Figures
Abstract
Calcium Binding Proteins (CaBPs), part of the vast family of EF-Hand-domain containing proteins, modulate intracellular calcium levels. They thereby contribute to a broad spectrum of biological processes – amongst others cell migration, gene expression and neural activity. In this study we identified twelve members of this protein family in zebrafish including one gene (cabp4b) currently not present in the zebrafish genome assembly. To gain insight into their biological functions, we carried out a detailed analysis of the expression patterns of these genes during zebrafish late embryonic and early larval development. We detected specific transcription for most of them in different neuronal cell populations including the neuroretina, the inner ear and the notochord. Our data supports potential roles for CaBPs during neuronal development and function and provides a starting point for genetic studies to examine CaBPs' function in these tissues and organs.
Citation: Di Donato V, Auer TO, Duroure K, Del Bene F (2013) Characterization of the Calcium Binding Protein Family in Zebrafish. PLoS ONE 8(1): e53299. https://doi.org/10.1371/journal.pone.0053299
Editor: Ferenc Mueller, University of Birmingham, United Kingdom
Received: August 2, 2012; Accepted: November 30, 2012; Published: January 16, 2013
Copyright: © 2013 Di Donato et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the ATIP/AVENIR program from CNRS/INSERM and an EC-IRG reintegration grant to FDB. VDD was supported by a Leonardo a scholarship of the Leonardo da Vinci project Unipharma-Graduates. TOA was supported by a Boeringer-Ingelheim Fonds Ph.D. fellowship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: Filippo Del Bene is currently an academic editor for PLOS ONE. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials.
Introduction
Calcium signaling is a fundamental process required for communication between neurons [1]. A local and rapid increase in calcium concentration within the pre- and postsynaptic specialization is required for transmission of information throughout the nervous system. The massive influx of calcium into the postsynaptic neuron triggers the activation of specific gene expression programs leading to long-term or short-term synaptic alterations [2], [3].
Since calcium-dependent gene transcription is involved in the control of crucial processes such as synapse development, maturation and refinement, it must be strictly regulated [4].
A broad spectrum of calcium sensing proteins acts as buffer for intracellular calcium, modulating and restricting the spatial and temporal impact of calcium as a second messenger. This gives these proteins a central role as regulators of the signaling pathways triggered or promoted by calcium.
Calcium binding typically elicits a conformational switch in the sensor. This switch leads to various interactions with downstream effectors and ultimately modulates neuronal activity [5]. For instance, the calcium binding protein Calmodulin (CaM) has been shown to bind the intracellular domain of the L-type voltage sensitive calcium channel and, upon calcium influx, to activate Ras/MAP Kinase signaling thus triggering gene transcription in the nucleus [6].
In mammals, the Calmodulin (CaM) superfamily, characterized by an EF-hand calcium binding motif, forms the largest class of calcium sensing proteins [7]. A related subfamily, the Calcium Binding Proteins (CaBPs) share a very similar domain organization with CaM and have been shown to have coevolved in vertebrate animals [8]. In humans the Calcium Binding Protein family is composed of six members: CaBP1, 2, 4, 5, 7 and 8. While the cabp6 gene has not been identified, cabp3 is most probably a pseudogene [9]. Cabp7 and cabp8 were alternatively referred to as calneuron2 and calneuron1 respectively in earlier studies [10], [11] and form a separate sub-family based on their sequence characteristics.
The expression pattern of single members of the CaBP family has been analyzed in human and mouse tissues (for a summary see Table 1.) but the localisation of the majority of them remains unknown. Furthermore, a few functional studies have been carried out, showing the involvement of CaBPs in the physiology of neural circuits. For example, cabp4 and 5 were observed to be expressed in the retina where the respective proteins play a role in the modulation of visual stimuli, most likely by their interaction with voltage-gated Calcium channels [12] [13]. The specific expression of other Calcium binding proteins has been observed to be connected to a precise function [14] in their respective expression domains.
In the following study we describe the expression patterns of all known Calcium binding proteins during the first five days of zebrafish development. We furthermore identified a new member of this gene family, cabp4b that is not part of the actual Zv.9 genome assembly.
Results
Phylogenetic analysis
To identify all Calcium binding protein family members in zebrafish we used the Ensembl orthology prediction tool. Based on their human orthologs we found two zebrafish paralogs for each gene (except cabp4). This is consistent with the commonly accepted theory that all teleosts underwent one additional round of whole genome duplication in evolution [15]. Surprisingly compared with the other 4 teleosts (medaka, takifugu, tetraodon, stickleback) zebrafish seemed to be the only species with just one paralog of cabp4. To identify a potential second zebrafish paralog for this gene we searched the NCBI expressed sequence tag collection for a suitable cDNA clone using the Tetraodon cabp4 (2of2) cDNA sequence as bait. As the best hit, with 77% sequence identity, we identified a cDNA clone from a zebrafish retina cDNA library. This sequence was not present in the current Zv.9 assembly. When we aligned the cDNA clone with all other zebrafish cabps cDNA sequences it displayed the highest degree of conservation to cabp4a (data not shown). Using specific primers against the identified cDNA clone (IMAGE:4145466) sequence, we were able to amplify a 530 bp fragment from wild type Tupfel long fin cDNA. The online protein domain prediction tool Prosite from ExPasy assigned two EF-Hand domains to the unknown gene (Fig. 1C). Based on these results, we decided to call this cDNA clone cabp4b.
A) The phylogenetic tree of all human and zebrafish Calcium binding protein family members based on protein sequence. For all members there exist two paralogs in zebrafish per human paralog. Cabp7 and calneuron (cabp8) form a separate subfamily (brown shading). B) Domain structure of CaBP4b as predicted by ExPasy (www.expasy.org). C) Protein alignment of the two EF domains of the human CaBP4 protein, the known zebrafish ortholog (cabp4a) and its newly discovered paralog (cabp4b). The blue color represents the Blosum62 score; high similarities are in dark blue while lower similarities are indicated in light blue. The first EF-Hand domain shows a higher degree of conservation than the second one.
We subsequently calculated a phylogenetic tree based on the protein sequences of all H. sapiens and D. rerio Calcium binding proteins (for details see Material and Methods). As previously described [10] cabp7s and cabp8s (calneurons) form a separate subfamily (Fig. 1). Cabp4 is closest related to this subtree followed by cabp5. Furthermore, both zebrafish cabp5 and cabp2 paralogs show a closer relationship to the zebrafish cabp2 paralogs than to their human orthologs.
In situ expression analysis
In order to determine the spatial distribution of calcium binding protein mRNA, we performed whole mount in situ hybridisation analyses with specific antisense probes.
CaBP1s
The expression pattern at different stages of development for both cabp1a and cabp1b is consistent with the data reported in the ZFIN website [16]. At 48hpf cabp1a exhibits a broad expression throughout the developing brain (Fig. 2, A–D) with additional expression in the notochord and the heart. 72hpf the staining of the antisense probe is restricted to the inner half of the inner nuclear layer (INL) of the retina (Fig. 2, A′–D′). To determine the precise neuronal type showing cabp1a expression we employed the zebrafish transgenic line Tg(Ptf1a:GFP) [17] (pancreas transcription factor 1 a) that has been shown to label the two inhibitory neuronal types (horizontal and amacrine cells) of the retina. Thereby, we were able to indicate amacrine cells as the most likely cabp1a-expressing population (compare Fig. 2 F–H). This observation is consistent with previous data by Wu et al. [10] where mRNA of the mouse cabp1 ortholog was detected in amacrine cells of the mouse retina.
(A–D′) mRNA expression of cabp1a in lateral (A–A′) and dorsal (B,B′) views of a 2dpf and 4dpf zebrafish embryo with higher magnifications (C–D,C′–D′). (E–H). Cross-sections of retinae in the Tg(Ptf1a:GFP) transgenic line show staining of cabp1a in the amacrine cell layer.(E) Epifluorescence picture of a sectioned retina. Scale bar: 50 µm (F–H) Confocal images of the area selected in E. (F) In situ signal in bright field, (G) GFP signal restricted to amacrine cells, (H) DAPI nuclear stain. Scale bar: 20 µm. HR: heart, NC: notochord, ACL: amacrine cell layer.
When the whole mount staining pattern of cabp1b was investigated, we could detect at 48hpf, a strong staining in the otic vesicles and along the notochord (Fig. 3, A–D). At 5dpf the strong expression of cabp1b in the notochord was maintained with an additional expression domain in the amacrine cells layer of the retina (Fig. 3, A′–D′). Comparison of cabp1b antisense probe signal with GFP in the Tg(Ptf1a:GFP) line strongly suggests expression in this cell type (Fig. 3, E–H).
(A–D′) Expression in 2dpf (A–D) and 5dpf (A′–D′) zebrafish embryos: lateral (A,C–A′,C′) and dorsal (B,D–B′,D′) views. At 2dpf a signal in the otic vesicles and the notochord can be detected. At 5dpf expression in the notochord and the amacrine cell layer of the retina is seen. (E–H). Cross-sections of retinae in the Tg(Ptf1a:GFP) transgenic line show staining of cabp1b in the amacrine cell layer.(E) Epifluorescence picture of a sectioned retina. Scale bar: 50 µm (F–H) Confocal images of the area selected in E. (F) In situ signal in bright field, (G) GFP signal restricted to amacrine cells, (H) DAPI nuclear stain. Scale bar: 20 µm. OV: otic vesicle, NC: notochord, ACL: amacrine cell layer.
CaBP2s
Whole mount RNA expression analyses of cabp2a revealed no specific signal at early developmental stages. At 72hpf we could detect prominent expression in the retina and in the notochord (Fig. 4, A–D). To further clarify the identity of cabp2a expressing cells in the retinal tissue, we used the zebrafish transgenic line Tg(Vsx2:GFP) [18]. Vsx2, a homeodomain transcription factor, is initially expressed throughout the retinal epithelium, but is later enriched in a minor population of bipolar cells in the outer part of the INL. Localisation of GFP and the in situ signal (Fig. 4, E–H) show that cabp2a is expressed in the bipolar cells of the retina consistent with specific mRNA distribution of the mouse ortholog cabp2 in the mouse retina and minor retinal component in other species [9].
(A–D) In situ hybridisation showing expression of cabp2a in 5dpf larvae. Lateral views (A,C) , dorsal views (B, D). Cabp2a antisense probe exhibits diffuse retinal localisation; a strong staining is also present along the notochord. (E–H) Cross-section of a retina in the Tg(Vsx2:GFP) transgenic line. (E) Epifluorescence image of a sectioned retina, showing prominent expression of cabp2a in the bipolar cell layer. Scale bar: 50 µm. (F–H) Confocal images of the area selected in E. (F) In situ signal in bright field, (G) GFP signal localized in bipolar cells, (H) DAPI. Scale bar: 20 µm (I) Cross-section exhibiting in situ staining in the notochord. Scale bar: 100 µm. INL: inner nuclear layer, NC: notochord.
For cabp2b, both, the inner ear and neuromasts in the lateral line exhibit strong staining from 72hpf onwards (Fig. 5). The localisation in hair cells of both sensory organs was further supported by analyzing the expression in the Tg(Brn3C:memGFP) transgenic line [19]. In this line the GFP signal can be observed in a subset of retinal ganglion cells, hair cells of the inner ear and the lateral line neuromasts.
(A–D) In situ hybridisation signal of cabp2b in 3dpf zebrafish embryos. Lateral (A) and dorsal (B) views of the embryo with higher magnification (C–D). Staining is restricted to hair cells in the inner ear and to the neuromasts. (F) View of stained neuromasts in the lateral line and (E) higher magnification of the selected area; arrowheads in E show the neuromasts. (G–L) Transverse section of the ear in the Tg(Brn3C:memGFP) transgenic line. (L) Epifluorescence image, showing strong expression of cabp2b in a subset of cells in the inner ear. Scale bar: 100 µm. (G) Higher magnification picture. (H–I) Confocal images. (H) DAPI signal, (I) GFP staining in the same domain as cabp2b. Scale bar: 20 µm. Nm: neuromast, IE: inner ear.
CaBP4s
During the first five days of development no mRNA of the cabp4a gene could be detected. Similarly, the newly discovered cabp4b was not detected in any tissue within the first 72 hours post fertilization. Importantly, from day 4 onwards, a strong staining in the photoreceptor layer became visible (Fig. 6). This specific pattern of expression has also been described in mammals where cabp4 was shown to play a crucial role in photoreceptor physiology [12]. The impairment of cabp4 function triggers severe defects of vision like autosomal recessive night blindness [20].
(A–D) In situ localisation of cabp4b transcript in 5dpf larvae. Lateral (A–C) and dorsal views (B–D). A strong staining in the photoreceptor layer is detected. (E–F) Cross section of a retina (E) with zoom in to the photoreceptor layer (F). Scale bar: 20 µm. Pr: photoreceptors.
CaBP5s
Endogenous cabp5a mRNA shows no expression in all the stages of development analyzed, while for adult eye tissue there was EST evidence reported [21]. For cabp5b, from 48hpf onwards, the expression pattern is consistent with the profile shown by Thisse et al., 200416: the otic vesicles display a very prominent labeling, which is maintained in later stages (Fig. 7). In addition, in 5dpf larvae a strong signal is detectable in the retinal inner nuclear layer and in the notochord (Fig. 7, A′–D′). To identify the cabp5b-expressing cells, we assayed whole-mount in situ hybridisation in the zebrafish transgenic lines Tg(Vsx2:GFP) and Tg(Brn3C:memGFP). In the Vsx2 transgenic line we see expression of GFP and cabp5b in the inner nuclear layer of the retina, in what are most probably bipolar cells. On the contrary, brn3C and cabp5b expressing cells in the ear represent distinct populations. Interestingly, for mouse cabp5, a role in rod to bipolar cell signaling was proposed by Rieke et al. [13]. Upon loss of cabp5 function, the rod-mediated responses of retinal ganglion cells were reduced which might reflect a change in the presynaptic function of rod bipolar cells.
(A–D′) Cabp5b expression in 2dpf (A–D) and 5dpf (A′–D′) zebrafish embryos: lateral (A,C–A′,C′) and dorsal (B,D–B′,D′) views. An intense staining is present in the inner ear and in the notochord at both stages of development. In 5dpf embryos, in addition, a strong signal is detectable in the retinal inner nuclear layer. (E–H) Sections of the ear in Tg(Brn3C:memGFP) transgenic line embryos. Epifluorescence image of a sectioned ear (E) and confocal images (F–H) showing strong expression of cabp5b in a subset of cells in the inner ear. Picture in bright field (F), DAPI (G), GFP (H). Scale bar: 20 µm. (I–L) Cross-sections of a retina in the Tg(Vsx2:eGFP) transgenic line. Epifluorescence image of a sectioned retina (I) and magnification (J), showing cabp5b antisense probe signal in the bipolar cell layer. Scale bar: 50 µm. (K–L) Confocal images. GFP signal localized in bipolar cells (K), DAPI (L). Scale bar: 20 µm. Ov: otic vesicle, IE: inner ear, INL: inner nuclear layer.
CaBP7s
Homolog to human calcium binding protein 7 (ENSG00000100314, also known as Calneuron2), the two zebrafish genes cabp7a (annotated as cabp7 2of2, ENSDARG00000078272) and cabp7b (annotated as cabp7b, ENSDARG00000060846) were analyzed for their spatio-temporal expression pattern. cabp7a showed widespread expression throughout the brain from day 3 onwards with a prominent labeling detected in the dorsal thalamus region, as well as at the level of the cerebellar plate (Fig. 8). For cabp7b, the observed expression was more restricted to the midbrain and the hindbrain area anterior to the medulla oblongata (Fig. 9). Some regions, such as the migrated posterior tubercular area, the nucleus of medial longitudinal fascicle and the reticular formation, revealed a prominent staining. No expression in the dorsal parts of the brain such as optic tectum and cerebellum could be detected (Fig. 9, E, F).
(A–D) mRNA expression of cabp7a in lateral (A) and dorsal (B) views of 3dpf larvae with higher magnification (C–D). The signal of cabp7a antisense probe is widespread in the brain, with a stronger staining detected in the regions of the dorsal thalamus and the cerebellar plate. (E) Transverse section at the level of the eye, exhibiting diffuse expression of cabp7a in the developing brain. Scale bar: 100 µm. CeP: cerebellar plate; DT: dorsal thalamus; Hr: rostral hypothalamus; M2: migrated posterior tubercular area; MO: medulla oblongata; PTv: ventral part of posterior tuberculum; T: midbrain tegmentum; TeO: tectum opticum.
(A–D) In situ localisation of cabp7b transcript in 5dpf larvae. Lateral (A,C) and dorsal views (B, D). A wide distribution of cabp7b mRNA in the brain was observed. (E,F) Transverse sections. Strongly stained cells are present in the midbrain, probably in the region of the nucleus of medial longitudinal fascicle (E) and in the hindbrain area anterior to the medulla oblongata most likely at the level of the reticular formation(F). Scale bar: 50 µm. M2: migrated posterior tubercular area; MO: medulla oblongata; N: nucleus of medial longitudinal fascicle; RF: reticular formation; T: midbrain tegmentum; TeO: tectum opticum.
CaBP8s
Calcium binding protein 8, also known as calneuron1, has the two homologs caln1 and caln2 in zebrafish. Both of them are characterized by an early onset (between 24hpf and 48hpf) of expression (Fig. 10, A–D, Fig. 11, A–D). In 48hpf embryos, caln1 exhibits a specific in situ hybridisation pattern, restricted to a population of primary sensory neurons - most probably Rohon Beard cells (Fig. 10, A–D). Analysis at later stages, 4dpf, reveals expression of caln1 predominantly extending from the telencephalic pallial domain to the ventral thalamus region (Fig. 10, A′–D′). In addition, caln2 is detected in 4dpf embryos in what is most probably the head of the pronephric ducts. The expression pattern observed for caln2 seems to overlap with that of caln1 at later stages - a very localized staining is detectable at 48hpf in the subpallial region and in the caudal midbrain (Fig. 11, A–D). Caln1 and 2 are also detected in a subset of retinal ganglion cells – in the case of caln2 localized at the center of the ganglion cell layer (Fig. 11, E).
(A–D′) In situ signal of caln1 transcript in 2dpf (A–D) and 4dpf (A′–D′) larvae. Lateral (A,C–A′,C′) and dorsal views (B,D–B′D′). (E) Higher magnification shows specific staining in the dorsal spinal cord probably in Rohon Beard cells. (A′–D′) 4dpf whole mount embryos show diffuse signal in the brain and a specific expression in what is most probably the head of the pronephric ducts. (F) A transverse section through the retina shows expression in the retinal ganglion cell layer. Scale bar: 50 µm. SC neurons: spinal cord neurons, P: pallium; DT: dorsal thalamus; PD: pronephric duct; GCL: ganglion cell layer.
(A–D′) mRNA expression of caln2 in lateral (A,C–A′,C′) and dorsal (B,D–B′D′) views of 2dpf (A–D) and 4dpf (A′–D′) larvae with zoom in (C,D–C′,D′). The onset of caln1 expression takes place within the first two days of embryonic development. (A–D) At 2dpf the caln1 transcript localizes to the forebrain at the level of the subpallial region and in the caudal midbrain. (A-‘D’) The same expression profile seems to be maintained until day 4 of development. (E) Transverse section of the retina showing signal of caln1 antisense probe in a subset of retinal ganglion cells in the central part of the ganglion cell layer. Strongly stained cells are present in the region of the telencephalic pallial domain (F). Scale bar: 50 µm. P: pallium; DT: dorsal thalamus; T: midbrain tegmentum; GCL: ganglion cell layer; Sd: dorsal division of subpallium; Sv: ventral division of subpallium.
Discussion
Our work indicates that Calcium Binding Protein family members show very specific expression patterns in the course of zebrafish embryonic and larval development. Comparing our data with the published literature in mouse we observe a consistent conservation of most expression domains between the mammalian and the teleost clade (Table 1). In addition, we detected expression of cabp2b and cabp5b in hair cells of the inner ear, that has not been previously described in mice, and the neuromasts of the lateral line.
As a consequence of the extra genome duplication in teleosts, the two zebrafish orthologs either showed distinct expression patterns (i. g. cabp2a and cabp2b) or expression could not be detected for one of the two paralogs (i. g. cabp1a and cabp1b). The separate expression domains of the two paralogs suggest a possible subfunctionalization during teleost evolution [22]. This remarkable feature of the zebrafish system and its amenability to genetic manipulation will allow a detailed dissection of CaBP function in the different neuronal subpopulations where they are expressed.
In addition, we identified a new member of the cabp family, cabp4b, that is not part of the current zebrafish genome assembly. In humans, this gene has been related to different retinal pathologies such as the congenital cone–rod synaptic disorder and autosomal recessive night blindness.
Therefore, our findings open up the possibility to further dissect the molecular mechanisms underlying the pathology in humans using zebrafish as a model organism.
Materials and Methods
Ethic statements
All fish are housed in the fish facility of our laboratory, which was built according to the local animal welfare standards. All animal procedures were performed in accordance with French and European Union animal welfare guidelines.
Gene identification
Calcium binding protein members in Danio rerio were identified based on orthology predictions in Ensembl using the Zv9 (GCA_000002035.2) assembly. To confirm gene identities we performed multispecies alignments within the 5 teleost species O. latipes, T. rubipres, G. aculeatus, T. nigroviridis and D. rerio and used the following genes: cabp1a (ENSDARG00000033411), cabp1b (ENSDARG00000019990), cabp2a (ENSDARG00000052016), cabp2b (ENSDARG00000052277), cabp4a (ENSDARG00000008866), cabp5a (ENSDARG00000002576), cabp5b (ENSDARG00000028485), cabp7a (ENSDARG00000060846), cabp7b (ENSDARG00000078272), caln1 (cabp8a) (ENSDARG00000088898), caln2 (cabp8b) (ENSDARG00000069766).
In the case of cabp4 there was just one ortholog annotated in the zebrafish Zv9 assembly. As there were two paralogs present in all other teleost fish species we used the cDNA sequence of cabp4 (2of2) (ENSTNIG00000005250) of Tetraodon and performed a BlastN search against the EST selection of NCBI. As a result we found a cDNA clone (BG307419, fm03g10.y1, IMAGE:4145466) that showed 77% sequence similarity to the Tetraodon sequence and named it cabp4b.
Phylogenetic analysis
The protein sequences of Danio rerio and Homo sapiens CaBPs were obtained from Ensembl. For cabp7b, there was no annotated start codon and we were not able to identify a suitable translational start in the genomic upstream sequence. For cabp4a neither start nor stop codon were annotated. By including the flanking genomic region in the search for an ORF, both could potentially be identified upstream and downstream of the annotated gene. For the newly identified cabp4b the whole sequence given as BG307419 was used and translated in frame +1. Alignment of the sequences was produced using MUSCLE online at the European Bioinformatics Insitute (EBI) [23]. The result of the algorithm was visualized using Jalview [24]. A phylogenetic tree was assembled using BioNJ online at phylogeny.fr performing 1000 bootstraps and using the Jones-Taylor-Thornton matrix. This distance-based algorithm is claimed to be well suited for comparison of sequences with high substitution rates [25], [26]. The tree was visualized using the open source software Dendroscope [27]. To identify the functional domains within the cabp4b ORF we used the ExPASy Prosite database from the Swiss Institute of Bioinformatics (SIB, www.expasy.org).
Fish husbandry and strains used
Breeding and raising of zebrafish followed standard protocols [28]. Zebrafish embryos were treated with 0.0045% 1-Phenyl-2-Thiourea (PTU) in medium after gastrulation to prevent pigment formation. For one color whole mount in situ hybridisation Tupfel long fin fish were used. The transgenic Tg(Vsx2:GFP) [18] and Tg(Ptf1A:GFP) [17] lines were a kind gift of Lucia Poggi and Jochen Wittbrodt; the Tg(Brn3C:memGFP) [19] line was obtained from Herwig Baier.
Molecular cloning
For generating an anti-sense probe for cabp1a, we ordered the clone IRBOp991H0750D from Imagenes. Subsequently, the coding fragment was cloned into the pBluescript KS vector (Invitrogen). Following linearization of the plasmid with HindIII and DNA clean-up, a Digoxigenin (DIG)-labeled antisense probe was generated using T7 RNA polymerase. Following DNaseI treatment, the synthesized probe was purified using the NucleoSpin® RNA II Kit (Macherey-Nagel).
The same procedure was applied for the synthesis of the anti-sense probes of cabp2a (IMAGp998N1115278Q(2)); into pAMP1, linearization with KpnI, transcription with SP6 polymerase; cabp2b (IMAGp998G1716318Q); into pBluescript Sk-, linearization with EcoRV, transcription with T7 polymerase; cabp4a (IMAGp998D0510667Q(4)); into pBluescript Sk-, linearization with BamHI/NotI, transcription with T7 polymerase; cabp5a (IRBOp991H021D); into pBluescript Sk-, linearization with NcoI, transcription with T7 polymerase; cabp5b (IMAGp998E2112463Q(5+3)b) into pAMP1, linearization with EcoRI, transcription with SP6 polymerase. For cabp1b, cabp4b, cabp7a, cabp8a and cabp8b, cDNA fragments were PCR amplified from zebrafish total cDNA using the following primers (5′prime to 3′prime): CaBP1b_fwd: CTATGGGAAACTGTGTTAAATCGCCGC; CaBP1b-rev: TTATCTCTAGCGAGACATCATTCGCAC; CaBP4b_fwd: CATCCACGATACACCATGGCAC; CaBP4b_rev: TCCACAGAGATCTTCCCATCGC; CaBP7a_fwd: AAGTGGAGGAGATCCGTGAAGC; CaBP7a_rev: ATCAAGCTCTTTCGCACACAGG; CaBP8a_fwd: AAGGAGATGAGGGGCTAGGGAG; CaBP8a_rev: CACACACGTCTGACGGTTCTTC; CaBP8b_fwd: GGAGCGAGCTTTTCACCTGATG; CaBP8b_rev: TGGTGAGATGGTCTCTGAAGGC. PCR fragments were cloned into the pCRII-TOPO vector (Invitrogen) according to manufacturers' instructions. All plasmids used were confirmed by sequencing.
In situ hybridisation
In vitro transcription of Digoxigenin-labeled probes was performed using the RNA Labeling Kit (Roche Diagnostics Corporation) according to manufacturer's instructions. Dechorionated embryos at the appropriate developmental stage(s) were fixed in 4% paraformaldehyde in 1× phosphate buffered saline (pH 7.4) for 2 h at room temperature and whole-mount in situ hybridisation was performed as previously described [29].
Antibody staining
After in situ hybridisation staining, whole mount zebrafish embryos from Tg(Vsx2:GFP), Tg(Brn3C:memGFP) and Tg(Ptf1a:GFP) transgenic lines were washed twice in 1× PBS/0.1% Tween-20 solution. Subsequently, they were incubated 1 h at room temperature in 10% Normal Goat Serum (Invitrogen), 1% DMSO in PBS-Tw blocking solution followed by overnight incubation with 1/1000 dilution of chicken primary anti-GFP antibody (Genetex). The Alexa Fluor 488 secondary antibody goat anti-chicken IgG (1/500, Molecular probes) and a 1/500 dilution of DAPI (50 µg/µL) in blocking solution were added overnight. After 5× washing in wash buffer (1× PBS/0.1% Tween-20) microscopy analysis was performed.
Vibratome sections and confocal microscopy
After staining, whole-mount embryos were washed twice in 0,1% Tween in PBS 1×. Afterwards, the samples were embedded in gelatin/albumin with 4% of Glutaraldehyde and sectioned (20 µm) on a VT1000 S vibrating blade microtome (Leica). The sections were analyzed on a Leica Upright Widefield epifluorescence microscope and a Zeiss LSM710 confocal microscope (Zeiss). Images were processed using ImageJ, Adobe Photoshop and Adobe Illustrator software.
Acknowledgments
We thank E. Restrepo for sharing preliminary results and W. Norton, Ch. Gebhardt and S. Weiss for their advice and comments on the manuscript. A special thank to L.Poggi and J. Wittbrodt that kindly provided the Tg(Vsx2:GFP) [18] and Tg(Ptf1A:GFP) [17] zebrafish transgenic lines and H. Baier for the Tg(Brn3C:memGFP) line. We thank Olivier and Armelle for excellent fish husbandry.
Author Contributions
Conceived and designed the experiments: VDD TOA FDB. Performed the experiments: VDD TOA KD. Analyzed the data: VDD TOA FDB. Wrote the paper: VDD TOA FDB.
References
- 1. Berridge MJ (1998) Neuronal calcium signaling. Neuron 21: 13–26.
- 2. Catterall WA, Few AP (2008) Calcium channel regulation and presynaptic plasticity. Neuron 59: 882–901.
- 3. Mochida S, Few AP, Scheuer T, Catterall WA (2008) Regulation of presynaptic Ca(V)2.1 channels by Ca2+ sensor proteins mediates short-term synaptic plasticity. Neuron 57: 210–216.
- 4. Greer PL, Greenberg ME (2008) From synapse to nucleus: calcium-dependent gene transcription in the control of synapse development and function. Neuron 59: 846–860.
- 5. McCue HV, Haynes LP, Burgoyne RD (2010) The diversity of calcium sensor proteins in the regulation of neuronal function. Cold Spring Harb Perspect Biol 2: a004085.
- 6. Dolmetsch RE, Pajvani U, Fife K, Spotts JM, Greenberg ME (2001) Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway. Science 294: 333–339.
- 7. Kawasaki H, Nakayama S, Kretsinger RH (1998) Classification and evolution of EF-hand proteins. Biometals 11: 277–295.
- 8. McCue HV, Haynes LP, Burgoyne RD (2010) Bioinformatic analysis of CaBP/calneuron proteins reveals a family of highly conserved vertebrate Ca2+-binding proteins. BMC Res Notes 3: 118.
- 9. Haeseleer F, Sokal I, Verlinde CL, Erdjument-Bromage H, Tempst P, et al. (2000) Five members of a novel Ca(2+)-binding protein (CABP) subfamily with similarity to calmodulin. J Biol Chem 275: 1247–1260.
- 10. Wu YQ, Lin X, Liu CM, Jamrich M, Shaffer LG (2001) Identification of a human brain-specific gene, calneuron 1, a new member of the calmodulin superfamily. Mol Genet Metab 72: 343–350.
- 11. Mikhaylova M, Sharma Y, Reissner C, Nagel F, Aravind P, et al. (2006) Neuronal Ca2+ signaling via caldendrin and calneurons. Biochim Biophys Acta 1763: 1229–1237.
- 12. Haeseleer F, Imanishi Y, Maeda T, Possin DE, Maeda A, et al. (2004) Essential role of Ca2+-binding protein 4, a Cav1.4 channel regulator, in photoreceptor synaptic function. Nat Neurosci 7: 1079–1087.
- 13. Rieke F, Lee A, Haeseleer F (2008) Characterization of Ca2+-binding protein 5 knockout mouse retina. Invest Ophthalmol Vis Sci 49: 5126–5135.
- 14. Haynes LP, McCue HV, Burgoyne RD (2012) Evolution and functional diversity of the Calcium Binding Proteins (CaBPs). Front Mol Neurosci 5: 9.
- 15. Wittbrodt JMA, Scharti M (1998) More genes in fish? BioEssays 20: 511–515.
- 16. Sprague J, Bayraktaroglu L, Clements D, Conlin T, Fashena D, et al. (2006) The Zebrafish Information Network: the zebrafish model organism database. Nucleic Acids Res 34: D581–585.
- 17. Jusuf PR, Harris WA (2009) Ptf1a is expressed transiently in all types of amacrine cells in the embryonic zebrafish retina. Neural Dev 4: 34.
- 18. Vitorino M, Jusuf PR, Maurus D, Kimura Y, Higashijima S, et al. (2009) Vsx2 in the zebrafish retina: restricted lineages through derepression. Neural Dev 4: 14.
- 19. Xiao T, Roeser T, Staub W, Baier H (2005) A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development 132: 2955–2967.
- 20. Zeitz C, Kloeckener-Gruissem B, Forster U, Kohl S, Magyar I, et al. (2006) Mutations in CABP4, the gene encoding the Ca2+-binding protein 4, cause autosomal recessive night blindness. Am J Hum Genet 79: 657–667.
- 21. Vihtelic TS, Fadool JM, Gao J, Thornton KA, Hyde DR, et al. (2005) Expressed sequence tag analysis of zebrafish eye tissues for NEIBank. Mol Vis 11: 1083–1100.
- 22. Force A, Lynch M, Pickett FB, Amores A, Yan YL, et al. (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 1531–1545.
- 23. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797.
- 24. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ (2009) Jalview Version 2–a multiple sequence alignment editor and analysis workbench. Bioinformatics 25: 1189–1191.
- 25. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, et al. (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36: W465–469.
- 26. Gascuel O (1997) BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol Biol Evol 14: 685–695.
- 27. Huson DH, Richter DC, Rausch C, Dezulian T, Franz M, et al. (2007) Dendroscope: An interactive viewer for large phylogenetic trees. BMC Bioinformatics 8: 460.
- 28.
Westerfield M The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). Univ of Oregon Press, Eugene 4th ed.
- 29. Thisse C, Thisse B (2008) High-resolution in situ hybridisation to whole-mount zebrafish embryos. Nat Protoc 3: 59–69.