence intensity than the rest of the three tryptophan residues which are located within the C-terminal PolX domain (Del 3) and therefore, the S-P region does not contribute to the tryptophan microenvironment of the protein. However interesting results were obtained for UV-B irradiated proteins (Fig 1F). UV-B irradiation for 4 hr drastically reduced normalized fluorescence intensity of full length Pol λ as well as the N-terminal deletion mutants. Whereas Del 1 showed λ_max around 340 nm, Del 2 not only showed reduced fluorescence intensity, but also displayed a clear shift of λ_max to 350 nm, indicating exposure of tryptophan residues. Del 3 had reduced intensity than Del 2 (Fig 1F). Since the protein variants of our interest have different number of tryptophan residues, we have used normalized plot of I₃₃₇/ I₃₅₀ with the time of UV-B exposure to monitor the UV-B induced conformational change of the protein variants (S4 Fig). Though, Pol λ and Del 1 did not show any appreciable change in the intensity ratio, both Del 2 and Del 3 showed steady decrease in I₃₃₇/ I₃₅₀ value with the increase in time of irradiation. However, change in the ratios of I₃₃₇/ I₃₅₀ for Del 2 and Del 3 were found to be ~18% and ~12%, respectively, suggesting that removal of the BRCT domain (Del 2) caused Pol λ to become structurally more vulnerable towards UV-B irradiation compared to the catalytic core domain (Del 3). Taken together, these results indicate that UV-B exposure helped expose primarily the tryptophan residues located within the catalytic core PolX domain (Del 3) of Del 2 fragment of Pol λ, resulting in the shift in λ_max after UV-B exposure, while the presence of Ser-Pro rich domain in Del 2 probably reduces fluorescence quenching after UV-B exposure.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Tryptophan fluorescence spectra of UV-B irradiated purified recombinant full length and N terminus truncated forms of Arabidopsis DNA Pol λ (AtPolλ).

0.05 mg/mL of purified (A) full length recombinant Pol λ, (B) Del 1, (C) Del 2, and (D) Del 3 protein samples in a final volume of 600 μL of 50 mM Tric-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF) were irradiated with an UV-B dose of ~200 J/m² for the indicated time points in the dark at 25°C. Tryptophan fluorescence spectra of control and UV-B irradiated protein samples were measured using excitation wavelength of 295 nm. The emission wavelengths were set in the range between 300 to 400 nm with the emission scan speed of 240 nm/min. The 0-h time point served as the control. (E) Normalized tryptophan fluorescence intensity per tryptophan residue in full length recombinant Pol λ, Del 1, Del 2 and Del 3 fragments under control condition (without UV-B exposure). (F) Normalized tryptophan fluorescence intensity per tryptophan residue in full length recombinant Pol λ, Del 1, Del 2 and Del 3 fragments after 4 h of UV-B (~200 J/m²) at room temperature.

https://doi.org/10.1371/journal.pone.0133843.g001

It is known that UV-B exposure causes degradation of tryptophan residues to N-formylkynurenine which shows characteristic tryptophan emission spectrum with maximum at around 440 nm [27], resulting in decreased tryptophan fluorescence intensity. In order to assess this possibility, we next compared the N-formylkynurenine spectra of control with the 4 hr UV-B exposed protein samples (Fig 2A and 2B). As shown in Fig 2A, the control proteins produced much less amount of N-formylkynurenine as compared to the UV-B exposed ones (Fig 2B). N-formylkynurenine in control samples might have generated from the UV-B exposure of the samples in the fluorescence spectrometer during the experiment. It was found that full length Pol λ produced the least amount of N-formylkynurenine compared to its N-terminal deletion mutants in terms of both total fluorescence (not shown) and normalized fluorescence spectra (Fig 2A). Among the deletion mutants, N-formylkynurenine formation was maximum in Del 2 in both control and after UV-B exposure (Fig 2A and 2B). It appeared that deletion of the signal domain (Del 1) did not significantly affect tryptophan degradation by UV-B, while removal of the BRCT domain from Pol λ (Del 2) caused higher exposure of the tryptophan residues in the C-terminal catalytic core PolX domain (Del 3 fragment) for UV-B mediated damage. Interestingly, the UV-B mediated tryptophan damage was somewhat controlled by further removal of the S-P region from Del 2 (Del 3). We also compared the UV-B induced damage of tryptophan residues of Pol λ with BSA, which has two tryptophan residues (Trp 134, Trp 214), as control. In contrast to Pol λ, UV-B exposure drastically reduced the tryptophan fluorescence intensity in BSA (Figs 1A and 2C). In addition, after 4 h of UV-B exposure, degradation of tryptophan to N-formylkynurenine was much higher in BSA (~5-times more) than in full length Pol λ (Fig 2D and 2E). Taken together, these results indicate that Pol λ possesses an intrinsic UV-B tolerance property. However, removal of the BRCT domain increased the rate of UV-B mediated damage, while further deletion of the S-P region again stabilized the C-terminal catalytic core PolX domain (Del 3) of Pol λ under UV-B stress, indicating that the S-P region has a destabilizing effect on the structure of Del 2 fragment of Pol λ.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. UV-B mediated oxidative degradation of tryptophan residues to N-formylkynurenine in Pol λ and its N-terminal deletion mutants.

(A) Normalized tryptophan fluorescence intensity per tryptophan residue in untreated control or (B) 4 h of UV-B exposed full length recombinant Pol λ, Del 1, Del 2 and Del 3 fragments. Fluorescence spectra were measured using excitation wavelength of 365 nm with the emission wavelengths ranging from 390 to 530 nm and emission scan speed of 240 nm/min, using 0.05 mg/mL of purified protein samples for analyzing the UV-B induced oxidation of tryptophan to N-formylkynurenine. (C) Tryptophan fluorescence spectra of 0.05 mg/ml of BSA (Sigma fraction V) under control or after 1 and 4 h of UV-B exposure. (D) Fluorescence spectra of control and UV-B BSA were measured using excitation wavelength of 365 nm with the emission wavelengths ranging from 390 to 530 nm to monitor the UV-B induced oxidation of tryptophan to N-formylkynurenine. (E) Normalized tryptophan fluorescence intensity per tryptophan residue in 4 h of UV-B exposed full length recombinant Pol λ and BSA. Fluorescence spectra were measured using excitation wavelength of 365 nm with the emission wavelengths ranging from 390 to 530 nm to compare the UV-B induced oxidation of tryptophan to N-formylkynurenine in Pol λ and BSA.

https://doi.org/10.1371/journal.pone.0133843.g002

The tryptophan fluorescence intensity of full length Pol λ and its N-terminal deletion mutants also decreased in presence of increasing concentrations of NaCl (Fig 3) as well as increasing time of exposure to high NaCl concentrations (S5 and S6 Figs). Full length Pol λ showed only marginal decline in tryptophan fluorescence intensity when NaCl concentration was increased to 400 mM. However at 500 mM NaCl, ~35% drop in intensity was observed as compared to control condition (Fig 3A). The Del 1 mutant showed gradual decrease in tryptophan fluorescence intensity with increasing NaCl concentration but the decrease was only ~ 15% at 500 mM NaCl (Fig 3B). Del 2 behaved in the same way as Del 1, but the decrease in tryptophan fluorescence intensity was ~ 35% in presence of 500 mM NaCl (Fig 3C). Tryptophan fluorescence intensity of Del 3 protein quenched effectively in presence of increasing NaCl concentrations and ~35% drop in intensity was observed at 200 mM NaCl. However, it was also interesting to note that at 500 mM NaCl, the normalized tryptophan fluorescence intensities (intensity per tryptophan residue) in both Del 2 and Del 3 were comparable (data not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Tryptophan fluorescence spectra of high salt treated purified recombinant full length and N terminus deletion versions of Pol λ.

0.05 mg/mL of purified (A) full length recombinant Pol λ, (B) Del 1, (C) Del 2, and (D) Del 3 protein samples in a final volume of 600 μL of 50 mM Tric-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF) were subjected to increasing concentrations of NaCl treatment for 2 h at 25°C. Tryptophan fluorescence spectra of protein samples were measured using excitation wavelength of 295 nm. The emission wavelengths were set in the range between 300 to 400 nm with the emission scan speed of 240 nm/min. Inset images indicate ratio of fluorescence intensity at 337 nm to the same at 350 nm plotted as function of NaCl concentration.

https://doi.org/10.1371/journal.pone.0133843.g003

Tryptophan fluorescence quenching analysis

To further substantiate the tryptophan fluorescence spectral pattern of full length recombinant Pol λ and the N-terminal deletion mutants, we next performed tryptophan fluorescence quenching assays using untreated control and UV-B or salt treated protein samples. Tryptophan quenching experiments were carried out using acrylamide and iodide as the complementary set of water soluble quenchers. Acrylamide, being a neutral quencher, has the greater ability to penetrate into the protein interior to quench buried tryptophan residues. In contrast, iodide, a negatively charged and highly hydrated bulky quencher, has the less ability to enter the protein interior. Thus, in case of iodide, the quenching ability is mainly related to the tryptophan residues located near the surface of the protein [35]. The tryptophan fluorescence quenching data were analysed by Stern-Volmer plot considering variable and heterogeneous emission from the different tryptophan residues. The Stern-Volmer constant, K_SV has been considered as the quenching constant, representing the weighted average of the quenching constants of individual tryptophan residues and may include contribution from both static and dynamic quenching, respectively.

The acrylamide and iodide quenching data for recombinant full length Pol λ and its N-terminal deletion mutants under control condition and after UV-B or high NaCl stress have been shown in S7 Fig as Stern-Volmer plot. The values of K_SV in the indicated conditions are summarized in Table 1. For acrylamide quenching, full length Pol λ (untreated control) showed the K_SV value of 4.7 M^-1. After UV-B exposure or 500 mM NaCl treatment, K_SV of Pol λ was increased to 5.5 M^-1 and 5.7 M^-1, indicating relatively higher exposure of tryptophan residues following stress. On the other hand, for iodide quenching of full length Pol λ, as compared to control (K_SV 5.2 M^-1), UV-B exposure reduced the K_SV value (4.4 M^-1), while 500 mM NaCl treatment did not significantly alter the K_SV (5.5 M^-1). The Del 1 fragment, with similar tryptophan microenvironment like Pol λ, did not show any significant difference from Pol λ in the K_SV values of acrylamide or iodide quenching of untreated control or treated protein (data not shown). For acrylamide quenching of Del 2 fragment of Pol λ, particularly after UV-B exposure, the K_SV value was found to increase from 5.7 M^-1 (control) to 7.0 M^-1, while in presence of 500 mM NaCl, the K_SV for Del 2 (5.2 M^-1) did not show any prominent change than control. More or less similar pattern was obtained for iodide quenching in Del 2 fragment under control and after UV-B or salt treatment, respectively (Table 1). For both acrylamide and iodide quenching, Del 3 protein showed relatively higher accessibility of tryptophans to the quencher after UV-B exposure (K_SV values of 6.5 M^-1 and 5.8 M^-1 for acrylamide and iodide, respectively) and salt treatment (K_SV 6.0 M^-1 and 5.3 M^-1 for acrylamide and iodide, respectively) than untreated control (K_SV values of 5.3 M^-1 and 4.9 M^-1 for acrylmide and iodide, respectively). Taken together, these results indicate marginal conformational change in full length Pol λ following the indicated doses of UV-B exposure or in presence of higher NaCl concentration used in this study. However, appreciable change in the microenvironment of tryptophan residues in UV-B irradiated Del 2 protein caused relatively easier penetration of the quencher molecule. These results were also consistent with the pattern of the tryptophan fluorescence spectra of the proteins in general (Figs 1 and 3).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Acrylamide and KI quenching constants (K_SV) of control, UV-B irradiated and high salt treated purified recombinant full length and N terminus deletion versions of recombinant purified Arabidopsis thaliana DNA Pol λ.

https://doi.org/10.1371/journal.pone.0133843.t001

Conformational change of recombinant full length Pol λ and its N-terminal deletion mutants after UV-B and salinity stress

Surface hydrophobicity properties of proteins provide essential insight towards understanding the behavior of proteins under stressed conditions and potential interactions among protein partners [36]. Bis-ANS (4,4’-dianilino-1,1’-binaphthyl-5,5- disulfonic acid) is a conformation-sensitive hydrophobic probe with low fluorescence quantum yield in aqueous solution while becomes highly fluorescent upon binding to hydrophobic pockets [37]. Bis-ANS has been extensively used for probing the surface-exposed hydrophobicity of proteins in plethora of studies [29, 38–39]. We performed Bis-ANS binding assay to investigate the exposure of hydrophobic pockets on the surface of Arabidopsis Pol λ and its N-terminal deletion mutants following UV-B exposure or high salt treatment. For the quantification of the number of Bis-ANS binding sites (n) and the binding constant (k_d), fluorometric titration of control and UV-B or NaCl treated proteins by Bis-ANS were carried out. The Bis-ANS titration curves for the protein samples have been shown in Fig 4A–4C, respectively. The data were analysed by plotting v versus v/S following the Scatchard equation: v = n—k_d [v/S], considering n number of identical non-interacting sites per subunit of the protein samples, where v and S represent the concentrations of bound and free Bis-ANS (μM), respectively, while k_d stands for the dissociation constant.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Changes in surface hydrophobicity of purified recombinant full length and N terminus deletion mutants of Pol λ following UV-B irradiation or high salt treatment.

(A) Bis-ANS binding titration of untreated control, UV-B irradiated and high NaCl treated recombinant Pol λ. (B) Bis-ANS binding titration of untreated control, UV-B irradiated and high NaCl treated Del 2 protein. (C) Bis-ANS binding titration of untreated control, UV-B irradiated and high NaCl treated Del 3 protein. (D-F) Representative Scatchard plots of untreated control, UV-B irradiated and high NaCl treated recombinant Pol λ, (G-I) Del 2 protein and (J-L) Del 3 protein for the determination of stoichiometry (n) and the dissociation constant (k_d) respectively. 0.02 mg/mL of each purified protein in 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM PMSF and 1 mM β-mercaptoethanol) was titrated by addition of aqueous solution of Bis-ANS. The excitation and emission wavelengths were 390 and 490 nm, respectively. The intensities at 490 nm, from the titration, were plotted as a function of Bis-ANS concentration. UV-B and NaCl treatment of purified recombinant proteins were carried out as described under ‘Materials and Methods’.

https://doi.org/10.1371/journal.pone.0133843.g004

In addition, a reverse titration of Bis-ANS by protein samples were also carried out for the conversion of the change in fluorescence intensity into bound Bis-ANS [30]. The Scatchard plots, obtained from the reverse titration assay for the Bis-ANS-Pol λ, -Del 2 and-Del 3 binding under control or after UV-B or salt treatment are shown in Fig 4D–4F, 4G–4I and 4J–4L, respectively. The number of binding sites (n) and the dissociation constant for binding (k_d) were calculated from the slope and intercepts of the plot and are summarized in Table 2.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. Determination of stoichiometry (n) and dissociation constant (K_d) of recombinant full length and N terminus truncated forms of AtPolλ under control and after UV-B irradiation or high NaCl treatment.

https://doi.org/10.1371/journal.pone.0133843.t002

Comparison among untreated control protein samples have revealed that the hydrophobic sites decreased from full length Pol λ to Del 2, while increased slightly from Pol λ to Del 3 (Table 2), suggesting that whereas the deletion of BRCT domain has only marginal effect on surface hydrophobicity, removal of S-P region probably causes exposure of some hydrophobic groups to the surface of the globular structure of the protein. However, for full length Pol λ, after UV-B exposure, the hydrophobic sites (n) were slightly decreased from 0.22 to 0.17 with the concomitant increase in dissociation constant (k_d) from 3.7 to 4.7 μM (Table 2). On the other hand, after 500 mM NaCl treatment, n for Pol λ increased ~2-fold with a decrease in k_d value by a factor of over 3 (Fig 4A, Table 2). The removal of N-terminal signal sequence (Del 1) did not cause any significant difference in the surface hydrophobicity properties under control or following stress treatment (data not shown). However, Del 2 protein showed a marginal decrease in n after UV-B exposure indicating loss of hydrophobic pockets possibly due to partial unfolding of the protein. This result was consistent with the tryptophan fluorescence spectra of Del 2 after UV-B exposure (Fig 4B, Table 2). Del 3 showed decrease in n after UV-B exposure (Fig 4C, Table 2). Interestingly, at high salinity condition, Pol λ and all of its N-terminally deletion mutants showed increase in n value. Since ionic interactions are suppressed with the increase in ionic strength of the medium, at higher NaCl concentrations hydrophobic interactions play major role and might result in the higher proportion of binding of the Bis-ANS molecule to the hydrophobic patches of the proteins.

Thermodynamic stability of Pol λ and its N-terminal deletion mutants under genotoxic stress

To understand the thermodynamic basis of the stability of Pol λ under UV-B and NaCl stress and the relative sensitivity of the N-terminal deletion versions of the protein towards such stress conditions, we next studied the relative resistance of these proteins to urea-induced unfolding by measuring the tryptophan fluorescence of the protein solutions as a function of urea concentration in the absence or presence of stress treatment. Since the emission maxima shifted from 337 to over 350 nm with the increase in urea concentration from 0 to 8 M, the data were plotted as fluorescence intensity ratio (I337/I350) against urea concentration as described under ‘Materials and Methods’. Fig 5 shows the urea denaturation profiles of Pol λ, Del 2 and Del 3 proteins under control and after UV-B or NaCl treatment, respectively. The urea induced denaturation profiles yielded sigmoidal shape of the curves, indicating cooperativity. From the sigmoidal data analysis, the urea concentration, which caused 50% denaturation (C_0.5) of the proteins, was obtained. For full length recombinant Pol λ, the C_0.5 in the absence and presence of UV-B or salt stress were found to 2.98 (control), 2.71(UV-B) and 3.18 M urea, respectively. In case of Del 2 fragment of Pol λ, C_0.5 under control condition was 2.93 M urea, while UV-B irradiated or salt treated Del 2 showed C_0.5 values of 2.64 and 2.92 M urea, respectively. The C_0.5 of Del 3 fragment (catalytic core PolX domain) changed from 3.66 (control) to 3.18 M urea after UV-B irradiation and to 3.81 M urea in presence of 500 mM NaCl (data not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Thermodynamic stability of recombinant full length and the N terminus truncated forms of Pol λ under UV-B and high salt stress.

(A-C) Urea induced denaturation profiles of recombinant full length Pol λ without treatment (A), after UV-B irradiation (B) or high salt treatment (C), respectively. (D-F) Urea induced denaturation profile of Del 2 protein without treatment (D), after UV-B irradiation (E), and high salt treatment (F). (G-I) Urea induced denaturation profile of DNA Pol λ-Del 3 protein without treatment (G) or after UV-B irradiation (H) and high salt treatment (I). The experiments were performed using 0.05 mg/mL of purified protein in 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF). Untreated control, UV-B irradiated (~200 J/m² UV-B irradiation for 4 h at 25°C) and high salt (500 mM NaCl treatment for 2 h at 25°C) treated protein samples were incubated in presence of increasing concentrations of urea (0–8 mM) in total 600 μL of reaction volume for about 16 h at room temperature (25°C). Samples were excited at 295 nm and emission was scanned between 300 to 400 nm. Ratio of fluorescence intensity at 337 nm to the same at 350 nm was plotted as function of urea concentration.

https://doi.org/10.1371/journal.pone.0133843.g005

The standard free energy change (ΔG⁰) required to fully unfold the proteins from their native state in absence of urea was calculated by fitting the experimental denaturation profile according to a three-state model [31], assuming one intermediate and the thermodynamic parameters thus determined are summarized in Table 3. For recombinant full length Pol λ and its N-terminal deletion versions such as Del 2 and Del 3, the ΔG⁰_I were found to be higher than ΔG⁰_II both in the absence or presence of stress, suggesting that the intermediate is located away from the native state of the respective proteins in the free energy coordinate. However, under control condition, the stability (ΔG⁰) of Pol λ was different from Del 3 protein while ΔG⁰ of Del 2 did not differ significantly from Pol λ (Table 3). In the absence of UV-B or added NaCl (untreated control) ΔG⁰ of Del 3 (24.2 kJ/mole) was always higher than Pol λ (ΔG⁰: 19.7 kJ/mole) and Del 2 (18.2 kJ/mole), respectively. After UV-B treatment, ΔG⁰ of Pol λ was decreased from 19.7 kJ/mole to 17.6 kJ/mole, whereas for Del 2 and Del 3, ΔG⁰ decreased from 18.2 kJ/mole to 16.1 kJ/mole and from 24.2 kJ/mole to 22.4 kJ/mole, respectively following UV-B exposure. However, salt treatment showed somewhat stabilizing effect for all the protein samples. The ΔG⁰ of Del 1 did not show any appreciable difference from Pol λ either in absence or presence of stress (data not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 3. Parameters of equilibrium urea unfolding of recombinant full length and N terminus truncated forms of AtPol under control and after UV-B irradiation or high NaCl treatment.

https://doi.org/10.1371/journal.pone.0133843.t003

Study of the secondary structure of recombinant Pol λ by circular dichroism and fourier transform infrared spectroscopy following UV-B and high salinity stress

We next analyzed the conformational change of Pol λ and the relative effects of the N-terminal domains on the structural stability of Pol λ at the level of secondary structure of the protein in the absence or presence of UV-B or NaCl stress. Far-UV circular dichroism (CD) spectra of recombinant Pol λ and its N-terminal deletion mutants (Del 2 and Del 3) were analyzed under control condition (without stress treatment) and after UV-B exposure or NaCl treatment of the protein samples as described under ‘Materials and Methods’. CD spectra of untreated control Pol λ and its N-terminal deletion versions are shown in Fig 6A, which indicated typical characteristics of alpha helical protein. However, control Del 2 protein showed appreciable difference from Pol λ and Del 3. (Fig 6A). On the other hand, whereas, CD spectral pattern of Pol λ and Del 3 remained mostly unaltered after UV-B exposure or salt treatment (Fig 6B and 6D), as compared with the untreated control condition, UV-B exposed Del 2 protein showed appreciable change in the CD spectrum (from w shape to v shape), suggesting some loss of secondary structural component. Salt treatment did not significantly alter the CD spectrum of Del 2 protein (Fig 6C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Analysis of changes in the secondary structure of full length Pol λ and it N-terminal deletion mutant proteins by far-UV CD spectroscopy.

~0.5 mg/ml purified recombinant protein samples in a total 1.5 mL reaction volume were UV-B irradiated with a dose of ~200 J/m² for 4 h at 25°C or pre-incubated in presence of 500 mM NaCl for 2 h at 25°C. The far-UV CD spectra were recorded at 25°C in the wavelength range of 200–260 nm in a JASCO-810 Spectropolarimeter. (A) The far-UV CD spectra of untreated control Pol λ, Del 2 and Del 3 proteins. (B) The far-UV CD spectra of untreated control, UV-B and salt treated recombinant Pol λ. (C) The far-UV CD spectra of untreated control, UV-B and salt treated Del 2 protein. (D) The far-UV CD spectra of untreated control, UV-B and salt treated Del 3 protein.

https://doi.org/10.1371/journal.pone.0133843.g006

In order to obtain quantitatively analyzed view of the CD spectral data, we fitted each spectrum with various secondary structure analysis programs such as, SELCON3, CONTIN, CDSSTR, CDNN, etc. [40]. Although the general agreement between the fitted parameters from different programs were not consistent and satisfactory, considerable increase in β-sheet structure at the expense of helical structure and increase in random coil contribution did not occur as a result of removal of the N-terminal domains of Pol λ or following exposure to UV-B or high NaCl (Table 4). Pol λ and its N-terminal mutants showed α-helix in the range of 30–35%. The variations in most cases were within the limits of experimental error. On the other hand, β-sheet, unordered content and turn were found in the range of ~16–20%, 20% and 32%, respectively. After UV-B and salt stress, Pol λ showed decreased α-helix content with some increase in the unordered structure. Similar pattern was observed with Del 2, however the extent of loss of α-helix content in Del 2 after UV-B exposure was ~22% as compared with Pol λ where ~14% loss of α-helix content was obtained. The loss of α-helix was complemented with some increase in β-sheet and random coil structure.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 4. Analysis of changes in the secondary structure compositions (in percentage) of full length and the N terminus truncated forms of recombinant purified Pol λ after UV-B and high salt stress by far-UV CD spectroscopy.

https://doi.org/10.1371/journal.pone.0133843.t004

To further substantiate the secondary structure related information of the proteins obtained from the CD spectra, we next carried out the fourier transform infrared spectroscopy (FT-IR) using the purified recombinant protein samples. The amide I band of protein FT-IR showed overlapping bands from different secondary structural elements, which were resolved by Fourier self-deconvolution. The original amide I band and the curve fitting have been shown in S8 Fig. The percentage of individual secondary structural elements was obtained by using the GRAMS AI curve fitting program (S9 Fig). The percentage of secondary structures thus obtained has been shown in S1 Table. The percentage of secondary structure obtained from fitting the FTIR spectrum of the Pol λ and its N-terminal deletion mutants in presence and absence of stress in general was consistent with the CD data. Loss of α-helix content in Pol λ after UV-B exposure was 13%, while it was 20% in Del 2 protein under similar condition (S1 Table). The loss of the helical content in Del 2 seems mostly due to unfolding of the protein as indicated by the increased random coil structure of the protein. Del 3 did not show any appreciable change in its structure in presence and absence of stress (S9 Fig and S1 Table). In vitro activity assay using purified recombinant proteins have also indicated compromised DNA polymerase activity of 4 h UV-B irradiated Del 2 fragment of Pol λ, while UV-B did not drastically reduce the polymerase activity of the catalytic core PolX domain (Del 3), indicating the regulatory function of the S-P region (S10A–S10D Fig). Interestingly, considerable activity was detected with full length and N-terminal deletion forms of Pol λ in presence of up to 400–500 mM NaCl, (S10E–S10H Fig), indicating maintenance of active conformation of the protein in presence of high salt. Furthermore, as expected, the major part of the DNA polymerase activity has been found to be associated with C terminus catalytic core PolX domain (Del 3) of the protein, while the N terminus S-P region suppressed Pol λ activity (S10A, S10D, S10E and S10H Fig, 0 h time points). These results were consistent with human DNA Pol λ, where the N terminus Ser-Pro rich domain has been shown to exert similar inhibitory function on the DNA polymerase activity of the enzyme [41].

Pol λ does not form aggregates under UV-B and high salinity stress

UV-B light frequently causes protein misfolding and aggregation by modification or destruction of amino acid residues [42], while high salinity also acts as a major genotoxic stress for plants, affecting protein unfolding and solubility. Based on this, we next studied whether exposure to UV-B or high NaCl concentrations affect the stability of Pol λ in vitro and in vivo. Light scattering experiments were carried out using purified recombinant protein samples to monitor aggregation after UV-B exposure or high NaCl treatment. The Del 2 and Del 3 fragments of Pol λ showed slightly higher light scattering at room temperature (25°C) than full length Pol λ (Fig 7A). Similar pattern was also noted at 37°C (data not shown). However, no significant increase in light scattering could be detected after UV-B irradiation or high NaCl treatment either at 25°C (Fig 7B–7D) or at 37°C (data not shown). The light scattering behaviour of Del 1 in the absence or presence of stress was similar to recombinant full length Pol λ (data not shown). UV-B induced aggregation of purified bovine γ-crystallin and aggregation of chicken IgG in presence of 500 mM NaCl were used as positive controls (Fig 7E and 7F) to validate the experimental conditions. Taken together, these results indicate that ~200 J/m² of UV-B irradiation for up to 4 h or high salinity (500 mM NaCl) did not cause any significant level of aggregation of Pol λ or its N-terminal deletion mutants in vitro.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Analysis of the possibility of UV-B and salt-induced aggregation of Pol λ in vitro and in vivo.

A) Aggregation assay using untreated control purified recombinant full length and N terminus deletion mutants of Pol λ. Aggregation assay using (B) untreated control, UV-B irradiated and salt treated purified recombinant full length, (C) Del 2 and (D) Del 3 proteins, respectively. (E) UV-B mediated aggregation of purified bovine γ crystalline. (F) Aggregation of high salt treated chicken IgG. 0.1 mg/ml of purified untreated control, UV-B irradiated (~200 J/m² of UV-B treatment for 4 h at 25°C) or salt treated (500 mM NaCl treatment for 2 h at 25°C) protein samples in 50 mM Tris-HCl, pH 7.5 (with 1 mM PMSF and 1 mM β-mercaptothanol) were subjected to static light scattering at 360 nm. Absorbance was measured over a time course of 4 h at room temperature (25°C). Influence of UV-B irradiation and high salinity stress on Aggregation of Pol λ and its N terminus truncated forms in vivo. (G) and (H) Immunoblotting of protein extracts from soluble and insoluble (pellet) fractions of UV-B irradiated protoplasts from wild-type Arabidopsis (G) and tobacco leaf mesophyll cells transiently expressing AtPolλ (H). (I) and (J) Immunoblotting of protein extracts from soluble and insoluble (pellet) fractions from 7-days-old wild-type Arabidopsis seedlings (I) and Agro-infiltrated tobacco leaves (transiently expressing AtPolλ) exposed to increasing concentrations of NaCl (J). (K) and (L) Immunoblotting of protein extract from soluble and insoluble (pellet) fractions from UV-B irradiated protoplasts of transgenic atpolλ-1 seedlings expressing Pol λ-Del-2 protein (atpolλ-1^{Pol λ-Del 2}) (K) or 7-days-old atpolλ-1^{Pol λ-Del 2} seedlings exposed to increasing concentrations of NaCl (L). (M) and (N) Immunoblotting of protein extracts from soluble and insoluble (pellet) fractions from UV-B irradiated protoplasts of transgenic atpolλ-1 seedlings expressing Pol λ-Del 3 protein (atpolλ-1^{Pol λ-Del 3}) (M) or 7-days-old atpolλ-1^{Pol λ-Del 2} seedlings exposed to increasing concentrations of NaCl (N). Positions of DNA Pol λ in the soluble and pellet fractions have been indicated. Size markers are shown on the left of gel images. Ponceau S stained membranes with the soluble protein extracts showing RuBisCo large subunit (LSU) have been shown as loading controls (middle panel, Fig G-N). Representative data in Fig G-N are from three trials with similar results. Immunoblotting of protein extracts from Arabidopsis (Col-0 and transgenic lines) protoplasts or seedlings were carried out using affinity purified anti-AtPolλ polyclonal antibody (1:250 dilutions) while anti-c-Myc antibody (1:1000 dilutions) was used for immunodetection of DNA Pol λ in protein extracts from tobacco leaves or mesophyll cell protoplasts ectopically expressing AtPolλ. atpolλ-1 is a null mutant line, devoid of AtPolλ expression. Representative gel images from at least three independent trials are shown.

https://doi.org/10.1371/journal.pone.0133843.g007

We next looked into the possibility of aggregation of Pol λ in vivo in the absence or presence of UV-B or high salt stress. The extent of aggregation was determined from the loss of relative amount of target protein in the soluble fractions and recovery in the insoluble fractions as measured by immunoblot analysis. Intact protoplasts from wild-type Arabidopsis (expressing the endogenous Pol λ) and tobacco (Nicotiana benthamiana) leaf mesophyll cell (transiently expressing C-terminal TAP-tagged Arabidopsis Pol λ under CaMV-35S promoter) were exposed to UV-B light (~200 J/m²) or 7-days-old wild-type Arabidopsis seedlings or Agro-infiltrated tobacco leaves (transiently expressing Pol λ) were subjected to increasing concentrations of NaCl (0–300 mM) treatment (S1 File). Immunoblotting of soluble and insoluble protein extracts from UV-B and high salt treated seedling samples have detected localization of Pol λ mostly in the soluble fractions (Fig 8G–8J, upper panels). Only marginal loss of Pol λ band intensity, if any, was detected in the soluble fraction in both Arabidopsis and tobacco under UV-B exposure and salinity stress (Fig 7G–7J, upper and lower panels, respectively).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. Pol λ interacts with HSP90 in vivo.

(A) Leaves from Agro-infiltrated tobacco (N. benthamiana) plants, transiently and ectopically expressing AtPolλ-C-TAP (DKLAT1G10520.1) and AtHSP90.1-C-TAP (DKLAT5G52640) were harvested and cross-linked with 1% formaldehyde. Protein extracts from the harvested tobacco leaves was immunoprecipitated with affinity purified anti-AtPolλ polyclonal antibody and anti-AtPolλ immunoprecipitate (IP) was probed with anti-HSP90 antibody (1:500 dilution) (coIP). (B) Pol λ and HSP90 interacts in Arabidopsis at endogenous levels. Arabidopsis seedlings were grown for 7–10 under long day cycles, seedlings were harvested, cross-linked with 1% formaldehyde and protein extract was prepared. The protein extract was immunoprecipitated with affinity purified anti-AtPolλ polyclonal antibody and immune complexes from protein extracts were probed for endogenous AtPolλ (IP) and coimmunopreciptated endogenous HSP90 (coIP) using affinity purified anti-AtPolλ polyclonal antibody (1:250 dilution) and anti-HSP90 antibody (1:500 dilution), respectively. Actin, detected by anti-actin monoclonal antibody was used as loading control. Protein extracts from atpolλ-3 was used as positive control while atpolλ-1 was used as negative control. atpolλ-1 is a null mutant line, devoid of Pol λ expression and atpolλ-3 is Pol λ protein positive mutant allele. Migration positions of Pol λ or HSP90 have been indicated. (C) Geldanamycin (GDA) treatment inhibits Pol λ-HSP90 interaction. 7-days-old Arabidopsis seedlings (Col-0) were treated with 5 μM GDA or vehicle (1% DMSO) for 8 h, protein extracts prepared and immunoprecipitated with anti-AtPolλ polyclonal antibody. Immune complexes from protein extracts were probed for endogenous AtPolλ (IP) and coimmunopreciptated endogenous HSP90 (coIP). Actin was used as loading control. (D) and (E) Geldanamycin treatment reduces Pol λ protein level. 7-days-old Arabidopsis seedlings (Col-0) were treated with 1% DMSO (D) or 5 μM GDA (E) for the indicated time points and protein extracts were immunoblotted as indicated. Actin was used as loading control. Quantifications of the data in (D) and (E) (lower graph). *P <0.05, *P <0.01 relative to respective controls (n = 3). (F) 7-days-old wild-type Arabidopsis seedlings were treated with 5 μM GDA for 8 h with vehicle (DMSO) or with 50 μM MG132 for at least 4 h. Protein extracts were then immunoblotted using anti-AtPolλ polyclonal antibody. Actin was used as loading control. (G) 7-days-old wild-type Arabidopsis seedlings were treated with 200 μM cycloheximide in the absence (upper panel) or presence of 5 μM GDA for the indicated time points (lower panel) and protein extracts were immunoblotted as indicated. (H) Pol λ signals were quantified and normalized against actin signals. Data shown are means ± SD of three independent replications (lower graph). Representative gel images from at least three independent trials are shown.

https://doi.org/10.1371/journal.pone.0133843.g008

To analyse the effects of deletion of N-terminal domains on the aggregation of Pol λ in presence of UV-B or salinity stress in vivo, immunoblotting was carried out using protein extracts from control and UV-B irradiated leaf mesophyll cell protoplasts from stable transgenic atpolλ-1 mutant plants (devoid of AtPolλ expression) expressing Pol λ: Del2 and Del3 cDNA fragments under the control of the CaMV-35S constitutive promoter (atpolλ-1^{Pol λ-Del2} and atpolλ-1^{Pol λ-Del3}) (S11 Fig). For salt stress, 7-days-old transgenic atpolλ-1^{Pol λ-Del2} and atpolλ-1^{Pol λ-Del3} seedlings were exposed to increasing concentrations of NaCl at room temperature and then protein extracts were prepared. After UV-B or salinity stress, as like Pol λ, major amounts of Del 2 and Del 3 proteins were mainly found in the soluble fractions, however, detectable levels of both Del 2 and Del 3 proteins were also observed in the insoluble fractions following stress treatment (Fig 7K–7N, upper and lower panels). UV-B irradiated protoplasts expressing Del 2 showed a progressive loss of Del 2 band (~46-kDa) intensity in the soluble protein fraction along with the gradual accumulation of Del 2 in pellet fraction with increasing duration of exposure to UV-B light (Fig 7K). In addition, the relative level of Del 3 protein in the soluble fraction was also decreased in presence of 200–300 mM NaCl with the concomitant appearance of detectable level of Del 3 protein in the pellet fraction under identical conditions (Fig 7N). Taken together, these results may indicate partial unfolding of Del 2 fragment of Pol λ particularly under UV-B stress and also some extent of high salinity mediated unfolding of Del 3, resulting in the availability of the proteins in the insoluble fraction. The possibility of protein aggregation cannot be completely ruled out. However, light scattering experiments did not indicate any significant level of protein aggregation after stress treatment.

Pol λ is a client of the eukaryotic molecular chaperone HSP90

In mammals, the essential molecular chaperone HSP90 interacts directly with many important components of DNA damage response pathway to regulate the stability and accumulation of DNA damage repair proteins [43–44]. Based on this, we next tested whether Pol λ interacts with HSP90 in plant cell to understand the regulation of stability of this protein at the molecular level. To study the possible interaction in vivo, we carried out coimmunoprecipitation experiments (Co-IPs) from transiently coexpressed Arabidopsis DNA Pol λ (AtPolλ) and HSP90 (both as C-terminal TAP tag constructs) in Nicotiana benthamiana leaves. HSP90 was successfully detected in AtPolλ immunoprecipitates from tobacco leaf tissues ectopically expressing AtPolλ-TAP and AtHSP90.1-TAP under the CaMV-35S promoter, indicating that a Pol λ-HSP90 complex can form in vivo (Fig 8A). Immunoprecipitations performed using an anti-AtPolλ antibody on extracts from wild-type Arabidopsis seedlings detected HSP90 in the immunoprecipitates (Fig 8B). HSP90 was not coimmunoprecipitated from atpolλ-1 null background, while HSP90 was detected in coimmunoprecipitates using protein extracts from atpolλ-3 background, the protein-positive allele AtPolλ (Fig 8B). In addition, the interaction was strongly diminished in presence of geldanamycin (Fig 8C), a specific inhibitor of HSP90 [45], suggesting that HSP90 specifically interacts with Pol λ. Together, these results indicate that Pol λ and HSP90 interact in vivo at endogenous levels and support the idea that Pol λ is a client of HSP90.

Geldanamycin treatment probably induces proteasomal degradation of Pol λ

To further understand the functional significance of the interaction between HSP90 and Pol λ, we next examined the effect of geldanamycin, which acts as a specific inhibitor of HSP90, on Pol λ protein levels in Arabidopsis seedlings. 7-days-old wild-type Arabidopsis seedlings were treated with 5 μM of geldanamycin (GDA) or vehicle (DMSO) for the indicated time points (Fig 8D and 8E) and Pol λ protein levels were analysed by immunoblotting. After DMSO treatment, the normal oscillation in Pol λ protein level was observed (Fig 8D), whereas GDA treatment caused significant reduction in Pol λ levels (Fig 8E, lower panel graph).

Geldanamycin is known to induce proteasomal degradation of HSP90 clients [46]. Therefore, we next examined effects of proteasomal inhibitors. As shown in Fig 8F, MG-132 treatment of wild-type Arabidopsis seedlings appreciably compromised the geldanamycin mediated reduction of Pol λ protein levels. Treatment of Arabidopsis seedlings with translation inhibitor cycloheximide indicated that geldanamycin treatment considerably reduced the half-life of Pol λ (Fig 8G and 8H). On the other hand, geldanamycin treatment showed little effect on Pol λ mRNA levels in Arabidopsis seedlings (S12 Fig). Together, these results indicate that geldanamycin induced depletion in HSP90 is most likely associated with the accelerated proteasomal degradation of Pol λ in Arabidopsis and thus link the possibility of HSP90 mediated regulation of stability of Pol λ.