Figures
Abstract
Ankyrin-G is an adaptor protein that links membrane proteins to the underlying cytoskeletal network. Alternative splicing of the Ank3 gene gives rise to multiple ankyrin-G isoforms in numerous tissues. To date, only one ankyrin-G isoform has been characterized in heart and transcriptional regulation of the Ank3 gene is completely unknown. In this study, we describe the first comprehensive analysis of Ank3 expression in heart. Using a PCR-based screen of cardiac mRNA transcripts, we identify two new exons and 28 alternative splice variants of the Ank3 gene. We measure the relative expression of each splice variant using quantitative real-time PCR and exon-exon boundary spanning primers that specifically amplify individual Ank3 variants. Six variants are rarely expressed (<1%), while the remaining variants display similar expression patterns in three hearts. Of the five first exons in the Ank3 gene, exon 1d is only expressed in heart and skeletal muscle as it was not detected in brain, kidney, cerebellum, and lung. Immunoblot analysis reveals multiple ankyrin-G isoforms in heart, and two ankyrin-G subpopulations are detected in adult cardiomyocytes by immunofluorescence. One population co-localizes with the voltage-gated sodium channel NaV1.5 at the intercalated disc, while the other population expresses at the Z-line. Two of the rare splice variants excise a portion of the ZU5 motif, which encodes the minimal spectrin-binding domain, and these variants lack Ξ²-spectrin binding. Together, these data demonstrate that Ank3 is subject to complex splicing regulation resulting in a diverse population of ankyrin-G isoforms in heart.
Citation: Yamankurt G, Wu HC, McCarthy M, Cunha SR (2015) Exon Organization and Novel Alternative Splicing of Ank3 in Mouse Heart. PLoS ONE 10(5): e0128177. https://doi.org/10.1371/journal.pone.0128177
Academic Editor: Emanuele Buratti, International Centre for Genetic Engineering and Biotechnology, ITALY
Received: December 20, 2014; Accepted: April 24, 2015; Published: May 29, 2015
Copyright: Β© 2015 Yamankurt et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This work was supported by the NIH NHLBI 092232 to GY and SRC. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Normal excitation-contraction coupling in skeletal and cardiac myocytes requires that the relative arrangement of integral membrane proteins remains unperturbed throughout the contraction cycle. Some of these membrane proteins facilitate structural continuity between adjacent myocytes, while other membrane proteins mediate the ionic flux that underlies excitation-contraction coupling. Adaptor proteins like ankyrin are critical for the retention and scaffolding of integral membrane proteins to the underlying cytoskeleton. By scaffolding specific membrane proteins and signaling molecules, ankyrins also contribute to the functional specialization of subcellular domains within myocytes.
Alternative splicing of an ankyrin gene produces different isoforms that display unique functions and subcellular distribution. In fact, alternative splicing of the Ank3 gene results in numerous ankyrin-G isoforms that have been detected in various tissues including brain, skeletal muscle, lung, and kidney [1β6]. In heart, only one ankyrin-G isoform has been characterized, yet numerous membrane proteins have been shown to interact with ankyrin-G including connexin 43, Ξ² dystroglycan, and voltage-gated sodium channels [7β12]. These membrane proteins are expressed at distinct membrane domains in ventricular cardiomyocytes such as the intercalated disc, transverse(T)-tubule, and costamere [7, 8, 10β12]. Considering these findings, we hypothesize that the heart expresses more than one isoform of ankyrin-G.
This study is the first to report the comprehensive analysis of Ank3 expression and alternative splicing in the heart. We demonstrate that the heart expresses multiple ankyrin-G isoforms and that ankyrin-G isoforms are detected at the intercalated discs and T-tubules of individually isolated cardiomyocytes. Using a PCR-based screen of cardiac mRNA, we identify two new exons in the Ank3 gene and 28 novel splicing events in Ank3 transcripts. We measure the relative ventricular expression of each splice junction by quantitative real-time PCR with transcript-specific primers. We demonstrate that expression of exon 1d, one of the five first Ank3 exons, is restricted to heart and skeletal muscle. We evaluate some of the alternative splice isoforms for altered function and find that two rare isoforms of the ankyrin-G spectrin-binding domain lack spectrin binding. In summary, this study demonstrates that the Ank3 gene is subject to complex splicing regulation resulting in numerous ankyrin-G isoforms in heart. We anticipate that these different isoforms underlie the diversity of ankyrin-G functions and subcellular distribution within cardiomyocytes.
Materials and Methods
RNA isolation, reverse transcription, and PCR amplification of Ank3 transcripts
RNA was isolated from mouse tissues with GenEluteMammalian RNA kit (Sigma Aldrich). cDNA was synthesized using SuperScript III (Life Technologies). Ank3 transcripts were amplified using nine overlapping primer sets using Phusion polymerase (Finnzymes) from mouse heart cDNA. PCR products were purified, ligated into pCR2.1-TOPO vector (Life Technologies), and sequenced.
Quantitative RT-PCR analysis of alternative Ank3 transcripts
Exon-exon boundary spanning primers containing ~12 base pairs from each exon were designed to PCR-amplify specific Ank3 splice junctions as previously described [13]. cDNA was synthesized from mRNA isolated from three age- and sex-matched mice. For each primer set, quantitative rt-PCR was performed in triplicate using SYBR Green Jumpstart Taq mix (Sigma Aldrich) and experiments were repeated three times. Analysis of the data was performed using a modified version of the Pfaffl method to incorporate primer efficiencies [14]. First, alternative Ank3 splice junctions were grouped according to shared exons (e.g. E15/16 is grouped with E15/17). The fold difference was determined using the highest threshold cycle (CT) value within that group as a reference. Percentage of abundance of each junction was calculated by comparing the CT value of that junction to the sum of all CT values for that group (e.g. the sum of E15/16 and E15/17 equal 100%). All errors were propagated through the fold difference and percentage calculations as standard deviations. The results were graphed with individual bars representing the average of a technical replicate and error bars represent standard deviations. Nucleotide sequences, amplicon lengths, annealing temperatures, and efficiencies for qt-PCR primer sets are listed in S1 Table.
Molecular cloning of Ξ²-spectrins, ankyrin-G SBD and CTD variants
Spectrin repeats 13 to 17 of Ξ²1- and Ξ²2-spectrins were PCR-amplified from heart cDNA using primers for Ξ²1-spectrin (TCTATGTCATCTCCGATGAGATCCC, CTACAGTGACTCCCAGGAACTAGAC) and Ξ²2-spectrin (AGAGTGCTGTCTCCATGTTG, CTAAGTATCCCACTGCTGCTGGGA). PCR products were sequenced to confirm the partial cDNAs of Ξ²1- and Ξ²2-spectrins. Products were subcloned into pGEX6p-1 for bacterial over-expression. Novel ankyrin-G SBD variants were generated by ligating Ank3 fragments PCR-amplified with primer sets 5 and 6 into pcDNA3.1. Ank3 fragments with novel splice junctions lacking exon 31 were PCR-amplified with primers (ATGACGGAGGAAATTATGACCAC, GGAGAGAGAACTTATCGTCCTT). Ank3 fragments PCR-amplified with primer set 6 used primers (GAACTTATCGTCCTTCGGAGC, TCATGGTGATCGGCTTATG). Novel ankyrin-G CTD variants were PCR amplified with the primer set (ATGAGGATGGCGATAGTAGCCG, AACTTCTCCCTGCTTAGGCTC) and subcloned into the lenti-viral vector pCDH1-MCS (Systems Biosciences).
In vitro binding assays
GST-fusion proteins of Ξ²1- and Ξ²2-spectrins were over-expressed and purified as described [13]. In vitro translated (IVT) products of AnkG-SBD variants (wt, ΞE31, ΞE28-31) were prepared using TnT T7-Coupled Reticulate Lysate System (Promega) and binding assays were performed as described [13].
Immunoblot analysis of ankyrin-G expression
Frozen mouse cerebellum and heart were pulverized with a mortar and pestle and resuspended in 4 volumes of RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, 1 mM PMSF and 1X protease inhibitor cocktail (Sigma Aldrich)). Lysate was homogenized with a dounce homogenizer, incubated on ice for 30 minutes, and then centrifuged at 20,000 x g for 15 minutes at 4Β°C. Supernatants were collected and protein lysates were separated by SDS-PAGE and transferred to nitrocellulose membrane (GE Healthcare). Membranes were incubated with affinity-purified ankyrin-G IgG (0.5 ΞΌg/ml) or Na+/H+ exchange regulatory factor (NHERF) (Sigma Aldrich) overnight at 4Β°C. Immunoreactive polypeptides were visualized using SuperSignal West Pico Chemiluminescent Substrate (Pierce).
Isolation and imaging of individual adult mouse cardiomyocytes
Adult mouse cardiomyocytes were isolated as described previously [15]. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Welfare Committee at University of Texas Health Science Center at Houston (permit #13β083). 3 month-old mice were anesthetized with intraperitoneal injection of tribromoethanol-Avertin (Sigma T48402) at 0.2 ml/10g of 1.25% solution, euthanized by removing the heart, and all efforts were made to minimize suffering. Hearts from wild type mice were placed in ice-cold saline and the aorta was cannulated. Hearts were first perfused with warm perfusion buffer for a few minutes, followed by perfusion with digestion buffer containing collagenase (Worthington, Collagenase type II 305U/mg). Once digested, hearts were minced and triturated, then centrifuged at 300 rpm x 5 minutes at 4Β°C. Supernatant was removed and cells were immediately fixed by adding ice-cold 100% ethanol in excess, and kept in -20Β°C until use.
Cells were washed in ice-cold phosphate-buffered saline (PBS, pH 7.4) 3x. Cells were then blocked with 5% normal goat serum and 0.075% TritonX-100 for 30 minutes at room temperature then incubated in primary antibodies overnight at 4Β°C. Primary antibodies used were: voltage-gated sodium channel NaV1.5 (1:500, [16], ankyrin-G (1:50, clone N106/20, UC Davis/NIH NeuroMab Facility), Ξ±-actinin (1:200, Sigma), and ankyrin-G (1:50, [17]). Secondary antibodies used were goat anti-rabbit conjugated to Alexa Fluor 488 and goat anti-mouse conjugated to Alexa Fluor 568 (1:500, LifeTechnologies). Hoechst 33258 (1:1000, LifeTechnologies) was used for nuclear staining after removal of the secondary antibody. ProLong Gold Antifade reagent (LifeTechnologies) was used for mounting coverslips. Images were obtained with a Nikon A1 confocal microscope (Nikon, Melville, NY) equipped with 40X oil, numerical aperture 1.4 objective.
Isolation and viral transduction of mouse neonatal cardiomyocytes
Primary cultures of cardiomyocytes were prepared from P1 wild-type neonatal mouse hearts as previously described [18]. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Welfare Committee at University of Texas Health Science Center at Houston (permit #13β083). Neonatal mice were euthanized by decapitation and all efforts were made to minimize suffering. Briefly, hearts were enzymatically and mechanically dispersed in Hamβs F10 with 0.05% trypsin for two 15-minute incubations at 37Β°C followed by a 50-minute incubation in collagenase type II (0.2mg/mL, Sigma). Pelleted and dispersed myocytes were pre-plated for 4 hours at 37Β°C in complete growth media (40% Hamβs F-10, 40% Dulbeccoβs Modified Eagleβs Media with high glucose, and 20% fetal bovine serum). Non-adherent cardiomyocytes were pelleted, re-suspended in fresh complete growth media, and plated on MatTek plates (MatTek Corporation, Ashland, MA). 48 hours later, the media was replaced with defined growth media (1 ΞΌg/mL insulin, 5ΞΌg/mL transferrin, 1nM LiCl, 1nM NaSeO4, 0.1nM thyroxine) to prevent overgrowth of fibroblasts. Following 3 days in culture, cardiomyocytes were transduced with lenti-viral constructs of GFP-tagged full-length or truncated AnkG-CTDs, and imaged 4 days later by confocal microscopy. Primary antibodies used were: GFP (1:500, SC-8334, Santa Cruz Antibodies), Ξ±-actinin (1:1000, Sigma), and ankyrin-G (1:500, [17]).
Statistical Analysis
Statistical analyses were performed using Prism (GraphPad Software, Inc; version 6.0). One-way ANOVA followed by Tukeyβs multiple comparison test or unpaired Studentβs t-test was used to analyze CT values from qt-PCR experiments to determine whether the expression differences in splice junctions were statistically significant.
Results
The heart expresses a heterogeneous population of ankyrin-G isoforms
To determine if the heart expresses more than one ankyrin-G isoform, we performed immunoblot analysis of ankyrin-G protein expression in heart using a polyclonal antibody to ankyrin-G [10]. To confirm the specificity of the ankyrin-G antibody, we also performed immunoblot analysis of ankyrin-G expression in wild-type and ankyrin-G null cerebellums. In contrast to ankyrin-G null cerebellums, wild-type cerebellums express numerous ankyrin-G immunoreactive polypeptides (Fig 1A). Likewise, we detected multiple ankyrin-G isoforms in heart lysate from adult mice.
(A) Ankyrin-G immunoblot demonstrates expression of different isoforms in heart (arrows). Loss of ankyrin-G immunoreactive polypeptides in ankyrin-G null cerebellums demonstrates antibody specificity. NHERF1 immunoblot demonstrates similar loading of protein lysates. (B) Immunofluorescent co-localization of ankyrin-G (monoclonal antibody) and the voltage-gated sodium channel NaV1.5 at intercalated discs of an individually isolated adult cardiomyocyte (white arrows and highlighted in the inset). (C) Immunofluorescent co-localization of ankyrin-G (polyclonal antibody) and Ξ±-actinin at Z-lines of individually isolated adult cardiomyocytes (white arrows and highlighted in the inset). Scale bar represents 10 microns.
We performed confocal microscopy to evaluate ankyrin-G subcellular localization with resident proteins of the intercalated disc and T-tubules in cardiomyocytes isolated from adult mice. Using a monoclonal antibody to ankyrin-G, we find a population of ankyrin-G co-localizes with the voltage-gated sodium channel NaV1.5 at the intercalated discs (Fig 1B). The commercially available monoclonal antibody was generated against the spectrin-binding, death, and C-terminal domains of human ankyrin-G. Additionally, using a polyclonal antibody to ankyrin-G, we demonstrate another population of ankyrin-G co-localizes with Ξ±-actinin, a cytoskeletal component of the Z-line that underlies 60% of the T-tubular network (Fig 1C) [19]. The polyclonal antibody was generated against the death and C-terminal domains of human ankyrin-G [10]. Taken together, these data demonstrate that the heart expresses a heterogeneous population of ankyrin-G isoforms that localize to the intercalated disc and/or Z-lines of individual myocytes.
Identification of novel Ank3 exons and splice variants in cardiac mRNA
To examine Ank3 mRNA expression and identify novel alternative splice variants, we performed reverse-transcriptase PCR on ventricular mRNA using nine overlapping primer sets (Table 1) that spanned the length of the Ank3 gene (Fig 2A). The integrity of the mRNA was evaluated by ethidium bromide staining of a 1% agarose gel. The presence of sharp 28S and 18S rRNA bands at a ratio of 2:1 and the absence of low molecular weight smears demonstrate that the mRNA was intact and not degraded (S1 Fig). We identified a variety of novel alternative Ank3 mRNA transcripts including: 10 variants of the membrane-binding domain, 12 iterations of the spectrin-binding domain, and 6 permutations of the C-terminal regulatory domain (Fig 2B). The splicing patterns include exon-skipping (exon 16 in MBD), use of alternative 5β-donor site (exon 39 in CTD) or alternative 3β-acceptor site (exon 28 in SBD), and excision of internal exonic sequence (exon 44 in CTD). We also identified two new exons in the spectrin-binding domain (exons 27 and 30). Neither exon alters the open reading frame nor do they disrupt the minimal spectrin-binding domain. Table 2 includes an updated nomenclature for Ank3 exon organization in addition to the lengths of individual exons and the intervening introns. Transcripts encoding the muscle-specific ankyrin-G isoforms that lack the membrane-binding domain (e.g. G107) initiate at the alternative start site in exon 25 and include exons 46β49. We have limited the scope of this study to the alternative splicing of full-length Ank3 transcripts.
(A) Diagram of ankyrin-G exon organization and nine overlapping PCR primer sets used to amplify cardiac-specific Ank3 alternative transcripts. Ankyrin functional domains are indicated. MBD: membrane-binding domain, SBD: spectrin-binding domain, DD: death domain, CTD: C-terminal domain. The large (7694 bp) brain-specific exon corresponds to exon 38. (B) Diagram of alternative Ank3 splice variants encoding the MBD, SBD, and CTD. In the MBD, 5 alternative first exons (1a-1e) were detected. Lengths of intervening intronic sequences are labeled in kilobases (k). In the SBD, two novel exons (27 and 30) were identified and exon numbering has been adjusted accordingly (exon 40 is now the brain-specific exon). Exon 25 (in red) encodes the alternative start site for truncated ankyrin-G isoforms that lack MBDs (e.g. AnkG-107). In the CTD, alternative splicing of exons 46β49 (highlighted in gray) was not addressed in this study. (C) Full-length exon-exon boundary spanning primers are necessary to amplify PCR products: Ank3 splice junctions of exons 26/28 and 26/t28 (truncated) (first panel) and exons 43/44 and 43/t44 (second panel).
To determine the relative mRNA expression of particular Ank3 transcripts, we designed exon-exon boundary spanning primers that selectively PCR amplify transcripts based on their unique exon junctions. Specifically, one PCR primer spans the junction of two adjacent exons and the full-length primer is required to amplify a PCR product (Fig 2C). PCR conditions (primer lengths, annealing temperatures) are optimized for quantitative real-time PCR analysis such that the efficiency of each primer set falls within the range of 90β110%. Nucleotide sequences, annealing temperatures, and primer efficiencies for all 28 primer sets are listed in S1 Table. We have previously used this technique to demonstrate the expression of alternative ANK2 transcripts in mouse and human hearts [13].
Expression of five Ank3 alternative first exons in various tissues
The Ank3 gene has five first exons within ~409 kb of the second exon. To determine the relative expression of each first exon in heart, we performed quantitative real-time PCR analysis using exon-exon boundary spanning primers that selectively detect specific exon junctions. The expression of each first exon is represented relative to the expression of the other first exons. Therefore, the sum of expression of exons 1a, 1b, 1c, 1d, and 1e equals 100%. Rare alternative splice junctions (< 1%) are indicated by gray, dashed lines (Fig 3A) and not included in the summation, although the primary data is provided in S2 Table.
(A) Diagram of alternative splicing of 5 first exons of the Ank3 gene. Gray dashed lines represent rare alternative spliced junctions (<1%). (B) qt-PCR analysis of hypoxanthine-guanine phosphoribosyltransferase (HPRT) expression (measured as cycle threshold number) in ventricle, atria, skeletal muscle, brain, and kidney from three mice (labeled M1βM3). (C) Relative mRNA expression of alternative first exons was measured in heart (ventricle and atria), skeletal muscle, brain, and kidney by qt-PCR analysis. Bar graphs represent technical replicates of qt-PCR samples and error bars represent standard deviations. Statistical analysis was performed with one-way ANOVA with Tukeyβs multiple comparison test (*** p-value β€0.001, ns: not significant) to assess the significance of expression differences between different splice variants (i.e. 1a vs. 1b).
In heart, we compared the relative expression of the first exons in ventricular and atrial mRNA isolated from three mouse hearts. We found that Ank3 transcripts with first exons 1b, 1c, or 1d are more abundant than transcripts with first exons 1a or 1e (Fig 3C). In addition to heart, Ank3 gene products have been detected in numerous tissues including skin, skeletal muscle, lung, kidney, and brain [1β6, 20β22]. To determine if first exons display tissue-specific expression, we measured the relative expression of the first exons in mRNA transcripts isolated from kidney, brain, and skeletal muscle (whole tissue). In skeletal muscle, the relative expression of Ank3 transcripts with first exon 1b is ~60%, 1c is ~20%, and 1d is ~10% (Fig 3C). Ank3 transcripts with first exons 1a and 1e are expressed less than 5% in skeletal muscle. In kidney and brain, we found that Ank3 transcripts with first exons 1b and 1c are more abundant than transcripts with first exons 1a and 1e (Fig 3C). Interestingly, Ank3 transcripts with first exon 1d were virtually undetectable in kidney and brain. Exon 1d was also undetected in mRNAs isolated from cerebellum and lung (data not shown). To validate the similarity of mRNA quantity and quality isolated from the different mouse tissues, we demonstrated equivalent expression of the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT) in mRNA samples from the ventricle, atria, skeletal muscle, brain, and kidney (Fig 3B).
Cardiac expression of Ank3 splice variants encoding ankyrin-G MBD
Ank3 exons 1β21 encode the ankyrin-G MBD (Table 2). During the screen for alternative transcripts, we identified four alternative splice variants (Β± exon 16 and Β± exon 18) of the MBD (Fig 4A). To measure the relative expression of these alternative splice variants, we performed quantitative real-time PCR using exon-exon boundary spanning primers on mRNAs isolated from mouse ventricular tissue. We found that splice variants including exon 16 or exon 18 are about four-fold more abundant than transcripts that lack these exons (Fig 4B).
(A) Diagram of Ank3 alternative splicing in ankyrin-G MBD. (B) Expression of Ank3 mRNA transcripts Β± exon 16 or Β± exon 18 was measured in three mouse hearts using qt-PCR analysis with exon-exon boundary spanning primers. Bar graphs represent technical replicates of qt-PCR samples and error bars represent standard deviations. Statistical analysis was performed with unpaired Studentβs T-test (*** p-value β€0.001).
Cardiac expression of Ank3 splice variants encoding ankyrin-G SBD
During the screen for cardiac-specific Ank3 transcripts, we identified two new exons (27 and 30) in the SBD (Fig 5A and Table 2). We also identified 12 novel alternative spliced transcripts. We measured the relative expression of each splice junction by quantitative real-time PCR. Four splice junctions (E22/24, E26/32, E30/31, E29/32) are so rare (< 1%) that we excluded them from the determination of relative mRNA expression, although the primary data is provided S2 Table. We identified three Ank3 transcripts with unique 3β-splice junctions with exon 22: E22/23, E22/24, and E22/26. Expression of E22/24 is less than 1%, while E22/26 is ~1.5 fold more abundant than E22/23 (Fig 5B). We also identified three Ank3 transcripts with unique 5β-splice junctions with exon 26: E22/26, E23/26, and E24/26. While both E22/26 and E23/26 are equally abundant (~45% each), E24/26 is much less abundant (~5%). Lastly, we identified three Ank3 transcripts with unique 5β-splice junctions with exon 28: E26/28, E26/tr28 (tr:truncated), and E27/28. Interestingly, exon 27 is one of the newly identified exons and transcripts containing this exon (E27/28) are the most abundant (~55β60%), followed by transcripts with the splice junctions of E26/tr28 (~25%) and then E26/28 (~15%).
(A) Diagram of Ank3 alternative splicing in ankyrin-G SBD. Newly identified exons are labeled in black and the alternative first exon (E25) is labeled in red. Gray dashed lines represent rare alternative spliced junctions (<1%). (B) Expression of various Ank3 mRNA transcripts was measured in three mouse hearts using qt-PCR analysis with exon-exon boundary spanning primers. Bar graphs represent technical replicates of qt-PCR samples and error bars represent standard deviations. Statistical analysis was performed using one-way ANOVA with Tukeyβs multiple comparison test or unpaired Studentβs T-test (*** p-value β€0.001, ns: not significant).
Two ankyrin-G SBD isoforms lack Ξ²-spectrin binding
In the spectrin-binding domain, the ZU5 motif represents the minimal Ξ²-spectrin binding domain and is encoded by exons 31 and 32 [23]. We identified two novel alternative Ank3 splice variants that lacked exon 31. While these transcripts in heart are rare (< 1%) (S2 Table), we evaluated Ξ²-spectrin binding to GST-fusion proteins of these SBD isoforms (SBDΞE31 and SBDΞE28β31) (Fig 6A). The ankyrin-binding domain has been mapped to spectrin repeats 14 and 15 [24β26]; therefore, we generated GST-fusion proteins of spectrin repeats 13 through 17 for both Ξ²1- and Ξ²2-spectrins. Briefly, in vitro translated and 35S-labelled SBD protein fragments were incubated with GST, GST Ξ²1-spectrin, or GST Ξ²2-spectrin. Glutathione sepharose precipitated radiolabelled protein complexes that were resolved by SDS-PAGE and visualized by autoradiography. While Ξ²1- and Ξ²2-spectrins bind wild-type SBD, the SBD displays greater binding capacity for Ξ²1-spectrin than for Ξ²2-spectrin (Fig 6B). In contrast, neither SBDΞE31 nor SBDΞE28β31 bound to spectrin demonstrating that partial loss of the ZU5 motif completely disrupts SBD binding to Ξ²-spectrin. Coomassie Blue Stain demonstrated equal loading of GST fusion proteins Ξ²1- and Ξ²2-spectrin (Fig 6C).
(A) Diagram of Ank3 exon organizations for two rare ankyrin-G SBD variants (ΞE31 and ΞE28β31). Both variants lack a portion of the ZU5 motif. (B) Ξ²1-spectrin and Ξ²2-spectrin (repeats 13 to 17) binding to ankyrin-G SBDs (wildtype, Ξ31, Ξ28β31) was measured by in vitro binding assays. Label is the unbound in vitro translated SBD products. (C) Coomassie Blue Stain demonstrates equal loading of GST-fusion proteins Ξ²1- and Ξ²2-spectrins.
Cardiac expression of Ank3 splice variants encoding ankyrin-G CTD
The focus of this study is to identify novel variants of full-length ankyrin-G. Ank3 exons 46, 47, 48, and 49 encode an obscurin-binding domain that is uniquely expressed in truncated ankyrin-G isoforms that were initially characterized in skeletal muscle (e.g. G107) [2β4]. We were unable to detect these exons in full-length Ank3 transcripts in heart; therefore, the characterization of alternative splicing of this domain was excluded from this study.
We identified six novel Ank3 splice variants of the CTD (Fig 7A). Exon 40 was never detected in any cardiac transcripts and we identified two splice junctions that excise this brain-specific exon. The splice junction of E39/41 is predominant in heart and the use of an alternative 5β-donor site within exon 39 is exceedingly rare (< 1%) (S2 Table). We identified three alternative splice variants of exon 44: E43/44, E43/tr44, and a medial excision of 267 base pairs from exon 44. Exon 44 is 679 bp in length and the 5β-truncation removes 588 bp (tr44). The splice variant E43/44 is more abundant than E43/tr44 (~55% versus ~40%), while the splice variant that lacks 267 base pairs in the middle of exon 44 is less common (~5%) (Fig 7B).
(A) Diagram of Ank3 alternative splicing in ankyrin-G CTD. Exon 40 is the large (7694 bp) brain-specific exon, while exon 51 contains non-coding sequence. Exons 46β49 are expressed in truncated ankyrin-G isoforms that lack membrane-binding domains. Gray dashed lines represent rare alternative spliced junctions (<1%). (B) Expression of various Ank3 mRNA transcripts with different iterations of exon 44 (full-length, 5β-truncated, medially truncated) was measured in three mouse hearts using qt-PCR analysis with exon-exon boundary spanning primers. Bar graphs represent technical replicates of qt-PCR samples and error bars represent standard deviations. Statistical analysis was performed with one-way ANOVA with Tukeyβs multiple comparison test (*** p-value β€0.001).
Exogenous ankyrin-G CTD isoforms display similar subcellular expression as endogenous ankyrin-G
Ankyrin-G is localized to the intercalated disc and Z-lines in adult ventricular cardiomyocytes (Fig 1Bβ1C). We have previously demonstrated that the C-terminal domain of ankyrin-B plays an important role in targeting this related adaptor protein to the sarcomeric M-line in cardiomyocytes [27]. To assess whether the C-terminal domain of ankyrin-G contains targeting motifs, we evaluated the subcellular localization of the two most abundant CTD variants in virally transduced neonatal cardiomyocytes. Lenti-viral expression in neonatal cardiomyocytes is preferable to adult cardiomyocytes because they survive in culture for 7β10 days compared to adult myocytes, which survive for ~24 hours. Lenti-viral constructs with GFP tags were made of the ankyrin-G CTD containing the full-length exon 44 (679 bps) or the 5β-truncated exon 44 (lacking 588 bps) (Fig 8A). Expression of lenti-viral constructs was confirmed by immunoblot analysis of the GFP tag (Fig 8B). We evaluated the co-localization of these CTD variants to Ξ±-actinin in neonatal cardiomyocytes. Both variants displayed diffuse cytosolic localization and lacked the defined patterning of sarcomeres. Moreover, both variants displayed similar subcellular distributions as endogenous ankyrin-G, which was detected using the polyclonal ankyrin-G antibody (Fig 8C). One of the limitations of neonatal cardiomyocytes as a model system is that they lack fully developed subcellular domains, which may be required for the proper targeting of ankyrin-G.
(A) Diagram of lenti-viral GFP-tagged CTD variants with full-length or truncated exon 44. (B) GFP immunoblot analysis demonstrating expression of lenti-viral constructs. (C) Immunofluorescent co-localization of GFP-tagged CTD variants (fl-E44-GFP and tr-E44-GFP) with Z-line resident protein Ξ±-actinin in neonatal cardiomyocytes. Bottom panels represent localization of endogenous ankyrin-G in reference to Ξ±-actinin. Scale bar represents 10 microns.
Discussion
This study is the first to describe a comprehensive analysis of Ank3 expression in heart. We identified two new exons and 28 novel alternative splicing events in the Ank3 gene. An update to the Ank3 exon organization and nomenclature is provided in Table 2. Using quantitative real-time PCR with exon-exon spanning primers, we demonstrate that alternative Ank3 splice variants are expressed at similar levels in three separate hearts. Moreover, we find that expression of Ank3 transcripts initiated with exon 1d is restricted to the heart and skeletal muscle as these transcripts are undetectable in brain, kidney, cerebellum, and lung.
The majority of alternative splicing is situated within the coding region of the spectrin-binding domain, specifically within the exons immediately 5β of the minimal spectrin-binding domain ZU5A, which is encoded by exons 31 and 32 [28, 29] (Figs 2 and 5). The newly identified exons 27 and 30 are also alternatively spliced, but neither exon alters the open-reading frame of ankyrin-G and exon 30 is rarely expressed in cardiac transcripts (Fig 5 and Table 2). Interestingly, exon 30 is included in three expressed sequence tags (CO430616, CF745086, CV555908) that were isolated from neural tissue. We identified two rare alternative splice variants that remove exon 31 (junctions of exons 26 to 32 and exons 29 to 32). In vitro translated products of these SBD isoforms lacked binding to both Ξ²1- and Ξ²2-spectrins (Fig 6). Moreover, wild-type ankyrin-G SBD bound more Ξ²1-spectrin than Ξ²2-spectrin. Ankyrin-G SBD binding to Ξ²-spectrin isoforms (Ξ²1, Ξ²2, Ξ²3, and Ξ²4) has yet to be studied extensively, much less the influence of alternative splicing on this process.
We demonstrate that the heart expresses five distinct ankyrin-G isoforms by immunoblot analysis. Imaging of individual cardiomyocytes reveals the expression of two ankyrin-G subpopulations. One population co-localizes with the voltage-gated sodium channel NaV1.5 at the intercalated disc (ICD), while the other population localizes to the Z-line. Interestingly, the ICD population is detected using the ankyrin-G monoclonal antibody, while the Z-line population is detected with the ankyrin-G polyclonal antibody. These differences may be the result of different antigens used for antibody production. The monoclonal antibody was generated against an antigen encoded by exons 26, 28, 29, 31β39, 41β45, and 50. In addition, splicing variations present in the antigen include 5β-truncation of exon 28, 3β-truncation of exon 39, and medial excision of 267 base pairs from exon 44. The antigen for the polyclonal antibody consisted of the death and C-terminal domains, which included the full-length exon 44.
The expression of numerous ankyrin-G isoforms in a specific tissue is quite common. Understanding the function of each isoform remains a challenge, but insights into an isoformβs function may be inferred from its subcellular localization. In kidney and muscle, the truncated AnkG119 isoform is located in the Golgi apparatus and is necessary for transport of sodium potassium ATPase (NKA) to the endoplasmic reticulum [1, 30]. Many alternative ankyrin-G isoforms that lack membrane-binding domains are expressed in skeletal muscle [2β4]. The obscurin-binding domains encoded by Ank3 exons 46β49 in the C-terminal domain regulate the sarcolemmal localization of these isoforms [2]. While a previous study demonstrated skeletal muscle expression of a full-length ankyrin-G isoform with exons 46β49 [3], we were unable to detect a similar isoform in cardiac muscle.
To evaluate whether Ank3 exon 44 encoded any targeting motifs, we examined the subcellular localization of the two most abundant CTD variants in neonatal cardiomyocytes. Neither isoform displayed sarcomeric localization, similar to expression of endogenous ankyrin-G (detected with the polyclonal antibody) (Fig 8C). While neonatal cardiomyocytes are viable to express proteins introduced by lenti-virus, they lack the elaborate T-tubular network found in adult cardiomyocytes. Proper subcellular targeting of ankyrin-G most likely requires fully developed membrane domains in adult myocytes.
Given the diversity of functions and subcellular localizations ascribed to ankyrin-G, it is not surprising that the heart expresses multiple ankyrin-G isoforms. In ventricular cardiomyocytes, ankyrin-G expression overlaps the expression of voltage-gated sodium channels (NaV) at the intercalated disc and T-tubules. Interestingly, the voltage-gated sodium channels display differential subcellular localization with NaV1.5 predominantly expressed at the intercalated disc, while the other sodium channels (NaV1.1, 1.3, and 1.6) are predominantly localized to the T-tubules [31β33]. In addition to interacting with NaV1.5 at the intercalated disc, ankyrin-G has also been shown to interact with plakoglobin and connexin 43 [11]. Whether the intercalated disc expresses a heterogeneous population of ankyrin-G isoforms is not known, but such a scenario could account for the diversity of ankyrin-G interactions. Finally, while it has been shown that ankyrin-G is required for the retention of dystrophin and Ξ²-dystroglycan at the costameres in skeletal muscle (and presumably cardiac muscle) [7, 8], the cDNA of this particular ankyrin-G isoform has yet to be characterized. Future research efforts will focus on identifying full-length Ank3 transcripts in heart and evaluating these isoforms for specific functions.
In closing, there are tremendous opportunities for discovery in examining the splicing regulation of ankyrin genes. Our data suggests that the Ank3 gene is subject to complex transcriptional regulation in the heart. We propose that alternative splicing of the Ank3 gene results in a diverse population of ankyrin-G isoforms with each isoform aggregating a unique set of proteins that impart specific functionality to unique cardiomyocyte domains such as the intercalated disc, T-tubule, or costamere.
Supporting Information
S1 Fig. EtBr-stained agarose gel of mRNA isolated from 3 mouse hearts.
https://doi.org/10.1371/journal.pone.0128177.s001
(TIF)
S1 Table. Primer sequences for qt-PCR analysis of Ank3 splice junctions.
https://doi.org/10.1371/journal.pone.0128177.s002
(DOCX)
S2 Table. Average CT values of rare Ank3 transcripts in 3 mouse hearts.
https://doi.org/10.1371/journal.pone.0128177.s003
(DOCX)
Acknowledgments
We would like to thank T. Hund and P. Mohler (OSU) for supplying the polyclonal antibodies to ankyrin-G [10] and NaV1.5 [16].
Author Contributions
Conceived and designed the experiments: GY SRC. Performed the experiments: GY HCW MM. Analyzed the data: GY SRC. Wrote the paper: GY HWC SRC.
References
- 1. Devarajan P, Stabach PR, Mann AS, Ardito T, Kashgarian M, Morrow JS. Identification of a small cytoplasmic ankyrin (AnkG119) in the kidney and muscle that binds beta I sigma spectrin and associates with the Golgi apparatus. The Journal of cell biology. 1996;133(4):819β30. pmid:8666667; PubMed Central PMCID: PMC2120834.
- 2. Gagelin C, Constantin B, Deprette C, Ludosky MA, Recouvreur M, Cartaud J, et al. Identification of Ank(G107), a muscle-specific ankyrin-G isoform. The Journal of biological chemistry. 2002;277(15):12978β87. pmid:11796721.
- 3. Hopitzan AA, Baines AJ, Ludosky MA, Recouvreur M, Kordeli E. Ankyrin-G in skeletal muscle: tissue-specific alternative splicing contributes to the complexity of the sarcolemmal cytoskeleton. Experimental cell research. 2005;309(1):86β98. pmid:15953600.
- 4. Kordeli E, Ludosky MA, Deprette C, Frappier T, Cartaud J. AnkyrinG is associated with the postsynaptic membrane and the sarcoplasmic reticulum in the skeletal muscle fiber. Journal of cell science. 1998;111 (Pt 15):2197β207. pmid:9664041.
- 5. Thevananther S, Kolli AH, Devarajan P. Identification of a novel ankyrin isoform (AnkG190) in kidney and lung that associates with the plasma membrane and binds alpha-Na, K-ATPase. The Journal of biological chemistry. 1998;273(37):23952β8. Epub 1998/09/03. pmid:9727010.
- 6. Zhang X, Bennett V. Restriction of 480/270-kD ankyrin G to axon proximal segments requires multiple ankyrin G-specific domains. The Journal of cell biology. 1998;142(6):1571β81. pmid:9744885; PubMed Central PMCID: PMC2141775.
- 7. Ayalon G, Davis JQ, Scotland PB, Bennett V. An ankyrin-based mechanism for functional organization of dystrophin and dystroglycan. Cell. 2008;135(7):1189β200. pmid:19109891.
- 8. Ayalon G, Hostettler JD, Hoffman J, Kizhatil K, Davis JQ, Bennett V. Ankyrin-B interactions with spectrin and dynactin-4 are required for dystrophin-based protection of skeletal muscle from exercise injury. The Journal of biological chemistry. 2011;286(9):7370β8. pmid:21186323; PubMed Central PMCID: PMC3044993.
- 9. Garrido JJ, Giraud P, Carlier E, Fernandes F, Moussif A, Fache MP, et al. A targeting motif involved in sodium channel clustering at the axonal initial segment. Science. 2003;300(5628):2091β4. Epub 2003/06/28. 300/5628/2091 [pii]. pmid:12829783.
- 10. Mohler PJ, Rivolta I, Napolitano C, LeMaillet G, Lambert S, Priori SG, et al. Nav1.5 E1053K mutation causing Brugada syndrome blocks binding to ankyrin-G and expression of Nav1.5 on the surface of cardiomyocytes. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(50):17533β8. pmid:15579534; PubMed Central PMCID: PMC536011.
- 11. Sato PY, Coombs W, Lin X, Nekrasova O, Green KJ, Isom LL, et al. Interactions between ankyrin-G, Plakophilin-2, and Connexin43 at the cardiac intercalated disc. Circulation research. 2011;109(2):193β201. Epub 2011/05/28. CIRCRESAHA.111.247023 [pii]. pmid:21617128.
- 12. Makara MA, Curran J, Little SC, Musa H, Polina I, Smith SA, et al. Ankyrin-g coordinates intercalated disc signaling platform to regulate cardiac excitability in vivo. Circulation research. 2014;115(11):929β38. pmid:25239140; PubMed Central PMCID: PMC4224970.
- 13. Cunha SR, Le Scouarnec S, Schott JJ, Mohler PJ. Exon organization and novel alternative splicing of the human ANK2 gene: implications for cardiac function and human cardiac disease. Journal of molecular and cellular cardiology. 2008;45(6):724β34. pmid:18790697; PubMed Central PMCID: PMC2630508.
- 14. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45. Epub 2001/05/09. pmid:11328886.
- 15. Baskin KK, Taegtmeyer H. AMP-activated protein kinase regulates E3 ligases in rodent heart. Circulation research. 2011;109(10):1153β61. pmid:21921267; PubMed Central PMCID: PMC3254015.
- 16. Hund TJ, Koval OM, Li J, Wright PJ, Qian L, Snyder JS, et al. A beta(IV)-spectrin/CaMKII signaling complex is essential for membrane excitability in mice. The Journal of clinical investigation. 2010;120(10):3508β19. pmid:20877009; PubMed Central PMCID: PMC2947241.
- 17. Lowe JS, Palygin O, Bhasin N, Hund TJ, Boyden PA, Shibata E, et al. Voltage-gated Nav channel targeting in the heart requires an ankyrin-G dependent cellular pathway. The Journal of cell biology. 2008;180(1):173β86. pmid:18180363; PubMed Central PMCID: PMC2213608.
- 18. Cunha SR, Bhasin N, Mohler PJ. Targeting and stability of Na/Ca exchanger 1 in cardiomyocytes requires direct interaction with the membrane adaptor ankyrin-B. The Journal of biological chemistry. 2007;282(7):4875β83. pmid:17178715.
- 19. Soeller C, Cannell MB. Examination of the transverse tubular system in living cardiac rat myocytes by 2-photon microscopy and digital image-processing techniques. Circulation research. 1999;84(3):266β75. pmid:10024300.
- 20. Peters B, Kaiser HW, Magin TM. Skin-specific expression of ank-3(93), a novel ankyrin-3 splice variant. J Invest Dermatol. 2001;116(2):216β23. Epub 2001/02/17. jid1210 [pii] pmid:11179996.
- 21. Jenkins PM, Vasavda C, Hostettler J, Davis JQ, Abdi K, Bennett V. E-cadherin polarity is determined by a multifunction motif mediating lateral membrane retention through ankyrin-G and apical-lateral transcytosis through clathrin. The Journal of biological chemistry. 2013;288(20):14018β31. Epub 2013/03/27. M113.454439 [pii]. pmid:23530049.
- 22. Kizhatil K, Bennett V. Lateral membrane biogenesis in human bronchial epithelial cells requires 190-kDa ankyrin-G. The Journal of biological chemistry. 2004;279(16):16706β14. Epub 2004/02/06. M314296200 [pii]. pmid:14757759.
- 23. Kizhatil K, Yoon W, Mohler PJ, Davis LH, Hoffman JA, Bennett V. Ankyrin-G and beta2-spectrin collaborate in biogenesis of lateral membrane of human bronchial epithelial cells. The Journal of biological chemistry. 2007;282(3):2029β37. pmid:17074766.
- 24. Stabach PR, Simonovic I, Ranieri MA, Aboodi MS, Steitz TA, Simonovic M, et al. The structure of the ankyrin-binding site of beta-spectrin reveals how tandem spectrin-repeats generate unique ligand-binding properties. Blood. 2009;113(22):5377β84. Epub 2009/01/27. blood-2008-10-184291 [pii]. pmid:19168783.
- 25. Ipsaro JJ, Huang L, Mondragon A. Structures of the spectrin-ankyrin interaction binding domains. Blood. 2009;113(22):5385β93. Epub 2009/01/15. blood-2008-10-184358 [pii]. pmid:19141864.
- 26. La-Borde PJ, Stabach PR, Simonovic I, Morrow JS, Simonovic M. Ankyrin recognizes both surface character and shape of the 14β15 di-repeat of beta-spectrin. Biochem Biophys Res Commun. 2010;392(4):490β4. Epub 2010/01/19. S0006-291X(10)00076-8 [pii]. pmid:20079712.
- 27. Cunha SR, Mohler PJ. Obscurin targets ankyrin-B and protein phosphatase 2A to the cardiac M-line. The Journal of biological chemistry. 2008;283(46):31968β80. pmid:18782775; PubMed Central PMCID: PMC2581558.
- 28. Wang C, Yu C, Ye F, Wei Z, Zhang M. Structure of the ZU5-ZU5-UPA-DD tandem of ankyrin-B reveals interaction surfaces necessary for ankyrin function. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(13):4822β7. Epub 2012/03/14. 1200613109 [pii]. pmid:22411828.
- 29. Yasunaga M, Ipsaro JJ, Mondragon A. Structurally similar but functionally diverse ZU5 domains in human erythrocyte ankyrin. Journal of molecular biology. 2012;417(4):336β50. Epub 2012/02/09. S0022-2836(12)00095-2 [pii]. pmid:22310050.
- 30. Devarajan P, Stabach PR, De Matteis MA, Morrow JS. Na,K-ATPase transport from endoplasmic reticulum to Golgi requires the Golgi spectrin-ankyrin G119 skeleton in Madin Darby canine kidney cells. Proceedings of the National Academy of Sciences of the United States of America. 1997;94(20):10711β6. Epub 1997/10/06. pmid:9380700.
- 31. Maier SK, Westenbroek RE, McCormick KA, Curtis R, Scheuer T, Catterall WA. Distinct subcellular localization of different sodium channel alpha and beta subunits in single ventricular myocytes from mouse heart. Circulation. 2004;109(11):1421β7. Epub 2004/03/10. 01.CIR.0000121421.61896.24 [pii]. pmid:15007009.
- 32. Noujaim SF, Kaur K, Milstein M, Jones JM, Furspan P, Jiang D, et al. A null mutation of the neuronal sodium channel NaV1.6 disrupts action potential propagation and excitation-contraction coupling in the mouse heart. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2012;26(1):63β72. Epub 2011/09/29. [pii]. pmid:21948246.
- 33. Lopez-Santiago LF, Meadows LS, Ernst SJ, Chen C, Malhotra JD, McEwen DP, et al. Sodium channel Scn1b null mice exhibit prolonged QT and RR intervals. Journal of molecular and cellular cardiology. 2007;43(5):636β47. Epub 2007/09/22. S0022-2828(07)01184-4 [pii] pmid:17884088.