Figures
Abstract
Glutathione transferases (GST) are an ancient superfamily comprising a large number of paralogous proteins in a single organism. This multiplicity of GSTs has allowed the copies to diverge for neofunctionalization with proposed roles ranging from detoxication and oxidative stress response to involvement in signal transduction cascades. We performed a comparative genomic analysis using FlyBase annotations and Drosophila melanogaster GST sequences as templates to further annotate the GST orthologs in the 12 Drosophila sequenced genomes. We found that GST genes in the Drosophila subgenera have undergone repeated local duplications followed by transposition, inversion, and micro-rearrangements of these copies. The colinearity and orientations of the orthologous GST genes appear to be unique in many of the species which suggests that genomic rearrangement events have occurred multiple times during speciation. The high micro-plasticity of the genomes appears to have a functional contribution utilized for evolution of this gene family.
Citation: Saisawang C, Ketterman AJ (2014) Micro-Plasticity of Genomes As Illustrated by the Evolution of Glutathione Transferases in 12 Drosophila Species. PLoS ONE 9(10): e109518. https://doi.org/10.1371/journal.pone.0109518
Editor: Roger A. Coulombe, Utah State University, United States of America
Received: May 21, 2014; Accepted: September 3, 2014; Published: October 13, 2014
Copyright: © 2014 Saisawang, Ketterman. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. Data available in FlyBase with the accession numbers provided in the paper.
Funding: This work was supported by funding from Mahidol University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Drosophila melanogaster is one of the best known dipteran, or ‘true fly’, and has been extensively studied as a model organism for more than a century [1]. The release of the completed D. melanogaster genome sequence in 2000 signaled the beginning of the genomic era [2]. In the last decade a further 11 Drosophila species have been sequenced. The genomic data from these 12 closely related species has facilitated comparative studies which show many coding sequences have been preserved during species divergence [3]–[6].
In this investigation, we focus on the cytosolic glutathione transferase (GST) superfamily in the 12 Drosophila species. Comparative genomics is a powerful tool which has allowed us to identify the GST orthologous protein encoding genes in the 12 diverse species. To identify the GST orthologs, the sequences of D. melanogaster were used as reference templates. GSTs are well-known detoxification enzymes which catalyze the reaction of glutathione conjugation to various toxic electrophilic compounds [7]. GSTs are an ancient superfamily comprising a large number of paralogous proteins in a single organism. The soluble cytosolic GSTs constitute the largest GST family in addition to the mitochondrial GSTs [8], [9] and the membrane-associated proteins involved in eicosanoid and glutathione metabolism (MAPEG) [10], [11]. The genes of the cytosolic GST superfamily are organized in multiple clusters on different chromosomes. The genes of GSTs from the same class tend to be clustered together. This is most likely due to the multiple genes originating from tandem gene duplication events. GST isoforms are grouped into different classes according to sequence identity and similarity of their final protein products [7]. There are at least 7 GST classes in mammals (Alpha, Mu, Pi, Omega, Theta, Sigma and Zeta), 7 classes in plants (Tau, Phi, Lambda, Zeta, Theta, DHA and EF1Bγ) [12], [13] and 6 classes in insects (Delta, Epsilon, Omega, Theta, Sigma and Zeta) [14]. This existence of numerous GST isoforms is believed to contribute to the enzymatic responses for cell protection from many different endogenous and exogenous toxic compounds. As previously reported, the GST family members recognize at least 100 different xenobiotic substrates [15]. Moreover this multiplicity of GSTs has allowed the enzymes to diverge and assume non-detoxification functions. For example, the GST Omega class has been shown to be associated with Alzheimer and Parkinson's disease [16]; whereas GST Pi, Mu and Alpha classes in human were shown to interact and regulate several steps in MAP kinase signal cascades [17]–[23].
As stated above, the coding sequences that have been previously annotated in D. melanogaster were used as sequence templates to identify the orthologous GST protein encoding genes in the other 11 sister species. The eight sister species of D. melanogaster, in subgenus Sophophora, are D. simulans, D. sechellia, D. yakuba, D. erecta, D. ananassae, D. pseudoobscura, D. persimilis and D. willistoni (Figure 1). The first four species mentioned are the most closely related to D. melanogaster and belong to the melanogaster subgroup. The subgenus Drosophila contains D. mojavensis, D. virilis and D. grimshawi, and are the most distantly related species to D. melanogaster with about 60 million years of divergence time [24]. Although a small number of orthologous GSTs have been studied in different Drosophila species [25]–[27], the present study encompasses the whole cytosolic GST superfamily in the 12 species. It should be emphasized that although great innovations in gene prediction have been made using computer program analysis, the accuracy in gene annotation is far from complete, necessitating manual curation. The quality of the genome sequences was of some concern as D. simulans, D. sechellia and D. persimilis were sequenced to a low coverage of only about 2–4 times of the total genome size; whereas, the other species were sequenced to greater than 8 times coverage [4], [28]. To increase the accuracy in the GST gene annotation, we have made a comprehensive sequence analysis augmented with manual curation. The analysis of these Drosophila genomes also has yielded some insight into the Drosophila GST family evolution as well as observations of several interesting features of the Drosophila genomes which are discussed below.
The numbers beside the branches are estimated divergence times in millions of years [32]. The generalist and specialist tags refer to the species feeding habits: D. melanogaster [34], D. simulans [34], D. sechellia [34], D. erecta [34], D. yakuba [24], D. ananassae [34], D. pseudoobscura [24], D. persimilis [24], D. willistoni [24], D. virilis [24], D. mojavensis [24] and D. grimshawi [35].
Results
In the D. melanogaster genome, thirty-six genes encode a total of 41 cytosolic GST proteins (Table 1) [14]. These have been named based on the unified GST nomenclature and categorized into 6 different classes [14]. However, many of the GSTs in the other 11 Drosophila species still lack this categorization. Therefore we have manually analyzed each gene by comparing the sequences from the 11 Drosophila species to a D. melanogaster template. Although the nucleotide sequences of the Drosophila species reveal codon usage bias, the codon preferences of the amino acids is sufficient for identifying the GST proteins. Due to a clear orthology for the 11 species with D. melanogaster, we were able to name and classify the GSTs into the six classes found in insects; Delta (D), Epsilon (E), Omega (O), Theta (T), Zeta (Z) and Sigma (S). Many orthologs have been previously annotated by FlyBase, for example, GSTD1 orthologs in the 4 species; D. simulans, D. sechellia, D. erecta and D. yakuba, as well as GSTE2 and GSTE3 of D. yakuba. However the number of genes with orthology to a single D. melanogaster gene in each species is varied which is a problem for GST annotation (Table S1 in file S1). In addition, the genomic comparison also showed several inaccuracies in the gene annotations, such as wrong translation initiation sites, wrong exon-intron boundaries and no identified alternatively spliced genes. The identified ambiguities, annotation errors, sequencing errors, pseudogenes and alternative splicing are presented below.
Gene annotation errors
Using D. melanogaster as a model species, we identified several errors in the annotations for GSTs in the other species. Seven GSTs from 5 Drosophila species have been annotated to be either too long or too short compared to the size of the D. melanogaster GST genes. The usual length of GST encoding sequence is from 600 to 800 bp. Several short sequences do not contain the critical conserved serine/tyrosine residue in the active site [29]. These key residues also appear to play roles in folding, stability as well as catalyzing the conjugation of the GSH substrate [30]. We believe that these annotation errors result from automatic algorithm predictions employed to process the large genome data sets. We wish to propose the following GST annotations based on the D. melanogaster annotation and our manual curation.
- Dsim\GD17126 (DsimGSTT4) is a D. melanogaster GSTT4 ortholog. Its gene size reported by FlyBase is 864 bp. A comparison of the nucleotide sequences of DsimGSTT4 and DmelGSTT4, show that the annotated exons 2 and 3 of DsimGSTT4 are actually part of an intron in the DmelGSTT4 gene (Figure S1 in file S1). These 2 extra exons make DsimGSTT4 larger than other GSTT4 orthologs. If the 2 exons are presumed to be intron, the size of DsimGSTT4 would be 714 bp and show 100% amino acid sequence identity to DmelGSTT4.
- Dere\GG21888 (DereGSTE6) is a D. melanogaster GSTE6 ortholog. Its gene size reported by FlyBase is 723 bp. It is larger than other GSTE6 orthologs because of an incorrectly annotated ATG start site. Using DmelGSTE6 as template, the correct ATG start site should be the next ATG after the annotated one which would reduce its size to 669 bp and show 93% amino acid sequence identity to DmelGSTE6 (Figure S2 in file S1).
- Dana\GF17942 is a member of Delta class. The gene reported by FlyBase is 1197 bp with 2 exons. Again we have found that a more likely ATG start site is at the end of the annotated intron 1. This sequence codes for the first 5 amino acids of the protein and is contiguous with the second exon (Figure S3 in file S1). Thus Dana\GF17942 would be one single exon of 663 bp. This proposed sequence would translate to give 64% amino acid sequence identity to DmelGSTD2.
- Dana\GF11968 (DanaGSTE11) is a D. melanogaster GSTE11 ortholog. Its gene size reported by FlyBase is 2919 bp. This is a similar case to the above mentioned annotation with proposed exon in annotated intron. In this case the proposed last 45 nucleotides of the coding region are located in the second intron (Figure S4 in file S1). This sequence includes the stop codon so a read-through from exon 2 including these 45 nucleotides would yield a DanaGSTE11 that encodes a GST protein of 225 amino acids. This proposed sequence shows 87% amino acid sequence identity to DmelGSTE11.
- Dvir\GJ22855 is a Delta class GST. Its gene size reported by FlyBase is 603 bp. From sequence analysis, we found the ATG start site should be 48 nucleotides upstream of the annotated site (Figure S5 in file S1). These 48 nucleotides are in-frame and contiguous with the annotated exon. This longer exon then translates to a GST protein 216 amino acids long with 67% amino acid identity to DmelGSTD2.
- Dvir\GJ22856 is located next to Dvir\GJ22855. Its annotated size is also 603 bp. We found a more appropriate start site 33 nucleotides upstream of the annotated ATG start site. This longer exon translates to yield a conserved Delta class sequence which results in a protein 211 amino acids long (Figure S6 in file S1). This protein also appears to be an ortholog to DmelGSTD2 with 64% amino acid identity.
- Dvir\GJ23571 (DvirGSTZ1) is annotated to be an ortholog of GSTZ1 from D. melanogaster. Its gene size reported by FlyBase is 489 bp. This gene size would encode a truncated protein. However, we found that the ATG start site should be 255 nucleotides upstream of the annotated one (Figure S7 in file S1). This proposed start site would translate to a GST protein 247 amino acids long with 61% amino acid identity to DmelGSTZ1.
Sequencing errors
Incomplete genome sequencing also contributes to the errors in sequence annotation. This is especially evident for the genomes of D. sechellia and D. persimilis that were sequenced to low coverage, 4.9X and 4.1X [28]. In addition, the genome of D. simulans which was performed as a mosaic assembly was also sequenced to a low coverage of 2.8X [28]. The annotation of the genome of these species therefore becomes difficult. The incompleteness of genome sequencing has yielded incorrect sequence annotation for 3 GST genes, Dsec\GM23038 (DsecGSTT3), Dper\GL26999 (DperGSTT4) as well as not identifying a proposed alternatively spliced Dper\GL13668 (DperGSTZ2). These annotations are described below.
- Dsec\GM23038 (DsecGSTT3) is annotated to be a DmelGSTT3 ortholog which codes for a protein of 87 amino acids. Using this short sequence to align with GSTT3 of D. melanogaster, the first 40 and the last 47 amino acids align very well to DmelGSTT3 with a gap in between (Figure S8 in file S1). However upon retrieving its gene region from FlyBase, it was found that the DNA sequencing is incomplete as shown by Ns in the middle of the gene. Therefore we suspect that this is a sequencing error of the original clone and Dsec\GM23038 would be an orthologous protein to DmelGSTT3. Nevertheless, the gene needs to be re-sequenced for confirmation.
- Dper\GL26999 (DperGSTT4) is annotated to be a DmelGSTT4 ortholog which codes for a protein of 280 amino acids. This is a similar case as GSTT3 of D. sechellia with the gene incompletely sequenced and shown as N's. Moreover we suggest that the annotated exons 2 and 3 of D. persimilis should be part of a large single intron. Therefore the first exon will encode the first 39 amino acid residues and the next 53 amino acid residues are encoded in the incomplete gene region and annotated exon 4 (Figure S9 in file S1). The remainder of the sequence is quite conserved. Presuming the annotated exons 2 and 3 to be intron, the size of DperGSTT4 is reduced 93 amino acids. Thus 39 residues from the first exon and including the missing 53 residues as well as the 148 residues from exons 4, 5 and 6 of the sequence, the size of DperGSTT4 will be approximately 240 amino acids which is comparable to GSTT4 in other species. However; again, the whole gene needs to be re-sequenced, especially the missing part.
- Dper\GL13668 is reported to be a DmelGSTZ2 ortholog. This gene would actually provide alternative transcripts encoding 3 final spliced protein products. The alternative splicing of this will be discussed in a following section. We found incomplete sequence in the intron region of GSTZ2B variant which does not affect the protein coding sequence. However the first exon of GSTZ2A and GSTZ2C are also located in this same intron (Figure S10 in file S1). Therefore we suggest that the GSTZ2A and GSTZ2C variants exist in D. persimilis as alternatively spliced products.
Pseudogenes
A pseudogene is a gene sequence that would translate to a non-functional protein. In the 11 Drosophila species, we found at least 9 GST genes suspected to be pseudogenes. These sequences were matched with the orthologous genes in the D. melanogaster genome. All of the matched genes tend to be shorter than normal GST sizes which appear to be a consequence of frame shifts or premature stop codons. These 9 GST gene annotations are described below.
- Dsec\GM24019 is a GST Delta class gene. Its reported gene sequence is 348 bp long. It aligns very well with DmelGSTD6 at the 3′end of the gene. Although 69 nucleotides upstream of the annotated ATG start site is conserved sequence of Delta class, this slightly longer protein would still be too short to be a viable GST enzyme as it's missing the first 100 amino acids of the protein which consists of the N-terminus domain containing the G-site or GSH binding site (Figure S11 in file S1).
- Dsec\GM21877 is placed into GST Epsilon class since its short sequence (447 bp) aligns well with the 3′end of other Epsilon class members (Figure S12 in file S1). In addition, a BLAST search hits Dmel\CR43687, a pseudogene in the middle of the D. melanogaster Epsilon GST gene cluster.
- Dyak\GE11955 codes for a protein of 163 amino acids and is reported to be a DmelGSTE1 ortholog. Again, by comparing the gene sequence of this DyakGSTE1 with DmelGSTE1, it was found that part of the intron shows conserved sequence to DmelGSTE1 (Figure S13 in file S1). However, our reanalyzed gene sequence still does not encode for a full-length GSTE1 and it is also missing the critical conserved active site sequence (which encodes Ser-His-Ala-Ile) of Epsilon class.
- Dana\GF17941 is a member of GST Delta class. Its gene sequence is 540 bp which codes for a protein of 179 amino acids in length. Dana\GF17941 shows similar sequence to the C-terminal part of DmelGSTD2, GSTD4 and GSTD5 but it is missing the first 38 amino acids which consist of important G-site residues (Figure S14 in file S1). There is no possible coding sequence upstream of the annotated ATG start site.
- Dper\GL17151 appears to be a Theta GST ortholog which codes for a protein of 111 amino acids. It shows high sequence conservation to DmelGSTT2 at the N-terminus (Figure S15 in file S1). Although this gene may translate to protein product, this protein would not function as an active GST enzyme as it is missing 117 amino acids or the C-terminus half of the protein that generates the hydrophobic substrate binding site (H-site).
- Dper\GL26929 also appears to be a Theta GST ortholog which codes for a truncated protein of 163 amino acids. Although this gene is not located on the same scaffold as other Theta gene members, its translated product shows the greatest amino acid identity, 27% and 29%, to DmelGSTT1 and T2, respectively (Figure S16 in file S1).
- Dwil\GK11203 is a GST Delta class member. The annotated sequence codes for a protein of only 108 amino acids. We have found conserved sequence of Delta class 91 nucleotides upstream of the annotated ATG start site. Moreover there is a possible ATG start site that would encode 17 amino acids of a GST protein (Figure S17 in file S1). This conserved block also shows high identity to Dwil\GK11871 which is located next to Dwil\GK11203 on the same chromosome and is further discussed below in the genomic organization section. Nevertheless about 60 amino acids, after the first 17 amino acids, are still missing and these residues constitute a major portion of the active site. Thus if this is not an error from sequencing, Dwil\GK11203 appears to be a pseudogene.
- Dvir\GJ24387 when translated shows the greatest amino acid identity to DmelGSTD10. The gene region of Dvir\GJ24387 codes for a protein of only 136 amino acids (Figure S18 in file S1).
- Dvir\GJ19066 encodes a peptide of 54 amino acids which shows the greatest amino acid sequence identity to DmelGSTD1. Curiously, Dvir\GJ19066 is located on the same scaffold as the 2 Theta GSTs. Although we found a possible conserved block of sequence upstream of the annotated ATG start site, the nucleotide sequence for the C-terminus of the protein is still missing. Obviously this pseudogene which encodes a ¼ length protein would not be expressing a functional enzyme (Figure S19 in file S1).
Ambiguous annotation
The mutation rate of different Drosophila species by natural selection would influence the gene loss and changes in genome size. Indel mutations are one of the major effectors of genome evolution. From our manual curation of each Drosophila GST sequence, we found both gene insertion and deletion mutations in 4 Drosophila species. However as previously mentioned, the quality of the genome assembly of D. sechellia and D. simulans was low. Therefore these findings remain ambiguous as to whether they are errors from genome sequencing or actual indel mutations. These 9 GST gene annotations are described below.
- Dsim\GD17492 (DsimGSTT3) is annotated to be a DmelGSTT3 ortholog. This gene would undergo alternative splicing to yield 2 alternatively spliced products. This will be discussed further in the next section. Its gene size reported by FlyBase is 750 bp which codes for smaller GSTT3A and GSTT3B proteins compared to other species. We found that one cytosine (C) appears to be missing (Figure S20 in file S1). Therefore the annotation split exon 5 into 2 exons to keep the remaining DNA sequence in frame. The annotated intron between the split exon 5 and 6 is 56 nucleotides. If the absent cytosine actually is present in the sequence as in D. melanogaster, DsimGSTT3A and GSTT3B will code for proteins of 228 and 268 amino acids and show 98 and 97% amino acid sequence identity to DmelGSTT3A and GSTT3B, respectively.
- Dsim\GD11388 (DsimGSTE11) is annotated to be a DmelGSTE11 ortholog and codes for a protein of 251 amino acids. This protein is longer than GSTE11 orthologs in other species. We found a possible ATG start site which codes for the conserved GSTE11 sequence in intron 1 but the end of this intron has a TAG stop codon (Figure S21 in file S1). If the putative stop codon (TAG) at the end of intron 1 is CTG, as in D. melanogaster, and the translation start site is from our predicted one, it would encode a protein of 225 amino acid and show 97% sequence identity to DmelGSTE11.
- Dsim\GD24922 (DsimGSTE12) is annotated to be a DmelGSTE12 ortholog and codes for a protein of 213 amino acids. This annotated protein is shorter than other GSTE12 orthologs. This is possibly due to one thymidine (T) missing from exon 2 (Figure S22 in file S1). We found that if this absent thymidine is present as it is in D. melanogaster and transcription occurs reading through the intron 2 as coding sequence, this would encode a protein of 223 amino acids and show 98% amino acid sequence identity to DmelGSTE12.
- Dsec\GM24014 and Dsec\GM24015 are annotated to be GST protein coding genes. These 2 genes are located next to each other on the same chromosome being only 23 nucleotides apart. These 2 single exons code for proteins of 91 and 115 amino acids, respectively. Dsec\GM24014 aligns very well with the 5′ end whereas Dsec\GM24015 aligns with the 3′ end of DmelGSTD2. Using the GSTD2 gene of D. melanogaster as template, we found that at nucleotide 261 of the Dsec\GM24014 exon, one cytidine (C) is missing which results in a stop codon at nucleotide 275 (Figure S23 in file S1). If the missing cytidine is indeed present then merging Dsec\GM24014 and Dsec\GM24015, including the 23 nucleotide gap between the 2 exons, would yield a gene with very high identity to GSTD2 of D. melanogaster (95% and 98% nucleotide and amino acid sequence identity, respectively).
- Dsec\GM25062 (DsecGSTO4) is annotated to be a DmelGSTO4 ortholog and codes for a 204 amino acid protein. The gene region of DsecGSTO4 appears to be completely sequenced. Using DmelGSTO4 as sequence template, it was found that there are both nucleotide insertions and deletions. There is one cytidine (C) insertion in each of exons 2 and 3 of DsecGSTO4, which causes frame shifts so that exon sequence has been annotated as intron. The annotated second intron and part of the third intron align with encoded conserved sequence from exon 2 in D. melanogaster. Moreover the second intron of DsecGSTO4 also is missing one nucleotide. Therefore although we include the second and third introns of DsecGSTO4 as exon, the reading frame will be shifted which in this case results in a stop codon and incorrect coding protein (Figure S24 in file S1). Previously the DmelGSTO4 has been shown to be PDA (6-acetyl-2-amino-3,7,8,9-tetrahydro-4H-pyrimido[4,5-b]-[1], [4]diazepin-4-one or pyrimidodiazepine) synthase which converts 2-amino-4-oxo-6-pyruvoyl-5,6,7,8-tetrahydropteridine (also called 6-pyruvoyltetrahydropterin; 6-PTP) into PDA, an important intermediate in eye pigment drosopterin biosynthesis [31]. Another possibility for the sequence ambiguity is that this species sequencing data may actually be from a sepia mutant which is the phenotype for mutations of this gene.
- Dsec\GM21874 (DsecGSTE1) is annotated to be a DmelGSTE1 ortholog and codes for a protein of 334 amino acids. The annotated exon 1 does not show conserved sequence to any Epsilon class member. In addition, the annotated gene would translate to a protein which is larger than any known GST. We have found a possible ATG start site located in the intron region (34 nucleotides upstream of the annotated second exon (Figure S25 in file S1). However a stop codon results due to an absent thymidine (T) at position 27 from our predicted ATG start site. Nonetheless, if this absent thymine is present as it is in D. melanogaster, translation from our predicted site will encode a protein of 206 amino acids. This proposed sequence has 66% amino acid identity to DmelGSTE1. Moreover it will be a single exon as found for GSTE1 of the other Drosophila species.
- Dsec\GM21098 (DsecGSTE13) is annotated to be a DmelGSTE13 ortholog which codes for a protein of 212 amino acids. This is actually smaller than GSTE13 orthologs in other species due to a one adenosine (A) base insertion which results in a frame shift. It seems that the extra adenosine region was annotated as intron to keep the remaining sequences in-frame (Figure S26 in file S1). If the extra adenosine is absent as in D. melanogaster, a read-through of the annotated intron 3 as exon would then yield a protein of 226 amino acids and identity increases to 98% compared to DmelGSTE13.
- Dper\GL13668 (DperGSTZ2) is annotated to be a DmelGSTZ2B ortholog. In addition to the incomplete DNA sequencing as mentioned in the previous Sequencing Error section, there also appears to be an insertion. We found one guanosine (G) insertion in exon 5 which would give a frame shift (Figure S10 in file S1). If the following intron region is included in this exon, to keep the rest of the sequence in frame, this also makes the 3 isoforms of DperGSTZ2 larger than GSTZ2 from the other Drosophila species.
- Dvir\GJ14962 codes for a protein of 277 amino acids and is identified to be a DmelGSTE13 ortholog. Again the protein is longer than GSTE13 orthologs in other species. We found one adenosine (A) insertion at nucleotide position 419 of exon 4. This insertion creates a frame shift which reads through its stop codon (TAA) to terminate at the next stop codon (Figure S27 in file S1). If the extra A is absent, as in D. melanogaster, the TAA stop codon will be in-frame. The GSTE13 of D. melanogaster and D. virilis then show 74% amino acid identity to each other.
Alternative splicing
The FlyBase annotations for the 11 species do not show the alternative splicing found in D. melanogaster. In addition, the alternatively spliced products sometimes are reported to originate from different genes. Therefore we have analyzed whether the GST genes in these 11 Drosophila species also undergo alternative splicing as in D. melanogaster. Our curation reveals that GSTD11, GSTZ2, GSTT3 and GSTO2 in all 11 species would also undergo alternative splicing and GSTO2A and GSTO2B are spliced products from the same gene (Figures S28–S31 in file S1). Exceptions to this are found in D. mojavensis and D. grimshawi, which have been shown to have only one isoform of GSTO2 which is the GSTO2B protein. Due to high gene conservation of GSTs throughout the 12 species, we have found a preserved pattern of not only the coding region but also the intron-exon boundaries as well as the untranslated region (UTR) (Figure S32 and Table S2 in file S1).
Although not annotated in FlyBase, the GSTD11, GSTZ2, GSTT3 and GSTO2 in all 11 species would also undergo alternative splicing similar to D. melanogaster. As mentioned in a previous section, DsimGSTT3 and DperGSTZ2 appear to have indel mutations. However this is somewhat uncertain as these 2 species were sequenced at very low coverage. FlyBase has recently reported a third DmelGSTT3C variant. The coding sequence of DmelGSTT3C is exactly the same as DmelGSTT3A. The difference is the 5′UTR. Since there is no 5′UTR or 3′UTR for the other 11 Drosophila species reported yet, the nucleotide sequence that we used in our analysis was the previously annotated DmelGSTT3A. In the case of the DsecGSTT3 gene for which the sequencing is incomplete, we did not include the variant sequences in our analysis.
As mentioned, at present there is no annotation for the 11 Drosophila species' untranslated regions. However, based on our manual analysis of each individual gene, we found that both the 5′ and 3′UTR of GSTZ2 show high sequence conservation to D. melanogaster; whereas, the UTR of the GSTT3 genes are quite varied. GSTO2 and GSTD11 of the 4 species; D. simulans, D. sechellia, D. erecta and D. yakuba reveal highly conserved sequences to the template species especially for the 5′UTR. However the 3′UTR sequences of GSTD11 are relatively varied.
GSTD11 and GSTZ2 variants show very high amino acid sequence identity to the orthologous D. melanogaster genes ranging from 84–100%. GSTD11A and GSTD11B of D. simulans show the highest identity whereas D. grimshawi show the lowest. The 3 alternatively spliced products of GSTZ2 show even greater conservation to D. melanogaster. The GSTZ2B and GSTZ2C amino acid sequences of D. simulans, D. sechellia, D. erecta, D. yakuba, D. ananassae, D. persimilis, D. pseudoobscura, D. willistoni show 100% identity to D. melanogaster; although D. virilis, D. grimshawi and D. mojavensis have only a single amino acid difference at Val106Ile and Val101Ile of GSTZ2B and GSTZ2C, respectively. GSTD11A and GSTD11B of D. simulans also show 100% amino acid sequence identity to D. melanogaster (Figure S33 in file S1).
Genomic organization of the other 11 Drosophila species
GSTs comprise a superfamily in D. melanogaster as there are at least 36 GST genes in the genome. By using genomic comparison as a tool to identify the GST superfamily members in the other 11 Drosophila species, we found different numbers of GST genes in each Drosophila species (Table 1 and Table S1 in file S1). Although gene duplication is generally believed to be followed by divergence, the GST genes of all 12 Drosophila species seem to be fairly conserved. This actually facilitated the chromosome/scaffold mapping. We have manually analyzed and constructed a genome map for each Drosophila species using D. melanogaster as a template [14]. Many of the GSTs showed clear orthologs in D. melanogaster and FlyBase has annotated or we have curated accordingly. However, some annotated GST genes were fragments or showed orthology to multiple DmelGSTs and these cases are specifically discussed below.
Drosophila simulans.
The genomic organization and distribution of the GST genes on the chromosomes of D. simulans are the most similar to D. melanogaster compared to the other 10 species. D. simulans GSTs show clear orthologous GST isoforms to D. melanogaster; although, the genome sequencing is at low assembly coverage. The D. simulans GST genes are also located on chromosome 3R, 2R, 2L and X (Figure S34A in file S1). The cytological map of D. simulans shows an inverted sequence on chromosome 3R [28]. This paracentric inversion is on the breakpoints 84F1 and 93F6-7. As the GST Delta and Zeta classes are located on this chromosome they are arranged in an inverted orientation, whereas the other 4 GST classes are well clustered and located roughly the same distance from each other when compared to the D. melanogaster template (compare Figure S34A in file S1 and Figure 1 in Reference [14]).
Drosophila sechellia.
In addition to D. simulans, D. sechellia has also been sequenced to low level coverage which results in errors in scaffold assemblage. Scaffold 0 was reported to be a chimera between chromosome 3R and 3L [28]. As a consequence GST Delta, Zeta and Omega classes were found to be located on the same scaffold. It also shows paracentric inversion for D. sechellia similar to D. simulans. As only Delta and Zeta classes align in the inverted orientation the paracentric inversion appears to occur just in part of chromosome 3R. A BLAST search with Dsec\GM24018 retrieved GSTD2, GSTD4 and GSTD5 of D. melanogaster with 73%, 98% and 70% amino acid identity, respectively. Interestingly D. sechellia also appears to have another GST gene that is a GSTD2 ortholog (as discussed in the Ambiguous annotation section). A BLAST search of Dsec\GM21880 amino acid sequence hits 4 Dmel Epsilon class members, GSTE5 (96% identity), GSTE6 (74% identity), GSTE7 (68% identity) and GSTE8 (72% identity). Dsec\GM21875 is an obvious DmelGSTE2 ortholog with 95% amino acid identity. Although a search with Dsec\GM21878 shows it to be an Epsilon class GST, its highest amino acid sequence identity also is to GSTE2, but with only 64% identity. Two Theta class GSTs, GSTT3 and GSTT4, of D. sechellia are located on different scaffolds, 8 and 21 respectively. Assemblage shows them to be both on the Muller-A element (Dmel chromosome arm X) and in D. melanogaster DmelGSTT3 and GSTT4 are located on chromosome X. Moreover we found incomplete sequencing for DsecGSTT3. We suspect that if the sequencing was complete, Dsec\GM23038 would be an orthologous protein to DmelGSTT3. However the whole gene needs to be sequenced to obtain the missing part of the gene (Figure S34B in file S1).
Drosophila erecta.
D. erecta possesses both paracentric and pericentric inversions as none of the D. melanogaster GSTs are located on chromosome 2L, whereas GSTT1, GSTT2 and GSTE13 of D. erecta are found on scaffold 4929 which is equivalent to chromosome 2L. This phenomenon comes from a pericentric inversion leading to the fusion of the base of chromosome 2R and 2L near the centromere [28]. Moreover a paracentric inversion also has occurred as these 3 GSTs are oriented in the reverse direction compared to D. melanogaster [28]. The remaining Epsilon members and the Sigma class GST are found on scaffold 4845 (chromosome 2R). Dere\GG21880 and Dere\GG21882 are annotated to be GSTE1 (91% identity) and GSTE2 (90% identity) D. melanogaster orthologs, respectively. However Dere\GG21881 and Dere\GG21885 also are annotated to be GSTE1 and GSTE2 with 79% and 66% amino acid sequence identity, respectively. This is considered to be a very high identity to GSTE1 and GSTE2, as Dere\GG21881 has 26%-51% and Dere\GG21885 has 25%-54% identity to other Epsilon class members. This suggests that these two genes would generate additional GSTE1 and GSTE2 isoform variants in this species. Dere\GG17139 is annotated to be an ortholog to DmelGSTD10 as it shows 91% amino acid identity, although FlyBase also reports Dere\GG17138 to be a DmelGSTD10 ortholog with 95% identity. A sequence search with Dere\GG18783 hit GSTD2 as well as GSTD4 and GSTD5 of D. melanogaster with 79%, 72% and 87% amino acid identity respectively. There is no orthologous protein to D. melanogaster GSTD6 found in D. erecta. As in the two species above, Delta and Zeta class genes show paracentric inversions compared to D. melanogaster as shown in Figure S34C in file S1.
Drosophila yakuba.
In a similar situation to D. erecta, D. yakuba shows pericentric inversion compared to D. melanogaster, which places Dyak\GE19294 and Dyak\GE19295 on chromosome 2L [28]. The amino acid sequences of these two GSTs hit both GSTT1 and GSTT2 of D. melanogaster. Dyak\GE19294 gives 94% amino acid identity to DmelGSTT1 and 62% to DmelGSTT2; whereas Dyak\GE19295 gives 66% identity to DmelGSTT1 and 92% to DmelGSTT2. Therefore, we annotate these proteins, Dyak\GE19294 and Dyak\GE19295 as DmelGSTT1 and GSTT2 orthologs, respectively. The Epsilon and Sigma classes are still located on chromosome 2R although the chromosome has undergone paracentric inversion. The Omega class gene cluster also has undergone a paracentric inversion on chromosome 3L. Although GSTE2 (90% amino acid identity) and GSTE3 (92% amino acid identity) of D. yakuba have been annotated, Dyak\GE11960 and Dyak\GE11959 also show high identities, 67% and 63% amino acid sequence identity to D. melanogaster GSTE2 and GSTE3, respectively. This indicates the existence of additional isoforms of GSTE2 and GSTE3 in this species. FlyBase has annotated the remaining Epsilon GSTs to their respective orthologs in D. melanogaster. BLAST searching Dyak\GE26173 sequence hit GSTD2, GSTD4 and GSTD5 in D. melanogaster with 82%, 73% and 75% amino acid identity respectively, which yields another ortholog to DmelGSTD2 in D. yakuba (Figure S34D in file S1).
Drosophila ananassae.
A pericentric inversion also appears to have occurred in this Drosophila species. The inversion changes chromosome X into a metacentric instead of an acrocentric chromosome [28]. D. ananassae GSTT3 and GSTT4 are located on different scaffolds of chromosome X. FlyBase shows Dana\GF17941, Dana\GF17942 and Dana\GF17943 as orthologs of GSTD2, GSTD4 and GSTD5 of D. melanogaster although Dana\GF17941 would appear to be a pseudogene. Curiously, protein product of Dana\GF17943 has greater amino acid identity (73%, 69%, 72%) than Dana\GF17942 (64%, 60%, 61%) to all 3 Delta GST enzymes. Likewise, both Dana\GF17945 and Dana\GF17946 are shown to be orthologs of DmelGSTD7 with a high conservation of 73% and 78% amino acid sequence identity, respectively and 93% identity compared to each other. DmelGSTT1 and GSTT2 have amino acid sequence identities with 3 D. ananassae GSTs, Dana\GF12484 (85%, 66%), Dana\GF12485 (63%, 71%) and Dana\GF12486 (72%, 74%), respectively. Dana\GF12484 shows the highest sequence identity to DmelGSTT1, although GF12485 and GF12486 show slightly greater identity to DmelGSTT2. There is a large cluster of Epsilon class GSTs located on scaffold 13266 as well as the Theta and Sigma class GSTs. FlyBase shows two D. ananassae GSTs; Dana\GF12160 and Dana\GF12161, as orthologs of GSTE1 of D. melanogaster with 78% and 76% sequence identity. GSTE2 also appears to have 2 D. ananassae orthologs, Dana\GF12162 (77% identity) and Dana\GF12168 (67% identity). Surprisingly, DmelGSTE3 was found to have 4 D. ananassae orthologs with 67% to 78% amino acid identity (Dana\GF12163, Dana\GF12165, Dana\GF12166 and Dana\GF12167; Table S1 in file S1). Dana\GF12164 is annotated to be an unknown GST but comparison of the translated protein to Epsilon class GSTs also shows it to be a GSTE3 ortholog with 67% identity (Table S1 and Figure S34E in file S1). So interestingly, D. ananassae has 5 GSTE3 orthologs. Four genes Dana\GF12171, Dana\GF12172, Dana\GF12173 and Dana\GF12174 show orthology to GSTE5, GSTE6, GSTE7 and GSTE8 of D. melanogaster with 61% to 75% amino acid identity (Table S1 in file S1). These 4 D. ananassae genes span about 3.4 kb, a similar distance to the 4 kb in D. melanogaster for the 4 Epsilon genes; however Dana\GF12171 and Dana\GF12172 appear to be more related to GSTE6 whereas Dana\GF12173 and Dana\GF12174 are more related to GSTE7. The 4 D. ananassae GSTs appear to share greater identity with the D. melanogaster GSTs than they do with each other, which suggests that gene divergence occurred after the tandem duplication events that generated the four genes.
Drosophila pseudoobscura.
In D. pseudoobscura, there are large chromosomal rearrangements, compared to D. melanogaster, one of which moves the GST genes from chromosome 3L to the right arm of chromosome X. Therefore the GST Omega class members are found on chromosome XR_group6 instead of chromosome 3L. GSTT3 and GSTT4 are on different scaffolds, XL_group1e and XL_group3a, respectively. Searches with translated sequences from both Dpse\GA15569 and Dpse\GA24982 hit GSTT1 and GSTT2. Although, both Dpse\GA15569 and Dpse\GA24982 have greater identity against DmelGSTT1, 77% and 73%, respectively. Dpse\GA15569 shows the greater identity; therefore we have annotated Dpse\GA15569 as a GSTT1. Searches with Dpse\GA18009 protein sequence retrieved GSTD2, GSTD4 and GSTD5 of D. melanogaster with both GSTD2 and GSTD5 having 72% identity (Table S1 in file S1). Although Dpse\GA27027 and Dpse\GA27028 were not annotated to be orthologs to any D. melanogaster GST, a BLAST search of both sequences hit DmelGSTD2, GSTD4 and GSTD6. Although the GSTE3 ortholog of D. pseudoobscura, Dpse\GA14541 (73% amino acid identity), has been annotated, Dpse\GA24907 (67% amino acid identity) also appears to be an ortholog of GSTE3 (Table S1 in file S1). Dpse\GA14545 appears to be the ortholog of GSTE5 (76% identity), GSTE6 (76% identity), GSTE7 (68% identity) and GSTE8 (68% identity) with other D. pseudoobscura ortholog candidates showing <60% amino acid identity (Figure S34F in file S1). So these 4 DmelGSTs show the greatest orthology to this one DpseGST.
Drosophila persimilis.
D. persimilis shares an analogous karyotype to D. pseudoobscura and both are classified in the obscura group [28]. D. persimilis also has been sequenced to low coverage which results in partial sequences for the DperGSTZ2 and GSTT4 genes. The gene organization of GST Delta class in D. persimilis is similar to that of D. pseudoobscura. A BLAST search with Dper\GL27300 hit GSTD2, GSTD4 and GSTD5 with 73%, 71% and 73% amino acid identities. The two proteins from genes Dper\GL27301 and Dper\GL27302 show the highest amino acid identity to DmelGSTD2 of 62% and 64%, respectively; although Dper\GL27302 also shows 64% identity to DmelGSTD4 (Table S1 in file S1). While FlyBase has annotated Dper\GL17770 to be GSTE3 with 72% amino acid identity, Dper\GL17772 also has its highest identity of 67% against GSTE3. A search with Dper\GL17773 protein hit GSTE5 (76% identity), GSTE6 (77%), GSTE7 (68%) and GSTE8 (68%). Dper\GL17152 has orthology to both GSTT1 (77% identity) and GSTT2 (69% identity) of D. melanogaster. Dper\GL17151 would appear to be the remainder of the paired Theta GST genes that usually generate T1 and T2 (Figure S34G in file S1). However, in this species Dper\GL17151 is a pseudogene that encodes a protein of 111 amino acids which is only the N-terminus half of the protein as discussed above in the Pseudogenes section.
Drosophila willistoni.
There is a cluster of Delta class genes, Dwil\GK11202, Dwil\GK11203 and Dwil\GK11871-11876 that have been annotated as GSTs. Although, Dwil\GK 11203 is a pseudogene as it encodes a protein of only 108 amino acids. These 7 genes share very high conservation of amino acid encoding sequence (58-65% identity) to one another as well as high identity (>58%) to GSTD1, GSTD2, GSTD4, GSTD5 and GSTD8 of D. melanogaster (Table S1 in file S1). The genome sequence of D. willistoni has several fragmentations so GSTT1 and GSTT2, GSTS1 and GSTE14, GSTE12 and the large cluster of Epsilon class GSTs are located on four different scaffolds (Figure S34H in file S1). FlyBase has annotated Dwil\GK22989 as the DwilGSTE7 ortholog with 64% identity to DmelGSTE7. However, both translated proteins from Dwil\GK22990 and Dwil\GK22991 show 61% to 69% identity to D. melanogaster GSTE5, GSTE6, GSTE7 and GSTE8. FlyBase does not show orthologs for Dwil\GK22988 to any isoform but BLAST searching hits GSTE3 with 60% amino acid identity. BLAST searching with both Dwil\22985 and Dwil\22987 hit DmelGSTE2 with 61% and 63% identity, respectively. D. willistoni is the only species that appears to lack the GSTE13 ortholog. Searches with Dwil\GK15953 and Dwil\GK15954 hit both GSTT1 and GSTT2, with both of their sequences showing greater identity to GSTT1 (Figure S34H and Table S1 in file S1).
Drosophila virilis.
Although annotated as an unknown Delta class GST Dvir\GJ22852 shows>60% amino acid identity to GSTD1 (61%), GSTD2 (62%) and GSTD5 (63%). Dvir\GJ22854 also is annotated as an unknown Delta GST and shows ≥60% identity to GSTD1 (64%), GSTD2 (63%), GSTD4 (62%), GSTD5 (64%), GSTD8 (64%) and GSTD10 (60%). FlyBase does show orthology for Dvir\GJ22855 and Dvir\GJ22856 with GSTD2, GSTD4 and GSTD5. However, amino acid comparisons with D. melanogaster Delta class isoforms show a more extensive orthology. Dvir\GJ22855 shows ≥60% identity to GSTD1 (65%), GSTD2 (67%), GSTD4 (66%), GSTD5 (65%), GSTD8 (66%) and GSTD10 (61%). Dvir\GJ22856 shows ≥60% identity to GSTD1 (62%), GSTD2 (64%), GSTD4 (62%), GSTD5 (63%) and GSTD8 (60%). Such similar identities to multiple D. melanogaster isoforms makes it difficult to identify single orthologs, although it does give clues to GST evolution. FlyBase has not identified orthologs for GSTE1 and GSTE2. However, using DmelGSTE1 and DmelGSTE2 as template to BLAST search D. virilis, we identified 2 unknown GSTs on two different scaffolds. Dvir\GJ21357 and Dvir\GJ12879 show the greatest identity to GSTE1 and GSTE2, (58% and 68% identity) respectively (see Table S1 in file S1). FlyBase shows Dvir\GJ19892 with orthology to GSTE5 (61% identity), GSTE6 (60% identity), GSTE7 (61% identity) and GSTE8 (58% identity). Dvir\GJ19893 is also shown by FlyBase to be orthologous to GSTE5 (66% identity), GSTE6 (65% identity), GSTE7 (63% identity) and GSTE8 (61% identity). FlyBase shows Dvir\GJ21509 with orthology to both GSTT1 (68% identity) and GSTT2 (60% identity). In this species, there appears to be only 3 Theta genes and no GSTO1 ortholog (Figure S34I in file S1).
Drosophila mojavensis.
Zeta and Delta class GSTs are located on scaffold 6540. The 2 Zeta genes are 1.4 kb apart and the Zeta 2 gene is alternatively spliced to generate 3 protein products as mentioned above. The Delta cluster appears to consist of only 7 genes with 2 genes being about 15 Mb distant from the others (Figure S34J in file S1). FlyBase shows Dmoj\GI23195 with orthology to DmelGSTD2, DmelGSTD4 and DmelGSTD5 and a translated amino acid alignment shows identity as 63%, 58% and 64%, respectively. FlyBase also identified 2 unknown GSTs, Dmoj\GI23193 and Dmoj\GI23194. Translated amino acid alignment shows high identity to multiple D. melanogaster Delta GSTs with>60% to GSTD1, GSTD2, GSTD4, GSTD5 and GSTD8 for both genes (Table S1 in file S1). FlyBase also identified Dmoj\GI24379 and Dmoj\GI22354 as orthologous to DmelGSTD1 and a translated amino acid alignment shows 93% and 88% identity to DmelGSTD1, respectively. The proteins from these 2 genes share 92% identity to each other. Several different scaffolds contain the Epsilon, Sigma and Theta class GSTs (Figure S34J in file S1). Dmoj\GI24095 is isolated on scaffold 6500 and FlyBase has identified it as a GST gene. We have translated and aligned the protein product to show it has the best match to DmelGSTE1 with 55% amino acid identity. FlyBase has both Dmoj\GI16623 and Dmoj\GI16624 as orthologs to DmelGSTE2 and a translated amino acid alignment shows 64% and 66% identity, respectively. Dmoj\GI20122 and Dmoj\GI20123 have been annotated as being orthologs to GSTE5, GSTE6, GSTE7, and GSTE8 of D. melanogaster. However, both translated protein products have the greatest identity with DmelGSTE6 of 63% and 64%, respectively (Table S1 in file S1). Dmoj\GI18422 is annotated to have orthology to both GSTT1 and GSTT2, although a translated amino acid alignment shows greater identity to GSTT1, 64% versus 56%. Similar to D. virilis, there appears to be only 3 Theta GST genes and no GSTO1 ortholog to D. melanogaster in this species (Figure S34J in file S1).
Drosophila grimshawi.
D. grimshawi is of special interest since there are 2 scaffolds, Sc_15074 and Sc_14830, which appear to contain the same 4 Delta GSTs genes. Moreover, Sc_15074 also contains a fifth GST, annotated as GSTD11, not on the second scaffold (Figure S34K in file S1). FlyBase has annotated two of the genes on each scaffold to be GSTD1 and GSTD10; however, the proteins of the 2 GSTD1 (Dgri\GH20186 and Dgri\GH13103) and 2 GSTD10 (Dgri\GH20197 and Dgri\GH13113), one from each scaffold, are 99% identical with a single amino acid difference between them. For GSTD1 the difference is Ser163Thr and for GSTD10 the difference is Ala76Thr. Both DgriGSTD1 proteins share 93% identity with DmelGSTD1 and both DgriGSTD10 proteins share 75% identity with DmelGSTD10. A third Delta gene pair (Dgri\GH20559 and Dgri\GH17521) has been annotated to be orthologous to GSTD2, GSTD4 and GSTD5 and this gene's protein from each scaffold is also 99% identical to the other scaffold product with the difference Val24Ile. Both protein products would share between 61% and 66% identity with GSTD1, GSTD2, GSTD4, GSTD5, GSTD8 and GSTD10 from D. melanogaster. The fourth Delta gene common to both scaffolds (Dgri\GH20548 and Dgri\GH17520) is annotated as an unknown GST. From both scaffolds this common gene would translate to a 100% identical protein. The protein product also has 60% to 64% amino acid identity with GSTD1, GSTD2, GSTD4, GSTD5, GSTD8 and GSTD10 from D. melanogaster. Uniquely among the 12 Drosophila species of this study D. grimshawi has been annotated to have 3 Zeta GST genes. Dgri\GH19140 is annotated as the GSTZ1 ortholog. Dgri\GH19138 is annotated to be GSTZ2 by FlyBase and as discussed above we have identified 3 alternatively spliced products similar to the other drosophilids. Interestingly, Dgri\GH19139 is located between GSTZ1 and GSTZ2 (Figure S34K in file S1). Moreover it possesses GST features and conserved sequence to Zeta class. The translated protein from Dgri\GH19139 shows 54% to 60% amino acid identity to the 4 Zeta proteins (GSTZ1, GSTZ2A, GSTZ2B and GSTZC) from D. melanogaster. This is actually a quite low identity comparison for Zeta proteins as these 4 proteins have 99% to 100% identity for the respective orthologs from the 12 drosophilids in this report. This suggests this extra Zeta GST has quite rapidly diverged as the grimshawi clade would have diverged from the virilis-repleta radiation only about 42.9 Ma [28], [32]. The virilis-repleta radiation contains both the D. virilis and D. mojavensis species. Epsilon class GST genes are located on several different scaffolds (Figure S34K in file S1). Scaffold 15245 contains a large cluster of Epsilon members as well as the Sigma class GST. Dgri\GH21669 is annotated to be orthologous to GSTE5 (63% identity), GSTE6 (66% identity), GSTE7 (56% identity) and GSTE8 (59% identity) from D. melanogaster. On scaffold 15126 where the annotated GSTE1 (Dgri\GH13569; 58% amino acid identity to DmelGSTE1) is located, there is also an annotated unknown GST (Dgri\GH13568) located ∼2 kb upstream of DgriGSTE1. Protein products from these 2 genes share 88% identity with each other, which also suggests rapid divergence after duplication. Amino acid translation of Dgri\GH22936 shows 70% sequence identity to DmelGSTT1 compared to 62% for DmelGSTT2. Again, there appears to be only 3 Theta GST genes and no GSTO1 ortholog to D. melanogaster in this species. Furthermore the GSTO2 gene encodes only one protein which has greater sequence identity to the DmelGSTO2B (74% identity) than to the GSTO2A variant (62% identity).
Discussion
This comparative genomic study of the 12 Drosophila genomes has allowed classification of novel GSTs, several highly conserved GSTs as well as proteins unique to a lineage or single species. The analysis has also allowed a prediction of the evolutionary origin of the isoforms within a GST class. A parsimony tree analysis shows clustering of the designated isoforms for each GST class, with the best example being Omega class (Figure 2, for other GST classes see Figure S35 in file S1). In general the clustering of each GST isoform on the parsimony tree is similar to the fly species phylogenetic tree (Figure 1), which suggests a link between the GST isoforms and the fly species. This implies that as the fly species diverge to adapt to the new ecological niches the GST family played roles in this adaptation.
The phylogenetic tree analysis used sequences from the Omega class from the 12 Drosophila species. Each isoform is designated by their FlyBase symbol followed by the D. melanogaster ortholog name in parenthesis. For example, Dana\GF10159(O1), where O1 refers to the DmelGST Omega 1 ortholog.
There are 19 orthologous GST genes that all 12 Drosophila species possess and these 19 genes express 23 proteins. Delta class consists of 11 genes (expressing 12 proteins) in D. melanogaster but orthologs for only 2 of these Delta genes (expressing 3 proteins) are present in all 12 Drosophila species. In contrast, of the 14 Epsilon class genes in D. melanogaster 8 orthologs are conserved across the 12 species. Enzymes from both classes have been proposed to play significant roles in detoxification of endogenous and xenobiotic compounds.
The Omega class GSTO1 is present in only the subgenus Sophophora species, possibly originating from a duplication of GSTO4 as these proteins share the greatest identity. The alternatively spliced GSTO2 gene in subgenus Sophophora generates 2 protein products but in 2 of the 3 Drosophila subgenus species generates only one protein. The GSTO2 gene appears to become alternatively splice during the virilis-repleta divergence as it is spliced in D. virilis but not D. mojavensis. Curiously, the intron-exon spliced gene organization is the same for D. virilis (subgenus Drosophila) as it is for the 9 subgenera Sophophora species; which suggests that the spliced product was lost in the other two Drosophila subgenus species.
The 12 species of this study possess 3 of the 4 alternatively spliced genes. Even though the alternatively spliced GSTO2 gene is not present in D. mojavensis and D. grimshawi the coding sequence for the GSTO2B protein is still present. The remaining spliced products tend to be highly conserved among the 12 species. The best example is the 3 protein splice products from the GSTZ2 gene with the 11 species orthologs possessing 94% to 100% amino acid identity to the relevant D. melanogaster proteins. However the alternatively spliced proteins also show us that the spliced products can evolve or diverge at different rates, as demonstrated by the subgenera Drosophila species GSTT3A and B isoforms. We also see for single gene products that although the gene may be present and conserved across the 12 species it can still diverge significantly as shown by GSTZ1 with 54% to 95% amino acid identity compared to D. melanogaster. In contrast to this divergence some of the orthologous genes present in all 12 species can be highly conserved as shown by GSTD1 with 93% to 98%, and GSTS1 with 92% to 99% amino acid identity compared to D. melanogaster. Obviously, the proteins that are so highly conserved must perform a critical or important function to be maintained over more than 60 million years of species divergence and evolution. Unfortunately the specific functions of the GSTs are unknown at this time. Although it is interesting to note that DmelGSTD1 was found to have a very broad substrate specificity [14].
Both GSTT4 and GSTT3A occur in all 12 Drosophila species and the 2 proteins show low conservation between them. This suggests an ancient duplication and divergence for the 2 genes. We suggest that DmelGSTT3A appears to be most related to the ancestral Theta GST as it shows the greatest amino acid identity to the single Theta GSTs in the Hymenoptera Apis mellifera (honey bee), 41%, and Lepidoptera Bombyx mori (silkworm moth), 44%. DmelGSTT3A also has 46% identity with one of the 2 Theta GSTs in the Coleoptera Tribolium castaneum (red flour beetle). DmelGSTT3A also has the greatest identity, 51%, to the mosquito Anopheles gambiae GSTT1 and 41% to the other A. gambiae Theta, GSTT2. The Diptera fruit flies and mosquitoes are estimated to have diverged 238.5 to 295.4 Ma [33]. The GSTT3 gene would have become alternatively spliced before the Drosophila divergence as both GST3A and GST3B appear in all 12 species with reasonably high conservation. GSTT2 appears to have duplicated after subgenera Drosophila and Sophophora diverged at 62.9Ma but before the willistoni, obscura and melanogaster groups diverged at 62.2 Ma. GSTT2 most likely originated from a GSTT1 duplication event as GSTT2 still shows the highest identity towards GSTT1.
Although some of the gene copies clearly originate with tandem duplication events such as for the copies of GSTD10 and GSTE1 in D. erecta, GSTE3 in D. yakuba, or GSTD7 and GSTE3 in D. ananassae. Analysis also indicates that multiple duplication events occurred from a single gene template. A clear example is the 5 copies of the orthologous GSTE3 in D. ananassae with 59% to 78% amino acid identity between the 5 proteins, demonstrating that these proteins have also undergone diversification after duplication. Several of the GSTs are lineage specific which suggests that the genes appeared after species divergence. GSTE3, GSTO1 and GSTT2, appear only in the Sophophora genus which would place their earliest appearance at about 62.9 Ma. The Delta class GSTD7 appears only in the Melanogaster group which diverged about 54.9 Ma. Both the Epsilon GSTE8 and Delta GSTD3 appear only in the Melanogaster subgroup which diverged about 44.2 Ma. The GSTD3 appears to have originated from a Delta 2/4/5 gene and rapidly diverged during the speciation of the Melanogaster subgroup. Analysis of the 12 species data suggests this Delta 2/4/5 gene to have originated with GSTD1 and then the 2/4/5 gene further duplicated to yield the other Delta genes, excluding GSTD11 which seems to be concurrent with GSTD1 in the Drosophila genus. In fact, consideration of the data from the 12 species suggests that GSTD1 gave rise to a gene template that further duplicated to initially yield the Delta 2/4/5/8/10 genes. This can be observed as the template gene is still present in several of the species, sometimes as multiple copies. Although there are many conserved Epsilon GSTs in these 12 Drosophila species the template gene scenario also can be observed with the template gene Epsilon 5/6/7/8 being found in several species again sometimes as multiple copies. The multiple copies would obviously be duplications and possibly in the process of diverging as shown by the 4 copies of Epsilon 5/6/7/8 in D. ananassae (Table S1 in file S1).
In addition to the well-known major chromosomal rearrangements, both paracentric and pericentric inversions as well as chromosomal fusions [28] (and references therein), the regions containing the GST genes also appear to have undergone micro-rearrangements. The sizes of these rearranged pieces are much smaller than the usually analyzed synteny blocks that are measured in megabases. These small pieces can contain intronless protein coding sequences and may be only a few hundred base pairs in length. The GST genome maps for the 11 Drosophila species illustrate the micro-plasticity of the GST gene region (Figure S34 in file S1). For example, the extreme rearrangement of the Epsilon cluster as observed for D. grimshawi where it appears the Epsilon genes have been dispersed compared to the other species (Figure S34K in file S1). Many of these rearrangements in and around the Epsilon gene cluster in six species are shown for illustrative purposes (Figure 3). One obvious rearrangement is that the Epsilon cluster, approximately 20 Kb, has undergone an inversion such as in D. yakuba, D. ananassae and D. virilis, relative to the surrounding GST genes (Figure 3; Figure S34D, E, I in file S1). We also observed multiple duplications from the same gene template, clearly shown in D. ananassae, as well as rearrangements within the cluster as shown by D. simulans (Figure 3 and Table S1 in file S1). Another reorganization noted is that the GST genes around the Epsilon cluster appear to have been ‘shuffled’ as for D. erecta, D. pseudoobscura, D. persimilis and D. mojavensis (Figure 3; Figure S34C, F, G and J in file S1). This shuffling is evident even between closely related species pairs such as D. erecta and D. yakuba which diverged about 10.4 Ma or the D. pseudoobscura and D. persimilis species pair more recently diverged at about 0.85 Ma. There also appears to be inversion of individual GST genes or groups of GST genes relative to the Epsilon cluster but still remaining near the cluster. For an illustration of these points consider Sigma GSTS1 from the different species, its orientation and position relative to the Epsilon cluster gene GSTE11 (Figure 3). For example, in D. erecta transcription of GSTS1 and GSTE11 is in the same direction with no GST genes in-between and downstream of GSTS1 are GSTE14 (3800 Kb away) and GSTE12 (9100 Kb away). However, in the sister species D. yakuba, GSTS1 and GSTE11 are transcribed in opposite directions as the Epsilon gene cluster is ‘inverted’. Also in D. yakuba GSTE13 is between the Epsilon gene cluster and GSTS1 whereas GSTE12 is only 2200 Kb downstream of GSTS1 with GSTE14 on the opposite side of the Epsilon gene cluster.
Genomic maps showing the Epsilon GST gene organization in six Drosophila species. These examples illustrate the overall synteny of the Epsilon gene cluster as well as the micro-rearrangements that occur in the individual species. The genes are shown as arrows which represent the direction of transcription.
We report here the identification of new GSTs as well as improved annotation of the GSTs in the FlyBase genomes database of 12 Drosophila species. This analysis has also highlighted several salient features of the compared genomes. The GST gene family is ancient and in the ‘recently’ evolved Drosophila genus has undergone repeated local duplications followed by transposition, inversion, micro-rearrangements and functional diversifications of these copies (Figure S34 in file S1). The gene copies originate from tandem duplications as well as multiple duplications from a single gene template. In the 12 species of this study, we identified several GST proteins that are highly conserved across the 63 Ma of speciation; as well as several GSTs that are lineage specific or apparently species specific (Figure S34 and Table S1 in file S1). Although many of the GST genes show clear orthology across the Drosophila species the genomic organization of the genes is also clearly very flexible across the species. The co-linearity, relative positions and orientations of the GST genes, within a relatively short genomic distance, appear to be unique in each species; which shows that these genomic rearrangements have occurred multiple times over the course of evolution and divergence of the 12 species in the last 60 million years. Although the mechanism of the genome micro-plasticity is currently unknown, it appears to have contributed substantially to the evolution of a gene family. Whether this micro-plasticity is a unique feature of Drosophila species or a general property of eukaryote genomes remains to be shown.
Materials and Methods
Comparative genomic analysis
Our analysis is the genomic comparison of 11 Drosophila species to D. melanogaster. The D. melanogaster GST genes and their translated proteins were used as a benchmark template to annotate the GST orthologs in the other sequenced Drosophila genomes. We retrieved the sequences from FlyBase version FB2013_05, released September 13, 2013. This version is based on the Annotation Release 5.53 of D. melanogaster, Annotation Release 3.1 of D. pseudoobscura, Annotation Release 1.4 of D. simulans, Annotation Release 1.3 of D. ananassae, D. erecta, D. grimshawi, D. mojavensis, D. persimilis, D. sechellia, D. willistoni and D. yakuba and Annotation Release 1.2 of D. virilis. Each single GST gene has been analyzed by manual curation. Briefly, the GST genes of D. melanogaster were first used for BLASTn searching. Then GSTs that cannot be obtained from the first screen were searched for again by using amino acid sequence of D. melanogaster as a query sequence for the respective species. Moreover we also searched for putative GST genes by their molecular function. The retrieved sequences were then confirmed by nucleotide and amino acid sequence alignment using the ClustalX and GeneDoc programs.
Alternative splicing determination
The genome region of each Drosophila species was retrieved from Flybase. To determine whether the GSTs from the other 11 Drosophila species also undergo alternative splicing as in D. melanogaster, the splicing patterns of DmelGSTZ2A/B/C, D11A/B, T3A/B and O2A/B for introns and exons as well as the protein amino acid sequences were used as templates and compared to the other 11 Drosophila species for each gene.
Phylogenetic tree construction
The GST sequences of all 12 Drosophila species from the same class were used for analysis. The trees were constructed by Geneious R7 program. BLOSUM62 was used to score the alignments. Distances were obtained from pairwise alignments of all sequence pairs and calculated using Jukes-Cantor algorithm. The phylogenetic trees were constructed by neighbor-joining method with a gap penalty of 1.
GST annotation and nomenclature
The FlyBase symbols are unique identifiers and are therefore used throughout this report for clarity. Additionally, we employ the GST nomenclature for the 11 Drosophila species which is based on the D. melanogaster GST system. We have assigned a descriptive name to all GST orthologs as well as the 2 letter ID followed by the 5 digit number. The uppercase D refers to Drosophila followed by the first 3 letters of each species' name, GST class designation and individual number. For example, Dsim\GD17126 is D. simulans, this gene was found to be orthologous to DmelGSTT4 the D. melanogaster GST numbered 4 from Theta class. Therefore the name of this gene would be DsimGSTT4 and the expressed protein product would be DsimGSTT4.
Supporting Information
File S1.
Supplementary Figures and Tables. Figure S1. The annotated gene region of Dsim\GD17126 (DsimGSTT4) from Flybase. A. 6 exons of DsimGSTT4 code for a protein of 288 amino acids. If the putative exons 2 and 3 are intron as in DmelGSTT4, DsimGSTT4 would encode a GST protein of 237 amino acids. B. The GSTT4 amino acid alignment of the proposed D. simulans and D. melanogaster shows 100% identity. Figure S2. The annotated gene region of Dere\GG21888 (DereGSTE6) from Flybase. A. The underlined nucleotides at the 5′end is the excluded sequence which makes DereGSTE6 larger than usual for Epsilon class GSTs. Exclusion of these 54 nucleotides and starting the translation from the second ATG start site as shown in red, DereGSTE6 will code for a GST protein of 222 amino acids. B. The GSTE6 amino acid sequence alignment of D. erecta and D. melanogaster shows 93% identity. Figure S3. The annotated gene region of Dana\GF17942 from Flybase. A. A possible ATG start site is situated in the intron region as shown by the underline and then read through the second exon. The coding sequence of Dana\GF17942 will become one single exon and code for a protein of 220 amino acids. B. The amino acid sequence alignment of Dana\GF17942 and DmelGSTD2 shows 64% identity. Figure S4. The annotated gene region of Dana\GF11968 (DanaGSTE11) from Flybase. A. 45 nucleotides of the coding sequences of DanaGSTE11 including stop codon are in the intron region. Including these 45 nucleotides as the last part of exon 2, DanaGSTE11 will be a 225 GST protein. B. The GSTE11 amino acid sequence alignment of D. ananassae and D. melanogaster shows 87% identity. Figure S5. The annotated gene region of Dvir\GJ22855 from Flybase. A. The suggested ATG start site is 48 nucleotides (amino acids encoded are shown below) upstream of exon 1. This now larger exon is in-frame and contiguous and encodes a protein of 216 amino acids. B. The amino acid sequence alignment of our curated Dvir\GJ22855 and DmelGSTD2 shows 67% amino acid identity. The arrow indicates the previously annotated transcriptional start site methionine (M). Figure S6. The annotated gene region of Dvir\GJ22856 from Flybase. A. The possible ATG start site is 33 nucleotides (amino acids encoded are shown below) upstream of exon 1. This larger exon is in-frame and contiguous and encodes a protein of 211 amino acids. B. The amino acids sequence alignment of Dvir\GJ22856 and DmelGSTD2 shows 64% amino acid identity. The arrow indicates the previous annotated methionine (M). Figure S7. The annotated gene region of Dvir\GJ23571 (DvirGSTZ1) from Flybase. A. The possible ATG start site is 255 nucleotides upstream of exon 1 as shown in underline. This larger exon is in-frame and contiguous and codes for a protein of 247 amino acids. B. The GSTZ1 amino acids sequence alignment of D. virillis and D. melanogaster shows 61% identity. The arrow indicates the previous annotated methionine (M). Figure S8. The annotated gene region of Dsec\GM23038 (DsecGSTT3) from Flybase. A. The incomplete gene sequencing of D. sechellia GSTT3 shown as Ns in the middle of the gene. B. The amino acid sequence alignment of GSTT3 D. sechellia and D. melanogaster is highly conserved. Figure S9. The annotated gene region of Dper\GL26999 (DperGSTT4) from Flybase. A. We have proposed that exons 2 and 3 of annotated DperGSTT4 are intron and the remainder of the coding sequence is in the incompletely sequenced region and exons 4, 5 and 6. The sequence of exons 5 and 6 is quite conserved compared to the last 2 exons from D. melanogaster. The new sequence of DperGSTT4 and the incomplete part are shown as underline. This gene needs to be re-sequenced to obtain the missing sequence. B. The amino acid alignment of GSTT4 D. persimilis and D. melanogaster shows high identity to each other. Figure S10. The annotated gene region of Dper\GL13668 (DperGSTZ2). A. ATG start codon (as underline) of GSTZ2B, Z2C and Z2A are on exon 1, 2 and 3 respectively. They share exons 4 and 5. Exons 2 and 3 are intron of GSTZ2B, and exon 3 is intron of GSTZ2C, therefore the incomplete sequencing data does not affect the sequence translation of these isoforms. Fortunately, the coding regions of GSTZ2B and Z2C were sequenced. As their sequences are quite conserved with D. melanogaster they can be manually curated. B. Based on D. melanogaster, this gene would have 6 exons. But we found a single guanosine (G) insertion (shown in red) which causes a frameshift mutation. If the extra G is absent and the 59 nucleotides after this G are intron (double underlined) as in D. melanogaster, the DperGSTZ2A, Z2B and Z2C will show 96, 100 and 100% amino acid sequence identity to all 3 spliced products of DmelGSTZ2, respectively. Obviously, with the Ns in intron 2 and this extra G in exon 5 the gene should be sequenced again. Figure S11. The annotated gene region of Dsec\GM24019 from Flybase. A. The Dsec\GM24019 gene is located next to Dsec\GM24018 gene on the same chromosome. There is a 149 nucleotide gap between the 2 genes. Although 69 nucleotides upstream of the annotated ATG start site of Dsec\GM24019 (underline) code for GST conserved sequence, this GST is still too short be an active enzyme. B. The short amino acid sequence of Dsec\GM24019 shows 52% identity to the C-terminus part of DmelGSTD6. Figure S12. The annotated gene region of Dsec\GM21877 from Flybase. A. Gene region of Dsec\GM21877. The coding sequence is 447 bp. B. The nucleotide sequence alignment of Dsec\GM21877 and Dmel\CR43687 pseudogene. Figure S13. The annotated gene region of Dyak\GE11955 (DyakGSTE1) from Flybase. A. Dyak\GE11955 was reported to have 1 intron. However the sequence of the annotated intron codes for part of the conserved DmGSTE1 protein. B. The amino acid sequence alignment of DmGSTE1 and DyakGSTE1, (1) and (2). DyakGSTE1 (1) is the protein sequence reported by Flybase. DyakGSTE1 (2) includes the protein coding sequence in the annotated intron region. Figure S14. The annotated gene region of Dana\GF17941 from Flybase. Dana\GF17941 shows high amino acid sequence identity to the C-terminus part of DmelGSTD2, 4 and 5. Figure S15. The annotated gene region of Dper\17151 (DperGSTT2) from Flybase. A. Gene region of DperGSTT2 which codes for protein 212 amino acids. The sequence show high conservative to DmelGSTT2. B. The amino acid sequence alignment of DmelGSTT2 and the pseudogene product DperGSTT2. Figure S16. The annotated gene region of Dper\GL26929 from Flybase. A. The gene region of Dper\GL26929 codes for a protein of 163 amino acids. B. The amino acid sequence alignment of Dper\GL26929 to DmelGSTT1 and T2 show 27% and 29% amino acid identity. The conserved sequences are shown underlined. Figure S17. The annotated gene region of Dwil\GK11203 from Flybase. A. Exon 1 is the annotated coding sequence from Flybase but we found conserved blocks of sequences located upstream of the annotated ATG start site as shown in the bracket. B. Dwil\GK11203 (1) is the annotated sequence reported by Flybase. It shows the highest amino acid sequence identity to DmelGSTD5 but it has about 60 critical amino acids missing from the active site so would not be an active GST enzyme. Therefore this gene is suggested to be a pseudogene. Dwil\GK11203 (2) shows some conserved sequence upstream of the annotated ATG start site. Figure S18. The annotated gene region of Dvir\GJ24387 (DvirGSTD10) from Flybase. A. Dvir\GJ24387has been reported to have 2 exons and 1 intron. Although we found that part of the intron sequence (underlined) also codes for conserved sequence of DmGSTD10, this protein is still too short to be an active GST enzyme. The conserved sequence is QYGKDSTLYPKDIQTQALIN. B. The short amino acid sequence of DvirGSTD10 shows 49% amino acid sequence identity to DmelGSTD10. Figure S19. The annotated gene region of Dvir\GJ19066 from Flybase. A. Dvir\GJ19066 encodes a protein of 54 amino acids which shows the greatest amino acid identity to DmelGSTD1. Moreover we found possible conserved sequence of 63 nucleotides upstream contiguous with the annotated ATG start site (underlined). B. The short amino acid sequence of Dvir\GJ19066 shows 20% identity to the N-terminus part of DmelGSTD1. Figure S20. The annotated gene region of Dsim\GD17492 (DsimGSTT3) from Flybase. A. The underlined ATG (exon 1 and exon 4) represent the start codons of T3B and T3A, respectively. The sequence from exons 5 to 6 of the DsimGSTT3 gene comprises the sequence of exon 5 in D. melanogaster. Due to the first cytosine (C) of exon 6 is missing; the annotation split the sequence into 2 exons apparently to keep the remaining sequence in frame. Thus DsimGSTT3A and T3B are shorter than T3A and T3B in other species. B. DsimT3 (1) refers to the sequence reported by Flybase. DsimT3 (2) refers to the sequence from the new curation. If the missing cytosine is replaced, T3A and T3B will translate to proteins of 228 and 268 amino acids and show 98 and 97% amino acid sequence identity to D. melanogaster. Figure S21. The annotated gene region of Dsim\GD11388 (DsimGSTE11) from Flybase. A. The curated ATG start site is highlighted in yellow, however the end of intron 1 shows a stop codon (TAG) in the annotation but which may be CTG, as in D. melanogaster, in this low coverage genome. B. The figure shows the amino acid alignment of DmelGSTE11, DsimGSTE11 (1) and DsimGSTE11 (2). DsimGSTE11 (1) is the annotated sequence from Flybase and DsimGSTE11 (2) is a new curated sequence. If the stop codon (TAG) at the end of intron 1 is CTG as in D. melanogaster and the translation start site is the yellow highlighted sequence, the proteins show 97% sequence identity to each other. The Ser13 in DmelGSTE11 (shown by arrow) is the catalytic serine and that region is generally conserved for active site topology which suggests that DsimGSTE11 (1) may be an inactive enzyme. Figure S22. The annotated gene region of Dsim\GD24922 (DsimGSTE12) from Flybase. A. Using DmelGSTE12 as template, we found that possibly a thymidine (T) is missing as shown by the underlined gap in exon 2. If this is so, intron 2 also would be translated to the coding sequence. If the thymidine is present a transcription read through would include intron 2 as coding sequence, which then would encode a protein of 223 amino acids. B. The panel shows the amino acid alignment of DmelGSTE12, DsimGSTE12 (1) and DsimGSTE12 (2). DsimGSTE12 (1) is the annotated sequence from Flybase and DsimGSTE12 (2) is a new curated sequence. The new curated sequence of DsimGSTE12 (2) aligns with DmelGSTE12 giving 98% amino acid sequence identity. Figure S23. The ambiguous annotation of Dsec\GM24014 and Dsec\GM24015 (DsecGSTD2). A. The first exon is the annotated coding sequence of Dsec\GM24014 whereas the second exon belongs to Dsec\GM24015 and the small gap of 23 nucleotides between the 2 genes is shown underlined. A missing cytosine of Dsec\GM24014 results in a frame shift which also results in a premature stop codon (TGA). The addition of cytosine to Dsec\GM24014 followed by a read through the gap as well as the exon of Dsec\GM24015 would result in a protein of 215 amino acids. This single exon would encode GSTD2 of D. sechellia. B. The GSTD2 amino acids sequence alignment of D. sechellia and D. melanogaster shows 98% identity. Figure S24. The annotated gene region of Dsec\GM25062 (DsecGSTO4) from Flybase. A. Using DmelGSTO4 as template, we found that intron 2 and part of intron 3 (as underlined) of D. sechellia GSTO4 show very highly conserved gene sequences to DmelGSTO4. However there are two insertions of cytosine, one in exon 2 the other in exon 3 as shown in red. The insertion in exon 2 would lead to a stop codon in intron 2 (TGA as underlined), hence its intron annotation. Moreover, annotated intron 2 contains 1 nucleotide less than DmelGSTO4. This frame shift leads to wrong coding protein. Therefore intron 2 and part of intron 3 were annotated by FlyBase as intron which makes DsecGSTO4 shorter than normal GST Omega class (204 instead of 240 to 250 amino acids). The sequence of intron 3 that is underlined should be part of the protein coding gene, WCERLELLKLQRGEDYNYDESRFPQL. B. The comparison between the conserved block of D. sechellia and D. melanogaster GSTO4. In the annotated intron 2, 7 nucleotides downstream from the stop codon there appears to be a deletion (position shown in panel A as underlined T). If in the exon this one nucleotide deletion would result in a frame-shift. C. The figure shows amino acid alignment of GSTO4 from D. sechellia and D. melanogaster. The empty blocks are the missing sequences of intron 2 and 3. D. The figure shows amino acid alignment of GSTO4 from D. sechellia and D. melanogaster if the inserted cytosines are absent from exons 2 and 3, as in D. melanogaster, and one more nucleotide present in intron 2 (GTGATCTGGATCCCTTCTGGAGCGGCCTGGA CGTCTACGAAAG), the full coding sequence would be present. The proteins would have 97% amino acid sequence identity to each other. This sequence is ambiguous because of the low coverage genome sequencing. Figure S25. The annotated gene region of Dsec\GM21874 (DsecGSTE1) from Flybase. A. A possible ATG start site is located in the intron region. However it includes a TAG stop codon due to the absence of a T, TA(T)G. If the T is present as it is in D. melanogaster, the gene will code for a 206 amino acid protein. B. The GSTE1 amino acid sequence alignment of D. sechellia and D. melanogaster shows 65% identity. Figure S26. The annotated gene region of Dsec\GM21098 (DsecGSTE13) from Flybase. A. In D. melanogaster the sequences from exon 3 to 4 are one continuous exon. There is one adenosine (A) insertion as shown in red which results in a frameshift. Therefore it appears some of the exon region was annotated as intron to keep the rest of the sequence in-frame. B. DsecE13 (1) refers to the sequence reported by Flyabse. DsecE13 (2) refers to the sequence from our new curation. The amino acid sequence alignment of DmelGSTE13 and DsecGSTE13 (1) shows 92% identity. The missing gap is the part of the gene which is annotated as intron. If the extra adenosine is absent as in D. melanogaster, the amino acid identity increases to 98% for 226 amino acids. Figure S27. The annotated gene region of Dvir\GJ14962 (DvirGSTE13) from Flybase. A. We found one adenosine (A) insertion at nucleotide position 419 of exon 4 (shown in red). This insertion makes a frame shift which reads through the stop codon (TAA) shown in red. B. The figure shows the amino acid alignment of DmelGSTE13, DvirGSTE13 (1) and DvirGSTE13 (2). DvirGSTE13 (1) is the annotated sequence from Flybase and DvirGSTE13 (2) is a new curated sequence. The amino acid alignment of DmelGSTE13 and DvirGSTE13 (1) shows 57% identity. If the extra A is absent, as in D. melanogaster, the TAA stop codon shown in red will be in-frame. The two proteins then show 74% amino acid identity to each other. Figure S28. Alternative splicing scheme of DyakGSTD11. A. DyakGSTD11 gene undergoes alternative splicing to generate 2 variants, DyakGSTD11A and DyakGSTD11B. DyakGSTD11Aare from exon 1, 3, 4 and 5. The whole exon 1 and the first 10 nucleotides of exon 3 are proposed to be 5′UTR of DyakGSTD11A whereas the first 17 nucleotides of exon 2 is proposed to be 5′UTR of DyakGSTD11B as shown underlined. DyakGSTD11A and DyakGSTD11B share the sequences in exon 4 and 5. They also share 3′UTR which is the last 94 nucleotides of exon 5 (underline). B. We propose the possible 5′UTR of DyakGSTD11A. This sequence shows nucleotide sequence identity of 83% to D. melanogaster. C. We propose the possible 5′UTR of DyakGSTD11B. This sequence shows nucleotide sequence identity of 100% to D. melanogaster. D. We propose the possible 3′UTR of DyakGSTD11. This sequence shows nucleotide sequence identity of 81% to D. melanogaster. Figure S29. Alternative splicing scheme of DyakGSTZ2. A. DyakGSTZ2 gene undergoes alternative splicing to generate 3 variants, DyakGSTZ2A, DyakGSTZ2B and DyakGSTZ2C. The first 356 nucleotides of exon 1 is proposed to be 5′UTR of DyakGSTZ2B as shown underlined. The first 40 nucleotides of exon 7 and the first 29 nucleotides of exon 6 are proposed to be 5′UTR of DyakGSTZ2C and DyakGSTZ2A, respectively. B. We propose the possible 5′UTR of DyakGSTZ2A. This sequence shows nucleotide sequence identity of 100% to D. melanogaster. C. We propose the possible 5′UTR of DyakGSTZ2B. This sequence shows nucleotide sequence identity of 89% to D. melanogaster. D. We propose the possible 5′UTR of DyakGSTZ2C. This sequence shows nucleotide sequence identity of 95% to D. melanogaster. E. We propose the possible 3′UTR of DyakGSTZ2A. This sequence shows nucleotide sequence identity of 83% to D. melanogaster. F. We propose the possible 3′UTR of DyakGSTZ2B. This sequence shows nucleotide sequence identity of 86% to D. melanogaster. G. We propose the possible 3′UTR of DyakGSTZ2C. This sequence shows nucleotide sequence identity of 85% to D. melanogaster. Figure S30. Alternative splicing scheme of DyakGSTT3. A. DyakGSTT3 gene undergoes alternative splicing to generate 3 variants, DyakGSTT3A, DyakGSTT3B and DyakGSTT3C. The first 235 nucleotides of exon 1 is proposed to be 5′UTR of DyakGSTT3B as shown underlined. Exon 1, 2, 3 and the first 29 nucleotides of exon 4 is proposed to be 5′UTR of DyakGSTT3C. Exon 3 and the first 29 nucleotides of exon 4 is proposed to be 5′UTR of DyakGSTT3A as shown in yellow highlight. All 3 variants share exon 4–6 and the 3′UTR which is the last 165 nucleotides of exon 6 as underlined. B. We propose the possible 5′UTR of DyakGSTT3B. This sequence shows nucleotide sequence identity of 71% to D. melanogaster. C. We propose the possible 5′UTR of DyakGSTT3C. This sequence shows nucleotide sequence identity of 80% to D. melanogaster. D. We propose the possible 5′UTR of DyakGSTT3A. This sequence shows nucleotide sequence identity of 94% to D. melanogaster. E. We propose the possible 3′UTR of DyakGSTT3. This sequence shows nucleotide sequence identity of 72% to D. melanogaster. Figure S31. Alternative splicing scheme of DyakGSTO2. A. Flybase has reported that Dyak\GE21297 and Dyak\GE21298 are GST proteins in Omega class translated from 2 different genes. Our manual curation based on D. melanogaster has shown that these 2 GST proteins could possibly originate from the same gene which has undergone alternative splicing to yield 2 final protein products which are DyakGSTO2A and DyakGSTO2B. The two proteins share sequence in exon 1. The underlined sequence in exon 1 is proposed to be 5′UTR whereas the underlined sequences in exon 2 and 4 are proposed to be 3′UTR of DyakGSTO2B and DyakGSTO2A, respectively. B. We propose the possible 5′UTR of DyakGSTO2. Using D. melanogaster as a template this sequence shows 92% nucleotide sequence identity. C. We propose the possible 3′UTR of DyakGSTO2A. Using D. melanogaster as a template this sequence shows 70% nucleotide sequence identity. D. We propose the possible 3′UTR of DyakGSTO2B. Using D. melanogaster as a template this sequence shows 77% nucleotide sequence identity. Figure S32. The curation for alternative splicing in D. yakuba. Our curation of alternative splicing shows all 11 drosophila had alternatively spliced genes. This figure uses the D. yakuba genes to illustrate this result. The details for this cartoon are given in Table S2. Figure S33. The alternatively spliced GST proteins from the 12 Drosophila species. Each identified alternatively spliced GST from D. melanogaster was used to manually curate the other 11 Drosophila species. This figure shows the amino acid alignment for the spliced GSTs with a matrix table beneath showing the percent identity and directly below the percent similarity for each species GST compared to D. melanogaster's GST template. Figure S34. Genomic organization of the GSTs of the 11 Drosophila species. The genomic maps show the overall synteny of the GST gene family in the Drosophila genus. The genes are shown as arrows which indicate the direction of transcription. The blue color shows genes that FlyBase reports to have GST molecular function but does not specify a D. melanogaster ortholog. The magenta color shows pseudogenes identified by our curation. The purple color shows identified genes needing confirmation due to incomplete genome sequence. Figure S35. Phylogenetic tree analysis The phylogenetic tree analysis used sequences from each GST class from the 12 Drosophila species. Each isoform is designated by their FlyBase symbol followed by the D. melanogaster ortholog name in parenthesis. For example, Dana\GF17052(D1), where D1 refers to the DmelGSTD1 ortholog. In some species there is more than one isoform orthologous to the same D. melanogaster ortholog, so these will be noted as D1-2, D1-3 and so on. GSTT3A/B of D. sechellia and GSTT4 of D. persimilis were not included in this analysis due to incomplete gene sequencing. Table S1. Glutathione transferase orthologs in the 11 Drosophila species. Table S2. Example of alternative splicing curation of non-annotated genes for D. yakuba.
https://doi.org/10.1371/journal.pone.0109518.s001
(RAR)
Author Contributions
Conceived and designed the experiments: CS AJK. Performed the experiments: CS AJK. Analyzed the data: CS AJK. Contributed reagents/materials/analysis tools: CS AJK. Wrote the paper: CS AJK.
References
- 1. Letsou A, Bohmann D (2005) Small flies-Big discoveries: Nearly a century of Drosophila genetics and development. Developmental Dynamics 232 526–528.
- 2. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, et al. (2000) The genome sequence of Drosophila melanogaster Science. 287: 2185–2195.
- 3. Drosophila 12 Genomes C, Clark AG, Eisen MB, Smith DR, Bergman CM, et al. (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450: 203–218.
- 4. Hahn MW, Han MV, Han SG (2007) Gene family evolution across 12 Drosophila genomes. PLoS Genetics 3: e197.
- 5. Lin MF, Carlson JW, Crosby MA, Matthews BB, Yu C, et al. (2007) Revisiting the protein-coding gene catalog of Drosophila melanogaster using 12 fly genomes. Genome Research 17: 1823–1836.
- 6. Stark A, Lin MF, Kheradpour P, Pedersen JS, Parts L, et al. (2007) Discovery of functional elements in 12 Drosophila genomes using evolutionary signatures. Nature 450: 219–232.
- 7. Hayes JD, Flanagan JU, Jowsey IR (2005) Glutathione transferases. Annual Review of Pharmacology and Toxicology 45: 51–88.
- 8. Raza H, Robin MA, Fang JK, Avadhani NG (2002) Multiple isoforms of mitochondrial glutathione S-transferases and their differential induction under oxidative stress. Biochemical Journal 366: 45–55.
- 9. Aniya Y, Imaizumi N (2011) Mitochondrial glutathione transferases involving a new function for membrane permeability transition pore regulation. Drug Metab Rev 43: 292–299.
- 10. Morgenstern R, Zhang J, Johansson K (2011) Microsomal glutathione transferase 1: mechanism and functional roles. Drug Metab Rev 43: 300–306.
- 11. Jakobsson PJ, Morgenstern R, Mancini J, Ford-Hutchinson A, Persson B (1999) Common structural features of MAPEG—A widespread superfamily of membrane associated proteins with highly divergent functions in eicosanoid and glutathione metabolism. Protein Science 8: 689–692.
- 12. Lan T, Yang ZL, Yang X, Liu YJ, Wang XR, et al. (2009) Extensive functional diversification of the Populus glutathione S-transferase supergene family. Plant Cell 21: 3749–3766.
- 13. Cummins I, Dixon DP, Freitag-Pohl S, Skipsey M, Edwards R (2011) Multiple roles for plant glutathione transferases in xenobiotic detoxification. Drug Metab Rev 43: 266–280.
- 14. Saisawang C, Wongsantichon J, Ketterman AJ (2012) A preliminary characterization of the cytosolic glutathione transferase proteome from Drosophila melanogaster. Biochemical Journal 442: 181–190.
- 15. Hayes JD, Pulford DJ (1995) The glutathione S-transferase supergene family: Regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Critical Reviews in Biochemistry and Molecular Biology 30: 445–600.
- 16. Kim K, Kim SH, Kim J, Kim H, Yim J (2012) Glutathione s-transferase omega 1 activity is sufficient to suppress neurodegeneration in a Drosophila model of Parkinson disease. Journal of Biological Chemistry 287: 6628–6641.
- 17. Adler V, Yin Z, Fuchs SY, Benezra M, Rosario L, et al. (1999) Regulation of JNK signaling by GSTp. EMBO Journal 18: 1321–1334.
- 18. Wang T, Arifoglu P, Ronai Z, Tew KD (2001) Glutathione S -transferase P1-1 (GSTP1-1) inhibits c-Jun N-terminal kinase (JNK1) signaling through interaction with the C terminus Journal of Biological Chemistry. 276: 20999–21003.
- 19. Wu Y, Fan Y, Xue B, Luo L, Shen J, et al. (2006) Human glutathione S-transferase P1-1 interacts with TRAF2 and regulates TRAF2-ASK1 signals. Oncogene 25: 5787–5800.
- 20. Cho SG, Lee YH, Park HS, Ryoo K, Kang KW, et al. (2001) Glutathione S -transferase Mu modulates the stress-activated signals by suppressing apoptosis signal-regulating kinase 1. Journal of Biological Chemistry 276: 12749–12755.
- 21. Ryoo K, Huh SH, Lee YH, Yoon KW, Cho SG, et al. (2004) Negative regulation of MEKK1-induced signaling by glutathione S-transferase Mu. Journal of Biological Chemistry 279: 43589–43594.
- 22. Wongtrakul J, Sukittikul S, Saisawang C, Ketterman AJ (2012) Mitogen-activated protein (MAP) kinase p38b interaction with delta class glutathione transferases from the fruit fly Drosophila melanogaster. Journal of Insect Science (Tucson) 12: 107.
- 23. Udomsinprasert R, Bogoyevitch MA, Ketterman AJ (2004) Reciprocal regulation of glutathione S -transferase spliceforms and the Drosophila c-Jun N-terminal Kinase pathway components. Biochemical Journal 383: 483–490.
- 24. Markow TA, O'Grady PM (2007) Drosophila biology in the genomic age. Genetics 177: 1269–1276.
- 25. Low WY, Ng HL, Morton CJ, Parker MW, Batterham P, et al. (2007) Molecular evolution of glutathione S-transferases in the genus Drosophila. Genetics 177: 1363–1375.
- 26. Walters KB, Grant P, Johnson DL (2009) Evolution of the GST omega gene family in 12 Drosophila species. Journal of Heredity 100: 742–753.
- 27. Le Goff G, Bride J, Cuany A, Berge J, Amichot M (2001) The sibling species Drosophila melanogaster and Drosophila simulans differ in the expression profile of glutathione S-transferases. Comparative Biochemistry and Physiology, Part B: Biochemistry and Molecular Biology 129: 837–841.
- 28. Schaeffer SW, Bhutkar A, McAllister BF, Matsuda M, Matzkin LM, et al. (2008) Polytene chromosomal maps of 11 Drosophila species: the order of genomic scaffolds inferred from genetic and physical maps. Genetics 179: 1601–1655.
- 29. Rife CL, Armstrong RN (2001) Structural investigations of the glutathione transferases. Chemico-Biological Interactions 133: 40–42.
- 30. Vararattanavech A, Ketterman AJ (2007) A functionally conserved basic residue in glutathione transferases interacts with the glycine moiety of glutathione and is pivotal for enzyme catalysis. Biochemical Journal 406 247–256.
- 31. Kim J, Suh H, Kim S, Kim K, Ahn C, et al. (2006) Identification and characteristics of the structural gene for the Drosophila eye color mutant sepia, encoding PDA synthase, a member of the Omega class glutathione S-transferases. Biochemical Journal 398: 451–460.
- 32. Tamura K, Subramanian S, Kumar S (2004) Temporal patterns of fruit fly (Drosophila) evolution revealed by mutation clocks. Molecular Biology and Evolution 21: 36–44.
- 33. Benton MJ, Donoghue PC (2007) Paleontological evidence to date the tree of life. Molecular Biology and Evolution 24: 26–53.
- 34. Drosophila 12 Genomes Consortium, Clark AG, Eisen MB, Smith DR, Bergman CM, et al. (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450: 203–218.
- 35. Piano F, Craddock EM, Kambysellis MP (1997) Phylogeny of the island populations of the Hawaiian Drosophila grimshawi complex: evidence from combined data. Molecular Phylogenetics and Evolution 7: 173–184.