BBS inducing drought tolerance in cucumber plants

After withholding watering for 13 days, the leaves of BBS-treated cucumber plants displayed much darker green and lighter wilt symptoms (i.e. still being able to rehydrate at night or in an early morning) than those of control plants, which were unable to rehydrate at night or in an early morning (Figure 1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. BBS inducing drought tolerance in cucumber plants.

The cell suspension of BBS and sterile water were poured on the soil around cucumber roots in the BBS treatment (BBS) and the control (CK), respectively, and then watering was withheld for 13 days.

https://doi.org/10.1371/journal.pone.0052565.g001

It is known that the imposition of drought on plants leads to enhanced membrane peroxidation in leaf tissues, thus increasing the leaf MDA content and relative electrical conductivity. Therefore, we determined the leaf MDA content and relative electrical conductivity in cucumber plants. Under drought stress the leaf MDA content and relative electrical conductivity in BBS-treated cucumber plants were 3.2×10⁻³ µmol/g and 57.0%, respectively, which decreased by 38.5% (Figure 2A) and 14.9% (Figure 2B), respectively, compared with their counterparts in control plants.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Effects of BBS on physiological indicators of cucumber drought tolerance.

The cell suspension of BBS and sterile water were poured on the soil around cucumber roots in the BBS treatment (BBS) and the control (CK), respectively, and then watering was withheld for 13 days. The leaf MDA content (A), the leaf relative electrical conductivity (B), and the leaf proline content (C), the root recovery intension (D), and the leaf chlorophyll content (E) of cucumber plants under drought stress were determined at 13 dpi. Each treatment was replicated three times; data are presented as means of three replicates ± SD, and error bars represent SD for three replicates. Means with different letters have significant differences (p<0.05; LSD test).

https://doi.org/10.1371/journal.pone.0052565.g002

Increasing leaf proline content is crucial for maintaining the osmotic potential of leaf tissues, which plays an important role in protecting them from over-dehydration under drought stress. The application of BBS resulted in a remarkable 3.4-fold increase in the leaf proline content in cucumber plants compared with the control (1.33 µmol/g vs. 0.30 µmol/g) (Figure 2C). Furthermore, as a reliable and sensitive indicator of plant drought tolerance, the root recovery intension significantly increased by 45.5% in BBS-treated cucumber plants (Figure 2D) in relation to that in control plants.

BBS maintaining leaf chlorophyll content and transcriptional levels of rbcS and rbcL

In order to examine the impact of BBS on the photosynthetic efficiency of cucumber plants exposed to water deficit stress, we first determined the leaf chlorophyll content in cucumber plants. The contents of leaf chlorophylls a, b, and a+b in BBS-treated cucumber plants increased by 25.9%, 31.5%, and 27.4%, respectively, in comparison with their counterparts in control plants (Figure 2E), which suggested that BBS maintained chlorophyll contents in cucumber leaves under drought stress. This was consistent with the above observation that BBS-treated cucumber plants had much darker green leaves than control plants (Figure 1).

It is well known that Rubisco, a bifunctional enzyme located in the chloroplast stoma, catalyzes photosynthetic CO₂ fixation to form ribulose-1,5-bisphosphate (RuBP) [38]; therefore, the transcriptional levels of the rbcS and rbcL genes in cucumber leaves may indicate their photosynthetic efficiency. We analyzed the transcriptional patterns of the two genes in cucumber leaves under drought conditions. While the transcriptional level of the rbcS gene gradually declined along with extending time of water deprivation in both the BBS and control treatment, it was down-regulated to a smaller extent in the BBS treatment than in the control (Figure 3A, B). Specifically, although the rbcL transcription was down-regulated sharply at 5 dpi, it was robust at 7 dpi and still detected at 11 and 13 dpi in the BBS treatment, but undetected since 9 dpi in the control (Figure 3A, B), indicating that the rbcL transcription was stronger in the BBS treatment than that in the control over 7–13 dpi. This demonstrated that BBS maintained the transcriptional levels of rbcS and rbcL genes in cucumber leaves under aggravated drought stress.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Effects of BBS on the expression of the rbcS, rbcL, and cAPX genes.

The cell suspension of BBS and sterile water were poured on the soil around cucumber roots in the BBS treatment (BBS) and the control (CK), respectively, and then watering was withheld for 13 days. A, The expression of the genes rbcS, rbcL and cAPX was detected at 0, 5, 7, 9, 11, and 13 dpi by RT-PCR. B, Relative mRNA levels of genes based on Quality One software of Bio-Rad. Each treatment was replicated three times. dpi, day post inoculation; Actin, internal reference.

https://doi.org/10.1371/journal.pone.0052565.g003

Effects of BBS on SOD, POD, and CAT activities; and on cAPX expression

It has been well established that drought stress promotes the production of oxygen free radicals in plants, which, however, can be scavenged and detoxified by plant enzymatic- and non-enzymatic systems to protect it from oxidative damage. We investigated the impact of BBS on the corresponding enzymatic system of cucumber plants in response to drought stress by determining the leaf SOD, POD, and CAT activities. As shown in Figure 4A, the application of BBS led to a substantial increase in the leaf SOD activity over 0–9 dpi, which peaked at 9 dpi (1533.17 U/mg) and then sharply fell until 11 dpi, but its counterpart in the control remained low over the entire time course 0–13 dpi. This demonstrated that BBS significantly stimulated the leaf SOD activity in cucumber plants under drought stress.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Effects of BBS on SOD, POD, and CAT activities.

The cell suspension of BBS and sterile water were poured on the soil around cucumber roots in the BBS treatment (BBS) and the control (CK), respectively, and then watering was withheld for 13 days. The leaf SOD, POD, and CAT activities in cucumber plants under drought stress were determined at 0, 5, 7, 9, 11, and 13 dpi. Each treatment was replicated three times; data are presented as means of three replicates ± SD, and error bars represent SD for three replicates. (p<0.05; LSD test).

https://doi.org/10.1371/journal.pone.0052565.g004

However, over 0–13 dpi, the leaf POD activity in BBS-treated cucumber plants fluctuated between 26.30 and 96.18 U/mg, while its counterpart in control plants exhibited an overall increasing trend by peaking at 292.94 U/mg at 11 dpi (Figure 4 B). CAT is another enzyme to scavenge H₂O₂. The leaf CAT activity in the BBS treatment firstly decreased, then continuously increased over 5–11 dpi, and finally dropped sharply to 14.74 U/mg at 13 dpi, which was higher at 9 and 11 dpi; but lower at 5, 7, and 13 dpi compared to the counterpart in the control (Figure 4C). Thus, overall, the BBS treatment did not enhance the CAT activity compared to the control. Besides, the expression of the gene cAPX encoding cytosolic ascorbate peroxidase, another H₂O₂ scavenging enzyme, was examined at the same set of time points in the BBS and control treatments. The two treatments were found to be similar in the fashion of the cAPX transcription over 0–7 dpi, which was slightly enhanced at 5 dpi and then noticeably lessened at 7 dpi; however, over 9–13 dpi, its level kept increasing and almost recovered to the initial level at 13 dpi in the BBS treatment, but substantially dropped at 11 dpi following an increase at 9 dpi and remained relatively low at 13 dpi in the control (Figure 3A, B). This demonstrated that BBS maintained cAPX transcriptional levels in cucumber plants in response to extending time of water deprivation.

All three BBS constituent strains containing no ACC deaminase

We detected the activity of ACC deaminase in all three BBS constituent strains, Bacillus cereus AR156 (AR156), Bacillus subtilis SM21 (SM21), and Serratia sp. XY21 (XY21), to investigate whether they confer IST to drought stress in cucumber plants by producing ACC deaminase to degrade the ethylene precursor ACC. As a result, the activity of ACC deaminase was undetected in all these strains, but detected in the known ACC deaminase-containing strain Burkholderia sp. 5BS21 (5BS21) (Figure 5). Correspondingly, homologous genes of ACC deaminase were undetected in AR156, SM21 and XY21 genome through PCR (data not showed). These implicated that BBS-elicited IST to drought stress in cucumber plants did not involve the action of ACC deaminase to lower ethylene levels in cucumber plants.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Detection of ACC deaminase activity in three BBS constituent strains and Burkholderia sp. 5BS21.

After grown in MSA medium with ACC (ACC+) or without ACC (ACC−) for 48 h, bacterial cells of Burkholderia sp. 5BS21 (5BS21) and of the three BBS constituent strains Bacillus cereus AR156 (AR156), Bacillus subtilis SM21 (SM21), Serratia sp. XY21 (XY21) were centrifuged at 14000× g for 5 min. Then 5 µL of the supernatant resulting from each culture was spotted on a TLC silica gel plate with 5 µL of MSA medium with ACC (ACC+) and 5 µL of that without ACC (ACC−) as controls. The gel was developed for 2.5 h and then stained with 0.5% ninhydrin for 20 min in an attemperator set at 100°C.

https://doi.org/10.1371/journal.pone.0052565.g005

Bacterial strains, plants, and drought stress treatments

Bacterial cells of the PGPR strains Bacillus cereus AR156, Bacillus subtilis SM21, and Serratia sp. XY21 were separately grown in Luria-Berta (LB) medium (10 g L⁻¹ tryptone, 5 g L⁻¹ yeast extract, 10 g L⁻¹ NaCl; pH 7.0–7.2) at 28°C with vigorous shaking at 280 r/min for 24 h. Subsequently, bacterial cells were pelleted by centrifugation, washed once with and resuspended in a sterile 0.85% NaCl solution, and adjusted to 5×10⁸ CFU mL⁻¹ for use. BBS was prepared by mixing the three bacterial cell suspensions in a ratio of 1∶1∶1 (vol/vol/vol). Besides, Burkholderia sp. 5BS21 was isolated from the rhizosphere soil of banana in Zhuhai City of Guangdong Province, China, by our team.

Cucumber (Cucumis sativus L. ‘Jinyou No. 1’) seeds were sown in plastic trays filled with the soil of northeast phaeozem of China, rich of humus, which was bought from Jilin province, China; after germination cucumber seedlings were grown in a growth chamber. Fifteen days after sowing, seedlings were transplanted into plastic pots (355.46 cm³ of volume) in one seedling per pot; the seedling in each pot was irrigated every other day with 30 mL of water to maintain an optimal moisture level. Cucumber plants were grown in a greenhouse maintained at day/night temperature of 25°C/18°C with 600 µmol photons m⁻² s⁻¹ of light supplied for 12 h during the daytime. The soil used in the research was all sterilized in 121°C for 1 h, and it repeated three times.

Fifteen days after transplantation seedlings were subjected to the BBS and control treatments in 24 seedlings per treatment. In the BBS treatment 20 mL of BBS cell suspension at 5×10⁸ CFU mL⁻¹ was poured on the soil around the roots of the seedling in each pot, and then watering was withheld. Each control seedling was treated as described above except for replacing the BBS cell suspension with an equal volume of sterile water. In a preliminary experiment of drought stress treatment, all cucumber plants showed moderate drought stress symptoms (cucumber leaves no longer rehydrated at night or in an early morning) after withholding watering for 13 days. Therefore, specific physiological indicators of drought tolerance in BBS-treated and control cucumber plants were measured 13 days post inoculation (dpi) as described below.

Determination of MDA content, relative electrical conductivity, proline content, root vigor, and chlorophyll content

The leaf MDA content was determined at 13 dpi according to the method described by Qiu et al. [7]. Three leaf tissue samples were collected from each treatment; each sample of 0.3 g fresh weight (FW) was homogenized in 5 mL of 5% trichloroacetic acid (TCA), and the homogenate was then centrifuged for 15 min at 8000× g. One milliliter of the resultant supernatant of each sample was mixed with 2.5 mL of thiobarbituric acid (TBA), and the mixture was heated at 100°C in a water bath for 20 min and then immediately cooled on ice. The mixture was subsequently centrifuged at 10000×g for 5 min, and the absorbance of the resulting supernatant was measured at 532 nm and 600 nm. By subtracting the non-specific absorbance at 600 nm, the MDA content in cucumber leaves was determined by its molar extinction coefficient (155 mM⁻¹ cm⁻¹) and expressed as µmol MDA g⁻¹ FW.

The relative electrical conductivity in cucumber leaves was measured at 13 dpi using the method of Yang et al. [52] with minor modifications. First, three leaf samples were collected from each treatment; and then each sample of 0.1 g FW was minced, placed into a cuvette, and mixed with 10 mL of distilled water. After the mixture was incubated in a calorstat set at 32°C for 2 h, its initial electronic conductivity (S1) was measured. Next, the mixture was boiled at 100°C for 30 min and then cooled to room temperature (25°C) to determine its final electric conductivity (S2). Distilled water was used as the blank control, whose electronic conductivity (S0) was measured. The relative electric conductivity (REC) was evaluated using the formula: REC = (S1−S0)/(S2−S0)×100.

The free proline content in cucumber leaves was determined at 13 dpi according to the method of Dobrá et al. [53] with minor modifications. Three leaf samples were collected from each treatment, and each sample of 0.2 g FW was homogenized in 10 mL of 3% aqueous sulfosalicylic acid. After the homogenate was filtered through a piece of filter paper, 1 mL of filtrate was mixed with 1 mL of acid-ninhydrin reagent and 1 mL of glacial acetic acid in a test tube, and then the mixture was heated at 100°C for 1 h. The reaction was terminated by placing the test tube in an ice bath. Subsequently, 5 mL of toluene was added into the test tube, which was then vigorously shaken by hand for 10–15 s and finally incubated at room temperature for 20 min. The absorbance of the upper layer of the mixture containing toluene was measured at 520 nm, with toluene as a blank control.

Root vigor is a reliable and sensitive indicator to evaluate drought tolerance, and it reflects water and nutrition absorbing abilities of drought stressed plants. It was measured according to the triphenyltetrazolium chloride (TTC) method and showed as root recovery intension [54]. Three samples of white young roots were collected from each treatment. Each sample of 0.5 g FW was placed into a test tube and mixed with 5 mL of 0.4% TTC and 5 mL of phosphate buffer (0.06 mol L⁻¹, pH 7.0). After the mixture was incubated at 37°C for 3 h, the chemical reaction was terminated by adding 2 mL of 1 mol L⁻¹ sulfuric acid into the tube. The roots were subsequently transferred to a mortal containing 3–4 mL of ethyl acetate and a little quartz sand, and ground with a pestle. The liquid phase was transferred to a test tube, to which ethyl acetate was added to bring the total volume of the mixture to 10 mL, and then its OD values were measured at 485 nm with a UV-vis recording spectrophotometer (UV1000 Spectrophotometer) for calculating equivalent triphenyl formazan (TTF) concentrations according to the TTC standard curve generated in this experiment. The root activity was determined for per gram (FW) of a root sample using the following formula:

The contents of leaf chlorophylls a, b, and a+b were determined at 13 dpi using the method of Ashraf et al. [55]. Three leaf samples were collected from each treatment, and each sample of 0.2 g FW was cut into 0.5 cm segments and extracted overnight with 80% acetone at −10°C. The mixture was centrifuged at 14000× g for 5 min, and the absorbance of the resulting supernatant was measured at 645 and 663 nm using a spectrophotometer (Hitachi-220). The contents of leaf chlorophylls a, b and a+b were calculated according to the following formulas:

Enzyme assays

The activities of SOD, POD, and CAT in cucumber leaves were assayed according to the method of Qiu et al. [7]. Three leaf samples were collected from each treatment at 0, 5, 7, 9, 11, and 13 dpi; and each sample of 0.2 g FW was placed into a mortar with 2 mL of 50 mM ice-cold phosphate buffer (pH 7.8) containing 1 mM ethylene diamine tetraacetic acid (EDTA) and homogenized with a pestle. The homogenate was centrifuged at 15000× g for 15 min at 4°C. The supernatant was an enzyme extract containing SOD, POD, and CAT, which was used in the following enzyme assays performed at 4°C.

The leaf SOD activity was determined on the basis of its effectiveness in inhibiting the photoreduction of nitro blue tetrazolium (NBT). Upon the addition of riboflavin into a test tube containing 3 mL reaction mixture [50 mM phosphate buffer (pH 7.8), 0.1 mM EDTA, 130 mM methionine, 0.75 mM NBT, 0.02 mM riboflavin, and 0.1 mL of the enzyme extract], the tube was illuminated with two 20 W fluorescent lamps, which lasted for 10 min. Non-illuminated and illuminated reactions without the enzyme extract served as calibration standards. The absorbance values of the reaction mixture and the blank control were measured at 560 nm with a UV1000 Spectrophotometer. One unit of SOD activity (U) was defined as the amount of enzyme required to cause 50% inhibition of the NBT photoreduction rate, and the results were expressed as U mg⁻¹ of FW. The leaf SOD activity was calculated according to the following formula:

The leaf POD activity was determined based on the oxidation of guaiacol using hydrogen peroxide. The reaction was initiated by adding 20 µL of the enzyme extract to 3 mL of reaction mixture consisting of 100 mM phosphate buffer (pH 7.0), 20 µL of guaiacol solution, and 10 µL of hydrogen peroxide solution. The absorbance was measured at 470 nm at time points of reaction initiation and 5 min later with a UV1000 Spectrophotometer. Enzyme activity was quantified based on the variation of absorbance per minute using the extinction coefficient (26.6 mM⁻¹ cm⁻¹) according to the following formula:

The leaf CAT activity was determined based on the decrease in H₂O₂ levels. The reaction mixture (3 mL) consisted of 100 mM phosphate buffer (pH 7.0), 0.1 µM EDTA, 0.1% H₂O₂, and 0.1 mL of enzyme extract. The reaction was initiated by adding the enzyme extract to the reaction mixture. The decrease in H₂O₂ levels was determined by measuring the absorbance at 240 nm with a UV1000 Spectrophotometer, and quantified by using extinction coefficient (36 M⁻¹ cm⁻¹). The leaf CAT activity was calculated using the following formula:

Analysis of gene expression by RT-PCR

To analyze the expression patterns of the genes cAPX (D88649.1), rbcL (EF208123.1), and rbcS (EF208124.1), cucumber leaf samples were collected at 0, 5, 7, 9, 11, 13 dpi. RT-PCR was performed according to the manufacturer's instructions of PrimeScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa, Japan). Total RNA was extracted from each sample using TRIzol® reagent (Invitrogen, USA). Using the Oligo dT Primer, first-strand cDNAs were synthesized from 1000 ng of total RNA. Independent PCR with 25 cycles was performed using aliquots (1 µL) of cDNA samples. A constitutively expressing gene Actin (AB010922.1) was used as a quantitative control in the RT-PCR analysis. Primer Premier 5.00 was employed to design specific primer pairs of cAPX (forward primer: TTGTTGCTGTTGAGGTTA, reverse primer: TGAGAGGGTTGGTAGTCC), of rbcL (forward primer: ATCTTGGCAGCATTCCGAGTA, reverse primer: CCCAATAGAGGGCGACCAT), and of rbcS (forward primer: ACAGGTCACCAGGATACTACGA, reverse primer: CCTCAAGAAAGCCTCAGCA).

Relative mRNA levels of genes were analyzed based on densitometry values obtained using the Quality One software of Bio-Rad.

Detection of ACC deaminase

The PGPR strains AR156, SM21, XY21, and 5BS21 were examined for the production of ACC deaminase according to the method of Chen et al. [56] with minor modifications as described below. After grown in MSA medium [2 g L⁻¹ NaNO₃, 1.2 g L⁻¹ K₂HPO₄, 0.5 g L⁻¹ MgSO₄, 0.5 g L⁻¹ KCl, 0.14 g L⁻¹ KH₂PO₄, 0.01 g L⁻¹ Fe₂(SO₄)₃·H₂O, 0.1 g L⁻¹ yeast extract paste, 15 g L⁻¹ agar; pH 7.2] with ACC (0.5 g L⁻¹) (ACC+) and that without ACC (ACC−) at 28°C with shaking at 120 r/min for 48 h, bacterial cells of each strain were centrifuged at 14000× g for 5 min. Five microliters of the supernatant resulting from each culture was spotted on a thin layer chromatography (TLC) silica gel plate, with the same volume of MSA medium with ACC (ACC+) and that without ACC (ACC−) as controls. The TLC plate was subsequently immersed in a developing solution consisting of n-butyl alcohol, acetic acid, and distilled water in the ratio of 15∶1∶2 (vol/vol/vol). After developed for 2.5 h, the silica gel was stained with 0.5% ninhydrin for 20 min in an attemperator set at 100°C. After staining, ACC deaminase-containing bacterium was indicated by the disappearance of khaki on the silica gel plate.

Statistical analysis

Data of physiological indexes associated with drought tolerance and of antioxidase activities were analyzed statistically at factorial level by means of variance analysis (ANOVA), and their significance levels (p<0.05 or p<0.01) were determined using the statistical software data processing system (DPS version 7.05).