Cell cultures.

Rat primary NPCs were isolated from cerebral cortex of embryonic day 14(E14) SD rat as described previously [32]. For differentiation, NPCs were sub-cultured into poly-L-ornithine (0.1 mg/ml) pre-coated multi-well plates (1×10⁶/ml) using B27 supplement containing DMEM/F12 medium without growth factors. The cultures were kept in a humidified atmosphere (5% CO₂) at 37°C. HDACIs such as sodium valproate (0.5 mM), sodium butyrate (0.1 mM) and trichostatin A (0.2 µM) were treated 3 h after sub-culture. When appropriate, cell viability was determined by MTT assay. For cell culture and further progenitor cell differentiation experiments, timed pregnant female rats were obtained from OrientBio (Gyeonggi-do, Korea). Animal treatments including anesthesia, euthanasia and administration were carried out in accordance with the Principle of Laboratory Animal Care (NIH publication No. 85-23, revised 1985) and were approved by Animal Care and Use Committee of Konkuk University, Korea (KU13156).

Western blot analysis.

Cells were washed twice with PBS and lysed with 2x SDS-PAGE sample buffer (120 mM Tris-HCl (pH 6.8), 20% glycerol, 4% SDS, 28.8 mM 2-mercaptoethanol, and 0.01% bromophenol blue). Brain tissues were homogenized using RIPA buffer (150 mM sodium chloride, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1%SDS, 50 mM Tris, pH 8.0), and the resulting lysates were diluted with 2X SDS-PAGE sample buffer. Same amounts of protein (20 µg) determined by BCA protein assay was separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 1% skim milk in TBST containing 0.2% tween-20 for 1 hr. The membranes were incubated with primary antibody overnight at 4°C and with peroxidase-conjugated secondary antibody (Santa Cruz, CA) for 2 hrs at room temperature. Specific bands were detected using the ECL system (Amersham, Buckinghamshire, UK) and exposed to Bio-Rad electrophoresis image analyzer (Bio-Rad, Hemel Hampstead, UK). β-actin was used as loading control and Western blot band intensity was normalized with β-actin immunoreactivity.

RT-PCR.

Total RNA was extracted from NPCs using Trizol reagent and 1 µg of total RNA was reverse transcribed using a RevertAidTM Reverse transcriptase kit (K1622, Fermentas, Glen Burnie, Maryland, USA). Then 3 µl of the cDNA was used for a PCR amplification that consisted of 32 cycles (94°C, 1 min; 60°C, 30 sec; 72°C, 35 sec and continued by a final extension step at 72°C for 10 min) with the oligonucleotide primers for Ache [33], Chat [34]. For Gapdh (accession number: M17701) amplification, 25 cycles of PCR reaction was used.

for Ache,

forward primer: 5′-TTC TCC CAC ACC TGT CCT CAT C-3′

reverse primer: 5′-TTC ATA GAT ACC AAC ACG GTT CCC -3′

for Chat,

forward primer: 5′- CAA CCA TCT TCT GGC ACT GA-3′

reverse primer: 5′- TAG CAG GCT CCA TAG CCA TT-3′

for Gapdh,

forward primer: 5′- AAT GCA TCC TGC ACC ACC AA-3′

reverse primer: 5′- GAT GGC ATG GAC TGT GGT CA-3′

The amplified PCR products were analyzed on EtBr contained agarose gel and visualized.

Chromatin immunoprecipitation.

Chromatin immunoprecipitation(ChIP) was performed according to the reported method [35] with minor modifications. For in vitro ChIP, 43 µl of 37% formaldehyde was added to 1.6 ml of overlaying culture medium of neural progenitor cell and incubated for 15 min at room temperature. After incubation, 225 µl of 1 M glycine was added and incubated for 5 min. Cells were scraped and collected by centrifugation (2,000 g for 5 min at 4°C), then washed twice with cold PBS. For in vivo tissue ChIP, prefrontal cortices of control or VPA-exposed rat offspring at week 4 were homogenized with PBS. And 43 µl of 37% formaldehyde was added to 1.6 ml of homogenates. After 15 min incubation at room temperature, 225 ul of 1 M glycine was added and incubated for 5 min. The homogenates were centrifuged (2,000 g for 5 min at 4°C), then washed twice with cold PBS. Collected cells and homogenates were lysed with IP buffer (150 mM sodium chloride, 50 mM Tris-HCl pH 7.5, 5 mM EDTA, 0.5% IGEPAL CA-630, 1.0% Triton X-100) on ice. Pellet was resuspended with IP buffer by pipetting and washed by centrifugation (12,000 g for 1 min at 4°C). To shear the chromatin, 1 mL of the washed and resuspended pellet was sonicated on ice. After centrifugation (12,000 g for 10 min at 4°C), supernatants were used for immunoprecipitation. Primary antibody (1 µg) was added to 1 ml of supernatant, and the samples were incubated for 12 hrs at 4°C on a rotating platform. IgG was used as a control antibody. After incubation, mixture of 20 µl of IP buffer and 20 µl of Protein G Agarose (Pierce) was added to the sample, and incubated for 45 min at 4°C on a rotating platform. After incubation, samples were washed five times by centrifugation (2,000 g for 3 min at 4°C), and the supernatants were removed. 100 µl of 10% Chelex 100 was added to the washed beads for DNA isolation, and the samples were boiled for 10 min at 90°C. After centrifugation (12,000 g for 1 min at 4°C), 80 µl of supernatant was transferred to new tube, and 120 µl of DDW was added to beads. After centrifugation (12,000 g for 1 min at 4°C), 120 µl of supernatant was collected and added to the previous supernatant. Isolated DNA was used for PCR reaction. The primers were designed in the promoter region using Primer Quest Design tool from Integrated DNA Technologies, Inc. Gapdh was used as an control to validate this analysis. Used sequence is like below:

Ache, 5′ CCTTCTGCGTTCCACTATGT 3′ (forward)

5′ GGACACACTGACAGCTCTAATC 3′ (reverse)

Gapdh, 5′ TCGTCCGTCCTCTCTACTTT 3′ (forward)

5′ AGCTTTCTGGGCCTTCATAC 3′ (reverse)

Immunohistochemistry.

Animals were perfused with ice-cold 0.09% normal saline (pH 7.4) for 20 min, followed by 4% paraformaldehyde. Coronal sections, measuring 40 µM in thickness, were cut through the prefrontal cortex to prepare serial sections using a freezing cryostat (Leica). The sections were collected in 24-well culture plates (Falcon, Becton Dickinson Labware S.A., Le Pont-de-Claix, France) containing 1 ml of tissue stock solution (glycerol and ethylene glycol in 0.2 M phosphate buffer) in each well. Sections were immersed in blocking buffer (10% Horse serum and 0.3% Triton X-100 in PBS) for 1 h at room temperature. The brain sections were incubated overnight at 4°C with primary antibody against AChE (Millipore, 1∶500), and rinsed 3 times with washing buffer (1.5% HS and 0.1% Triton X-100 in PBS) for 10 min. Secondary antibody conjugated with Alexa488 was diluted in blocking buffer and incubated for 2 h at room temperature. After 3 rinses with washing buffer, stained tissues were incubated with To-Pro3 (1∶1000) for nucleus staining, and were attached to coated slide glass and mounted in ProLong solution (Invitrogen, USA), before they were viewed using a confocal microscope (ZEN2009, Carl Zeiss).

Animals for in vivo and behavioral study.

Pregnant Sprague-Dawley rats and ICR mice were purchased from OrientBio (Gyeonggi-do, Korea) and were maintained on a standard 12 hrs light-dark cycle, at ambient temperature (22±2°C) and humidity (55±5%) with free access to chow pellets and water. Prenatal exposure of VPA or PBS was performed as previously reported [29]. Rats and mice were injected with PBS or VPA subcutaneously at 400 mg/kg dosage on E12 and 300 mg/kg subcutaneously on E10, respectively. Total four mothers and their littermates were used for each group. Behavioral studies were performed from 4:00 PM to 8:00 PM. Before the behavior study, animals were habituated in the study place at least 1 hour.

Animal treatments including anesthesia, euthanasia and administration were carried out in accordance with the Principle of Laboratory Animal Care (NIH publication No. 85-23, revised 1985) and were approved by Animal Care and Use Committee of Konkuk University, Korea (KU13156).

Drug treatment.

Donepezil hydrochloride monohydrate (0.3 mg/kg of body weight) or saline was administered via intraperitoneal injection from postnatal day 14 to 40 (P14 to P40), once daily. Bodyweight was measured twice a week or before the behavior test. Dose was selected from the literature and preliminary test [36], [37]. In the preliminary test, 3 mg/kg and 5 mg/kg of the drug were injected to mice (P14) but soon after treatment some mice showed tremor and salivation (data not shown). Due to these side effects, we chose 0.3 mg/kg for this study. Moreover, chronic administration should be considered considering its regimen in clinical setting. The drug was freshly dissolved in saline (NaCl 0.9%) every administration schedule and given 30 min before starting the behavior test. During the experiment, no abnormal symptoms or toxic effects were observed in both drug and saline treated groups.

The 7 different types of behavioral analyses were performed consecutively until the animal reach P40 (Figure 1A). During the entire experimental periods, no body weigh differences were noted among experimental groups (Figure S3).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Drug treatment and behavioral study scheme with VPA mice.

VPA was s.c. injected at embryonic day 10 (E10) to pregnant mice. Donepezil was i.p. injected once daily from postnatal day 14 (P14) until the end of the study. Behavioral studies were performed from P21. Grooming and digging test and novel object recognition tests were performed at 4 weeks of age with different sets of animals.

https://doi.org/10.1371/journal.pone.0104927.g001

Open field locomotor test.

Exploratory activity in a novel environment was assessed in an open field box (40×40×30 cm). Mice were introduced into the center area of the arena and given 5 min habituation before recording the actual behaviors. The total distance moved in the whole arena and the velocity were measured for 20 min using CCD camera-assisted motion tracking apparatus and software (EthoVision 3.1, Noldus Information Technology, the Netherlands). Ten mice in each group were used for this analysis (N = 10).

Three chamber social interaction test.

The social interaction test was performed as previously reported [29]. The task consists of three sessions. In the first session, subject was introduced in the middle compartment and then habituated for 5 min. After habituation, a stranger animal (same age and no previous contact with the subject) of the same strain was introduced inside the wire cage of the left or right compartment (stranger zone 1) randomly while the other wire cage was empty (empty zone) for the 10 min sociability test. Time spent in the stranger zone 1 and around the cage was measured versus time spent in the empty zone. Social preference test was conducted for another 10 min directly after the termination of the sociability test. Another stranger animal was introduced in the wire cage of the opposite compartment (stranger zone 2) and same parameters were measured as with the previous session to find a preference of the subject animals to the novel over the familiar animal in the wire cage. The trace of movements during the experiment was automatically recorded using EthoVision software. Sociability (SI) and social preference indices (SPI) were calculated with the following formulas:

Ten mice in each group were used for this analysis (N = 10).

Elevated plus maze.

Elevated plus-maze test was conducted according to the previously reported procedures [38]. The maze is composed of two open arms (30×5 cm), two closed arms (30×5×15 cm) and a central (5×5 cm) area. Mice were placed in the central area and allowed to move freely in the maze. Mice movement and time spent in the arms were automatically recorded using EthoVision software. From 8 to 11 animals were used for this analysis (N = 9 for Con and VPA, N = 8 for DPZ, N = 11 for V+D).

Marble burying test.

The test was performed as previously reported with slight modifications [39]. Briefly, cages were filled with clean corncob bedding (1/8 inch, Anderson lab bedding, U.S.) with 3 cm height and the mouse was individually added for habituation. After 10 min, mouse was removed and 20 glass marbles (15 mm diameter) were carefully overlaid with equidistantly in a 4×5 arrangement. Each mouse was returned to its designated test cage and allowed to explore for 20 min. The number of marbles buried (>50% marble covered by the bedding) was recorded. Twelve mice in each group were used for this analysis (N = 12).

Self-grooming and digging test.

The test was performed as previously reported with slight modifications [40], [41]. Before the experiment, each mouse was placed in the polycarbonate cage (20×26×13 cm) with clean corncob bedding (1/8 inch, Anderson lab bedding, U.S.) and habituated for 10 minutes. Accumulative time of grooming and digging behavior was measured simultaneously at a distance of 2 m from the cage for 10 minutes. Twelve mice in each group were used for this analysis (N = 12).

Novel object recognition test.

The test was performed as previously reported [42]. Briefly, mice were placed in the empty polycarbonate cage (arena, 40×30×20 cm) and allowed to freely explore the cage for 10 minutes to habituate the experimental environment. The next day, identical two cylindrical plastic tubes (sample objects) were placed in the opposite corner. The subject was introduced into the arena carefully and given a period of 10 minutes to familiarize the sample objects. One hour later, one of the tubes was switched into a cubical novel object. And then the subject was re-introduced into the arena and recording the behavior for 5 minutes. Two observer evaluated their behavior by measuring the accumulative time interacting with each objects directly. The result was calculated as a discrimination ratio (novel object interaction/total interaction with both objects). Total 12∼13 mice in each group were used for this analysis (N = 13 for Con, VPA, and DPZ, N = 12 for V+D).

Nest building test.

The subjects were individually housed in the polycarbonate cage (20×26×13 cm) 3 hrs before the experiment. In each cage, a nestlet (5×5 cm, Ancare, NY, U.S.) was added at 17:00 o'clock and the results were assessed by the trained experimenter with blind method in the next morning. Scoring was performed as previously described [43]. Eight mice in each group were used for this analysis (N = 8).

Acetylcholinesterease activity assay.

AChE activity was measured at P35 using prefrontal cortex extracts after subchronic treatment of donepezil (N = 6). Briefly, mice were killed and prefrontal cortices were collected. Prefrontal cortices were homogenized with cold PBS on the ice. After centrifugation, supernatant was collected for the assay. To measure the AChE activity, we used Amplex Red ACh/AChE assay kit (Molecular probes, A12217) according to manufacturer's instructions. The measurement was performed using microplate reader (Spectramax Gemini EM, Molecular Devices) at excitation wavelength of 530 nm and emission wavelength of 590 nm. Background fluorescence was corrected by subtracting values from the negative control.

Statistical analysis.

Data were expressed as mean ± standard error of mean (S.E.M) and analyzed for statistical significance using one-way analysis of variance (ANOVA) followed by Newman-Keuls test as a post-hoc test. Two-way ANOVA was used to identify the effect of VPA exposure or drug treatment, and interaction between the two factors. If significant effects were found in any one of the factors, post-hoc comparisons were conducted using Bonferroni's post-tests. Differences were considered statistically significant when the p value was less than 0.05 (p<0.05). All statistical analyses were conducted using GraphPad Prism (version 5) software.