Figures
Abstract
The pandemic influenza A (H1N1) 2009 virus (pH1N1) contains novel gene segments of zoonotic origin that lack virulence and antiviral resistance markers. We aimed to evaluate the applicability and accuracy of mass spectrometry-based comparative sequence analysis (MSCSA) to detect genetic mutations associated with increased virulence or antiviral resistance in pH1N1. During the 2009 H1N1 pandemic, routine surveillance specimens and clinical antiviral resistance monitoring specimens were analyzed. Routine surveillance specimens obtained from 70 patients with pH1N1 infection were evaluated for mutations associated with increased virulence (PB1-F2, PB2 and NS1 genes) or antiviral resistance (neuraminidase gene, NA) using MSCSA and Sanger sequencing. MSCSA and Sanger sequencing results revealed a high concordance (nucleotides >99%, SNPs ∼94%). Virulence or resistance markers were not detected in routine surveillance specimens: all identified SNPs encoded for silent mutations or non-relevant amino acid substitutions. In a second study population, the presence of H275Y oseltamivir resistant virus was identified by real-time PCR in 19 of 35 clinical antiviral resistance monitoring specimens obtained from 4 immunocompromised patients with ≥14 days prolonged pH1N1 excretion. MSCSA detected H275Y in 24% (4/19) of positive specimens and Sanger sequencing in 89% (17/19). MSCSA only detected H275Y when the mutation was dominant in the analyzed specimens. In conclusion, MSCSA may be used as a rapid screening tool during molecular surveillance of pH1N1. The low sensitivity for the detection of H275Y mutation in mixed viral populations suggests that MSCSA is not suitable for antiviral resistance monitoring in the clinical setting.
Citation: Gooskens J, Zevenhoven-Dobbe JC, Claas EC, Kroes ACM, Posthuma CC (2014) Mass Spectrometry-Based Comparative Sequence Analysis for the Genetic Monitoring of Influenza A(H1N1)pdm09 Virus. PLoS ONE 9(4): e92970. https://doi.org/10.1371/journal.pone.0092970
Editor: Andrew Pekosz, Johns Hopkins University - Bloomberg School of Public Health, United States of America
Received: November 20, 2013; Accepted: February 27, 2014; Published: April 3, 2014
Copyright: © 2014 Gooskens et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors have no support or funding to report.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Influenza A and B viruses cause seasonal epidemics of febrile respiratory illness in the human population. The negative-sense RNA genome of influenza A viruses consists of eight segments which encode at least 13 proteins following transcription and translation [1]–[3]. Seasonal epidemics arise by antigenic drift through frequent mutations in hemagglutinin (HA) and neuraminidase (NA) surface glycoprotein genes enabling seasonal host immune evasion by the virus. In rare occasions, human influenza A virus gene segments reassort with other influenza A viruses from avian, human, and swine origins which can result in new antigenic subtypes that may cause severe human influenza pandemics [4].
In 2009, the influenza A (H1N1)pdm09 virus (pH1N1) with a relatively new antigenic subtype of zoonotic-origin emerged in Mexico and caused an influenza pandemic followed by rapid global spread in the human population [5]–[7]. The virus was likely generated through multiple reassortment events in pigs, and contained gene segments from North American “classical” swine influenza virus A/H1N1 (HA, NP, NS), North American avian influenza virus A/H1N1 (PB2, PA), human seasonal influenza virus A/H3N2 (PB1) and Eurasian swine influenza virus A/H1N1 (M, NA) [8]. The overall clinical presentation in humans appeared unexpectedly mild which can not be explained by residual host immunity in the human population. A minority of children and adults had preexisting cross-protective antibody titers against pH1N1 [9]. Only ∼18% of influenza A CD8+ cytotoxic T lymphocyte epitopes derived from previous seasonal influenza A viruses are conserved in pH1N1 [10]. The novel pH1N1 virus contained gene segments of zoonotic origin that lack virulence and antiviral resistance markers due to favorable genetic polymorphisms or truncations in PB2, PB1-F2, NS1 and NA genes [11]–[14].
Novel adaptive mutations may emerge in PB2, PB1-F2 and NS1 genes with the potential to increase viral replication and host pathogenicity of pH1N1 [14]–[16]. In addition, oseltamivir resistant virus may emerge during selective pressure [17], [18]. Wide-scale molecular surveillance is warranted but conventional sequencing methods are laborious and inefficient. Mass spectrometry-based comparative sequence analysis (MSCSA) enables rapid multigenomic sequence analysis with automated data analysis and could improve the availability of relevant pH1N1 genomic sequences [19], [20]. Rapid identification of relevant pH1N1 mutations in the community or in clinical settings may guide early prevention and intervention strategies. MSCSA was previously successfully used for the analysis of human cytomegalovirus sequence polymorphisms in UL97 gene and for detection of genetic mutations associated with antiviral resistance in clinical specimens [19].
In this study, we evaluated the applicability and accuracy of MSCSA to detect pH1N1 genetic mutations associated with increased virulence (PB1-F2, PB2 and NS1 genes) or antiviral resistance (NA gene).
Materials and Methods
Active Case Finding and Ethics Statement
During the 2009 H1N1 pandemic, human pH1N1 infection cases became obligatory notifiable by law in the Netherlands on 29 April 2009 (RIVM website. Available: www.rivm.nl/bibliotheek/rapporten/215011006.pdf. Accessed 2013 Mar 3.). A nationwide case definition was determined based on the European Union case definition [21] and contained clinical and epidemiological criteria upon which routine diagnostic testing was indicated and subsequent control measures could be applied. Diagnostic specimens were obtained from suspect cases by municipal health services, general practitioners or hospitals following influenza pandemic procedures from the National Institute of Public Health and the Environment (RIVM) responsible for the control of infectious diseases. In the region of Leiden, the first pandemic wave (weeks 27 through 35) inferred a normal (Gaussian) distribution of which the peak occurred in week 31 when 72% of positive patients were observed (Figure 1). All specimens included in this study were collected in the region of Leiden for routine influenza diagnostic testing following national pandemic procedures. The specimens were sent directly to the regional reference outbreak assistance laboratory accompanied by a written diagnostic request from the responsible phycisians and results were reported back to the medical facility who requested them. After performing routine influenza diagnostic testing, the reference outbreak assistance laboratory evaluated the additional presence of virulence and resistance markers for technical and epidemiological reasons. Additional influenza molecular characterization was not considered to be fully part of the initial diagnostic request, therefore all specimens were anonymized for precautionary reasons after receiving them from the requesting medical facilities and phycisians. There was no access to patient identifying information or clinical data during additional molecular characterization following ethical principles expressed in the Declaration of Helsinki. Approval from the institutional review board and the use of informed consents were not necessary for influenza diagnostic testing on specimens sent to the laboratory for this specific purpose.
Study Populations
Two study populations with pH1N1 infection are under evaluation in this study. Routine surveillance specimens were obtained from 344 suspect cases in the region of Leiden during the early phase of the 2009 H1N1 pandemic (June 29th through August 30th, 2009) and submitted to the regional reference outbreak assistance laboratory at Leiden University Medical Center. Influenza A virus was detected in 75 specimens (70 pH1N1, 4 seasonal H1N1, 1 seasonal H3N2). A total of 70 specimens from 70 patients with pH1N1 infection (43 male; median age 21 years, range 1 to 63 years) were included in this study. A second collection of 35 clinical antiviral resistance monitoring specimens was obtained from hospitalized immunocompromised patients with ≥14 days prolonged pH1N1 excretion (panH1 Ct values ≤ 37.0) during widespread pH1N1 circulation (November 3rd 2009 through Janurary 13th, 2010). Real-time PCR confirmed H275Y mutated virus in 19 of 35 specimens obtained from 3 of 4 immunocompromised patients and these results were compared to MSCSA and Sanger sequencing findings of the NA gene.
Influenza A Virus Detection and Molecular Typing
RNA was extracted from clinical specimens using the automated MagNA Pure nucleic acid isolation system (Roche Diagnostics, Almere, The Netherlands). Influenza A virus screening was performed by real-time PCR using InfA primers and a probe targeting the matrix gene and following procedures validated by the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC) as described previously (WHO website. Available: http://www.who.int/csr/resources/publications/swineflu/CDCrealtimeRTPCRprotocol_20090428.pdf. Accessed 2013 Mar 3.). The presence of pH1N1 was confirmed by PCR using panH1 and MexFluN1 protocols targeting the HA and NA genes [22], [23]. Influenza A virus specimens that were negative for pH1N1 were evaluated for seasonal influenza A (H1N1) and A (H3N2) viruses using H1-RF and H3-RF protocols targeting the HA gene [24] (WHO website. Available: http://www.who.int/csr/resources/publications/swineflu/WHO_Diagnostic_RecommendationsH1N1_20090521.pdf. Accessed 2013 Mar 3.).
MSCSA, Sanger Sequencing and H275Y Real-time PCR
MSCSA and Sanger sequencing were performed on all specimen collections containing influenza A virus, whereas H275Y real-time PCR was only carried out on the clinical antiviral resistance monitoring specimens after which H275Y positive findings were correlated to MSCSA and Sanger sequencing results. H275Y real-time PCR was performed as described previously [22]. MSCSA using the MassARRAY/iSEQ™ – Comparative Sequence Analysis technique (Sequenom, San Diego, USA) is based on the PCR amplification of a genomic target and in vitro transcription to produce RNA strands. These transcripts are cleaved to produce a sequence-specific set of fragments for analysis by mass spectrometry [20]. As the MSCSA protocol starts from DNA, a reverse transcription reaction using SuperScriptII (Invitrogen) with random primers (Promega; 1 μg final concentration; incubations at 25°C for 10 min, at 40°C for 90 min and 70°C for 15 min) was implemented prior to PCR amplification. We designed T7 promoter-tagged (CAGTAATACGACTCACTATAGGGAGAAGGCT) forward primers and SP6-tagged (CGATTTAGGTGACACTATAGAAGAGAGGCT) reverse primers for the specific amplification of NA, PB1-F2, PB2 and NS1 targets (Table 1). The pH1N1 primers were designed to cover potential markers of virulence (PB2 gene positions 271, 590, 591, 627, 701; PB1-F2 gene position 66; NS1 gene positions 227–230), protein segment truncation (PB1-F2 gene positions 12, 58, 88; NS1 gene position 220) and antiviral resistance (NA gene positions 116, 117, 119, 136, 150, 151, 199, 223, 275 and 295) in the viral genome (Table 2) [11]–[14], [25], [26]. PCR amplification of the targets was performed using 2 μl of RT product, with the tagged primers in 10 μl volume in 384 well plates as previously described [19]. The sample was processed by shrimp alkaline phosphatase treatment, in vitro transcription, and C- or U-specific RNaseA cleavage, according to the manufacturer’s instructions and using a MassARRAY Liquid Handler (Matrix+Fusio™ Chip Module, Sequenom). The fragments resulting from RNA cleavage were diluted in double-distilled water and desalted with Clean Resin (Sequenom), transferred to a SpectroCHIP array (Sequenom), and analyzed by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MassARRAY Compact Analyzer, Sequenom). Sanger sequencing was done on 2 μl of the PCR amplified products that were produced during the MSCSA procedure. Sanger sequencing reactions were performed in a volume of 10 μl using Big Dye terminator v 1.1 with sequencing buffer (Applied Biosystems) and 1 μM primer. The primers for Sanger sequencing were identical to the primers used for MSCSA (Table 1), but without the T7- and SP6-containing tails. Nucleotide sequence analysis was performed on an ABI Prism 3100 Genetic Analyser (Applied Biosystems).
Data Analysis
For MSCSA, the mass spectra of four amplicon transcript cleavage products per sample were matched against cleavage patterns calculated from an imported set of reference sequences [20]. The reference database was created by the authors and included a set of 193 NA gene, 67 PB2 gene, 210 NS1 gene and 53 PB1-F2 gene sequences imported from a resource database in September 2009 (PubMed website. Available: http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html. Accessed 2009 Sep 3.). Data processing was performed using iSEQ Software Version 1.0.0.2 to assemble amplicon sequences. MSCSA and Sanger sequences were aligned to influenza A/california/04/2009 (H1N1) and single nucleotide polymorphisms (SNPs) were defined as nucleotide variations to this reference sequence.
Results
MSCSA Primers and Amplicons
Primers utilized for MSCSA were specific for pH1N1 as they did not amplify seasonal influenza A(H1N1 or H3N2). Among 70 routine surveillance specimens, the primers amplified 265 of in total 280 amplicons (95%) including NA (63/70), PB1-F2 (65/70), PB2 (68/70) and NS1 genes (69/70). PCR amplification of PB1-F2, PB2 and NS1 genes only failed in specimens with low viral levels (mean InfA PCR Ct 36.2), whereas amplification was observed in specimens containing high viral levels (mean InfA PCR Ct 26.5). The amplification of the NA gene failed in 4 specimens with high viral levels (range Ct 22.3 to 28.1), suggesting that occasionally the primer sequence did not correspond to the actual viral sequence.
MSCSA and Sanger Sequencing of Routine Surveillance Specimens
Using the resource database in September 2009 as reference database for MSCSA, 99.9% of the total number of nucleotides (n = 130204) matched between both methods. A total of 93.6% (456/487) of all SNPs were identified by both methods (Table 3). More accurate results were obtained for the NA, PB2 and NS1 amplicons (93.2%, 98.7% and 90.1%, respectively) compared to the PB1-F2 amplicon (82.9%). In a small number of cases, a SNP detected by both methods could not be pinpointed to an exact position within an eleven nucleotide region by MSCSA (17/487, 3.5%). These inconclusive sequence data resulted in <0.1% uncertain nucleotide positions and were not considered as mismatches. A high degree of concordance was observed for the detection of SNPs via MSCSA and Sanger sequencing. The majority of SNPs (246/456) resulted in silent mutations and few SNPs (210/456) encoded for non-relevant amino acid substitutions in NA gene (V106I (n = 61), V203M (n = 1), N248D (n = 62), S286G (n = 1)), PB1-F2 gene (T34A (n = 1), V113A(n = 1)), PB2 gene (K660R (n = 2)) and NS1 gene segments (I123V (n = 61), N133D (n = 16), S135N (n = 1), G154R (n = 1), V194I (n = 1), D207N (n = 1)). The degree of discordance was limited (31/487 SNPs) and only 8 amino acid substitutions differed among the results generated by MSCSA and Sanger sequencing. We detected no mutations associated with increased virulence or with reversion of protein segment truncation by either method. All surveillance specimens had wild-type sequences in virulence markers (PB2 gene A271, S590, R591, E627, D701; PB1-F2 gene N66; NS1 gene G227, T228, E229 and I230) and stop codons in protein truncation markers (PB1-F2 stop12, stop58, stop88; NS1 gene stop220). MSCSA and Sanger sequencing detected no mutations associated with antiviral resistance (NA gene V116, I117, E119, Q136, K150, D151, D199, I223, H275 and N295).
Clinical Antiviral Resistance Monitoring Specimens
Oseltamivir resistant H275Y mutated virus was confirmed in 19 of 35 specimens clinical antiviral resistance monitoring specimens by H275Y real-time PCR and these findings were compared to MSCSA and Sanger sequencing results. MSCSA detected NA gene H275Y mutation in 4 of 19 samples (24%) while the mutation was observed in 17/19 samples by Sanger sequencing (89%). MSCSA detected NA gene H275Y mutation in specimens with fully mutant virus populations (4/4) but not in specimens with mixed wildtype and mutant populations (0/15). By visual evaluation of NA gene mass spectrometry spectra, the presence of peaks derived from the wild type sequence as well as from the H275Y-associated mutation were observed in many samples. In this way, we were able to infer the presence of H275Y minor populations in 14 pH1N1 samples, which led to a 95% correspondence between MSCSA and real-time PCR (18 of 19 samples).
Discussion
Molecular surveillance of human influenza viruses is important to monitor viral evolution. Genetic mutations occur frequently due to the lack of proofreading by the influenza virus RNA polymerase and may emerge during recurrent interspecies transmission or wide-scale antiviral selective pressure [1], [7], [14]–[17]. Rapid identification of relevant mutations associated with increased virulence or antiviral resistance during active surveillance of pH1N1 may guide early prevention and treatment strategies. MSCSA enables medium- to high-throughput genetic sequence analysis of amplified targets of genomic DNA or RNA with automated data analysis [20]. During the 2009 H1N1 pandemic, we evaluated influenza A-positive routine surveillance specimens for virulence or resistance markers using MSCSA and Sanger sequencing and included H275Y real-time PCR on clinical antiviral resistance monitoring specimens. MSCSA did not cover the complete pH1N1 genome since we chose to focus on gene segments (Table 2) that contain relevant virulence or resistance markers (with the exception of the HA gene) [11]–[14], [25], [26].
We observed a high concordance between MSCSA and Sanger sequencing (nucleotides >99%, SNPs 93.6%) in 70 routine surveillance specimens and detected 487 SNPs. Most SNPs encoded for silent mutations and few encoded for non-relevant amino acid changes compared to reference influenza A/california/04/2009 (H1N1) virus. The most frequently detected non-relevant amino acid changes in the NA gene (V106I (n = 61), N248D (n = 62)) and NS1 gene segments (I123V (n = 61), N133D (n = 16)) are well described by others [27]. Genetic mutations associated with increased virulence (PB2 gene positions 271, 590, 591, 627, 701; PB1-F2 gene position 66; NS1 gene positions 227–230), reversion of protein segment truncation (PB1-F2 gene positions 12, 58, 88; NS1 gene position 220) or antiviral resistance (NA gene positions V116, I117, E119, Q136, K150, D151, D199, I223, H275 and N295) were not detected by either method in routine surveillance specimens [11]–[14], [25], [26]. Amino acid replacement at residue S334 associated with increased oseltamivir resistance was not monitored in the NA amplicon. This is not of great concern because mutations at amino acid S334 can only increase oseltamivir resistance in the presence of H275Y mutation but does not lead to phenotypic antiviral resistance by itself [26]. Genetic sequences of pH1N1 circulating in the region of Leiden appeared genetically stable, similar to pH1N1 during the early phase of the 2009 H1N1 pandemic in Mexico and the United States [7]. MSCSA could not accurately pinpoint the exact position of a small number of SNPs in spite of the reference database. Relevant SNPs detected by MSCSA always need to be confirmed by Sanger sequencing, pyrosequencing or real-time PCR to limit potential misinterpretations during molecular surveillance. We emphasize that the reference database must be continuously updated with recent virus sequences for MSCSA to remain accurate. The MSCSA reference database has not been updated since the 2009 H1N1 pandemic, therefore newer versions of the reference database were not available to re-analyze the data.
Influenza reverse transcription-polymerase chain reaction/electro-spray ionization (RT-PCR/ESI-MS) assay is a similar mass spectrometry-based automated method which is capable of measuring amplicon-derived masses. The benefit of MSCSA over RT-PCR/ESI-MS is the possibility to analyze larger amplicon sizes (500–800 versus 150 nucleotides) and its capability to detect all nucleotide variations within the analyzed target region rather than providing genomic signatures [28], [29]. Some methods for antiviral resistance detection, like real-time PCR, are fast, but only allow for the analysis of fixed genome positions known to be involved in antiviral drug resistance.
In this study, a second collection of clinical antiviral resistance monitoring specimens was included and real-time PCR detected oseltamivir resistant H275Y mutated virus in 19 of 35 specimens obtained from 3 of 4 immunocompromised patients. We detected no other mutations that are associated with antiviral resistance including NA gene positions V116, I117, E119, Q136, K150, D151, D199, I223 and N295 [25], [26]. Previous influenza studies have shown that immunocompromised patients with prolonged viral excretion are at increased risk for developing neuraminidase inhibitor resistant virus during continued oseltamivir treatment [30], [31]. Frequent development of antiviral resistant viruses among 3 of 4 (75%) immunocompromised patients is in agreement with previous studies [32]–[34]. MSCSA detected H275Y in 24% (4/19) of positive specimens and Sanger sequencing in 89% (17/19). MSCSA only detected H275Y when the mutation was dominant in the analyzed specimens. The ability to infer the presence of H275Y (18 of 19 samples) by visual evaluation of the mass spectrometry spectra indicated that iSEQ software improvement may result in improved detection of minor variants in mixed populations. However, pyrosequencing and real-time PCR currently remain the designated methods for continued antiviral resistance monitoring in clinical settings [22], [25].
In conclusion, MSCSA may be used as a rapid screening tool to monitor fixed nucleotide changes and potential virulence markers in the pH1N1 genetic background. MSCSA does not seem applicable for continued antiviral resistance monitoring in the clinical setting since detection of the H275Y mutation was limited by a very low sensitivity in the presence of minor variants and mixed genotypes.
Acknowledgments
We thank Eric Snijder (Molecular Virology Laboratory) for valuable assistance and advice. Dennis Kremer, Bas Heijmans, and Eline Slagboom (Department of Molecular Epidemiology) provided valuable MS-based sequencing support.
Author Contributions
Conceived and designed the experiments: JG CCP. Performed the experiments: JCZD ECJC. Analyzed the data: JG JCZD ECJC CCP. Contributed reagents/materials/analysis tools: JCZD ECJC CCP. Wrote the paper: JG CCP. Conception and design of the work: JG ACMK CCP. Revised manuscript critically for intellectual content: JG ECJC ACMK CCP.
References
- 1. Ghedin E, Sengamalay NA, Shumway M, Zaborsky J, Feldblyum T, et al. (2005) Large-scale sequencing of human influenza reveals the dynamic nature of viral genome evolution. Nature 437: 1162–6.
- 2. Wise HM, Foeglein A, Sun J, Dalton RM, Patel S, et al. (2009) A complicated message: Identification of a novel PB1-related protein translated from influenza A virus segment 2 mRNA. J Virol 2009 83: 8021–31.
- 3. Jagger BW, Wise HM, Kash JC, Walters KA, Wills NM, et al. (2012) An overlapping protein-coding region in influenza A virus segment 3 modulates the host response. Science 337: 199–204.
- 4. Kilbourne ED (2006) Influenza pandemics of the 20th century. Emerg Infect Dis 12: 9–14.
- 5. Centers for Disease Control and Prevention (CDC) (2009) Outbreak of swine-origin influenza A (H1N1) virus infection - Mexico, March-April 2009. MMWR Morb Mortal Wkly Rep 58: 467–70.
- 6. Writing Committee of the WHO Consultation on Clinical Aspects of Pandemic (H1N1) 2009 Influenza, Bautista E, Chotpitayasunondh T, Gao Z, Harper SA, et al (2010) Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection. N Engl J Med 362: 1708–19.
- 7. WHO Collaborating Center for Influenza, Centers for Disease Control and Prevention (CDC), Atlanta, GA 30333, USA (2009) Antigenic and genetic characteristics of swine-origin 2009 A(H1N1) influenza viruses circulating in humans. Science 325: 197–201.
- 8.
World Health Organization website. Pandemic (H1N1) 2009-update 112 (2010) Available: http://www.who.int/entity/csr/don/2010_08_06/en/index.html.Accessed 2013 Mar 3.
- 9. Hancock K, Veguilla V, Lu X, Zhong W, Butler EN, et al. (2009) Cross-reactive antibody responses to the 2009 pandemic H1N1 influenza virus. N Engl J Med 361: 1945–52.
- 10. Tu W, Mao H, Zheng J, Liu Y, Chiu SS, et al. (2010) Cytotoxic T lymphocytes established by seasonal human influenza cross-react against 2009 pandemic H1N1 influenza virus. J Virol 84: 6527–35.
- 11. Neumann G, Noda T, Kawaoka Y (2009) Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 459: 931–9.
- 12. McAuley JL, Chipuk JE, Boyd KL, Van De Velde N, Green DR, et al. (2010) PB1-F2 proteins from H5N1 and 20 century pandemic influenza viruses cause immunopathology. PLoS Pathog 6: e1001014.
- 13. Liu Q, Qiao C, Marjuki H, Bawa B, Ma J, et al. (2012) Combination of PB2 271A and SR polymorphism at positions 590/591 is critical for viral replication and virulence of swine influenza virus in cultured cells and in vivo. J Virol 86: 1233–7.
- 14. Ozawa M, Basnet S, Burley LM, Neumann G, Hatta M, et al. (2011) Impact of amino acid mutations in PB2, PB1-F2, and NS1 on the replication and pathogenicity of pandemic (H1N1) 2009 influenza viruses. J Virol 85: 4596–601.
- 15. Yamada S, Hatta M, Staker BL, Watanabe S, Imai M, et al. (2010) Biological and structural characterization of a host-adapting amino acid in influenza virus. PLoS Pathog 6: e1001034.
- 16. Octaviani CP, Li C, Noda T, Kawaoka Y (2011) Reassortment between seasonal and swine-origin H1N1 influenza viruses generates viruses with enhanced growth capability in cell culture. Virus Res 156: 147–50.
- 17. Moore C, Galiano M, Lackenby A, Abdelrahman T, Barnes R, et al. (2011) Evidence of person-to-person transmission of oseltamivir-resistant pandemic influenza A(H1N1) 2009 virus in a hematology unit. J Infect Dis 203: 18–24.
- 18. Seibert CW, Kaminski M, Philipp J, Rubbenstroth D, Albrecht RA, et al. (2010) Oseltamivir-resistant variants of the 2009 pandemic H1N1 influenza A virus are not attenuated in the guinea pig and ferret transmission models. J Virol 84: 11219–26.
- 19. Posthuma CC, van der Beek MT, van der Blij-de Brouwer CS, van der Heiden PL, Marijt EW, et al. (2011) Mass spectrometry-based comparative sequencing to detect ganciclovir resistance in the UL97 gene of human cytomegalovirus. J Clin Virol 51: 25–30.
- 20. Honisch C, Chen Y, Mortimer C, Arnold C, Schmidt O, et al. (2007) Automated comparative sequence analysis by base-specific cleavage and mass spectrometry for nucleic acid-based microbial typing. Proc Natl Acad Sci U S A 104: 10649–54.
- 21.
European Commission. Commission Decision of 30 April 2009 amending Decision 2002/253/EC laying down case definitions for reporting communicable diseases to the Community network under Decision No 2119/98/EC of the European Parliament and of the Council. Official Journal of the European Union. L 110/58. 1.5.2009. Available: http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2009:110:0058:0059:EN:PDF. Accessed 2013 Mar 3.
- 22. van der Vries E, Jonges M, Herfst S, Maaskant J, Van der Linden A, et al. (2010) Evaluation of a rapid molecular algorithm for detection of pandemic influenza A (H1N1) 2009 virus and screening for a key oseltamivir resistance (H275Y) substitution in neuraminidase. J Clin Virol 47: 34–7.
- 23. Meijer A, Beerens A, Claas E, Hermans M, de Jong A, et al. (2009) Preparing the outbreak assistance laboratory network in the Netherlands for the detection of the influenza virus A(H1N1) variant. J Clin Virol 45: 179–84.
- 24. Rahamat-Langendoen JC, Tutuhatunewa ED, Schölvinck EH, Hak E, Koopmans M, et al. (2012) Influenza in the immediate post-pandemic era: a comparison with seasonal and pandemic influenza in hospitalized patients. J Clin Virol 54: 135–40.
- 25. Deyde VM, Sheu TG, Trujillo AA, Okomo-Adhiambo M, Garten R, et al. (2010) Detection of molecular markers of drug resistance in 2009 pandemic influenza A (H1N1) viruses by pyrosequencing. Antimicrob Agents Chemother 54: 1102–10.
- 26. Pizzorno A, Bouhy X, Abed Y, Boivin G (2011) Generation and characterization of recombinant pandemic influenza A(H1N1) viruses resistant to neuraminidase inhibitors. J Infect Dis 203: 25–31.
- 27. Pascalis H, Temmam S, Wilkinson DA, Dsouli N, Turpin M, et al. (2012) Molecular evolutionary analysis of pH1N1 2009 influenza virus in Reunion Island, South West Indian Ocean region: a cohort study. PLoS One 7: e43742.
- 28. Deyde VM, Sampath R, Garten RJ, Blair PJ, Myers CA, et al. (2010) Genomic signature-based identification of influenza A viruses using RT-PCR/electro-spray ionization mass spectrometry (ESI-MS) technology. PLoS One 5: e13293.
- 29. Jeng K, Massire C, Zembower TR, Deyde VM, Gubareva LV, et al. (2012) Monitoring seasonal influenza A evolution: rapid 2009 pandemic H1N1 surveillance with an reverse transcription-polymerase chain reaction/electro-spray ionization mass spectrometry assay. J Clin Virol 54: 332–6.
- 30. Gooskens J, Jonges M, Claas EC, Meijer A, Kroes AC (2009) Prolonged influenza virus infection during lymphocytopenia and frequent detection of drug-resistant viruses. J Infect Dis 199: 1435–41.
- 31. Carr S, Ilyushina NA, Franks J, Adderson EE, Caniza M, et al. (2011) Oseltamivir-resistant influenza A and B viruses pre- and postantiviral therapy in children and young adults with cancer. Pediatr Infect Dis J 30: 284–8.
- 32.
Harvala H, Gunson R, Simmonds P, Hardie A, Bennett S, et al.. (2010) The emergence of oseltamivir-resistant pandemic influenza A (H1N1) 2009 virus amongst hospitalised immunocompromised patients in Scotland, November-December, 2009. Euro Surveill 15: pii: 19536.
- 33. Tramontana AR, George B, Hurt AC, Doyle JS, Langan K, et al. (2010) Oseltamivir resistance in adult oncology and hematology patients infected with pandemic (H1N1) 2009 virus, Australia. Emerg Infect Dis 16: 1068–75.
- 34. Renaud C, Boudreault AA, Kuypers J, Lofy KH, Corey L, et al. (2011) H275Y mutant pandemic (H1N1) 2009 virus in immunocompromised patients. Emerg Infect Dis 17: 653–60.