Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Baicalin Downregulates Porphyromonas gingivalis Lipopolysaccharide-Upregulated IL-6 and IL-8 Expression in Human Oral Keratinocytes by Negative Regulation of TLR Signaling

  • Wei Luo,

    Affiliation Faculty of Dentistry, The University of Hong Kong, Hong Kong SAR, China

    ⨯
  • Cun-Yu Wang,

    Affiliation University of California Los Angeles, School of Dentistry, Los Angeles, California, United States of America

    ⨯
  • Lijian Jin

    ljjin@hkucc.hku.hk

    Affiliation Faculty of Dentistry, The University of Hong Kong, Hong Kong SAR, China

    ⨯

Abstract

Periodontal (gum) disease is one of the main global oral health burdens and severe periodontal disease (periodontitis) is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS) is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs). Cells were pre-treated with baicalin (0–80 µM) for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB), p38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR) signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling.

Citation: Luo W, Wang C-Y, Jin L (2012) Baicalin Downregulates Porphyromonas gingivalis Lipopolysaccharide-Upregulated IL-6 and IL-8 Expression in Human Oral Keratinocytes by Negative Regulation of TLR Signaling. PLoS ONE 7(12): e51008. https://doi.org/10.1371/journal.pone.0051008

Editor: Anne Wertheimer, University of Arizona, United States of America

Received: March 27, 2012; Accepted: October 31, 2012; Published: December 11, 2012

Copyright: © 2012 Luo et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was supported by the Hong Kong Research Grants Council (HKU766909M and HKU768411M to LJJ), and the Modern Dental Laboratory/HKU Endowment Fund to LJJ. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Periodontal disease is one of the main global oral health burdens and severe periodontal disease (periodontitis) is a major cause of tooth loss in adults globally [1]. Emerging evidence shows that it also increases the risk of some life-threating diseases like cardiovascular disease and diabetes mellitus [2]–[4]. Periodontitis is characterized by bacteria-induced, uncontrolled inflammatory destruction of tooth-supporting tissues and alveolar bone in susceptible individuals [5]. Porphyromonas gingivalis is a major periodontal pathogen and its lipopolysaccharide (LPS) is one of the key virulent attributes that significantly contributes to periodontal pathogenesis [6], [7]. It can stimulate the host to produce a variety of pro-inflammatory cytokines like IL-6 and IL-8, thereby involving in the initiation and progression of periodontal disease [8]–[10].

Toll-like receptors (TLRs) are a family of pattern recognition receptors (PRRs) that recognize microbial components and mediate the activation of host response [11]. Microbial LPS utilizes TLR4 to activate nuclear factor-κB (NF-κB), p38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK), leading to the production of pro-inflammatory cytokines [11]. This process requires an initial recruitment of myeloid differentiation primary-response protein 88 (MyD88) to TLR4 [12]–[14]. In addition, there exists a TLR4-mediated MyD88-independent pathway that recruits toll/interleukin-1 receptor (TIR) domain-containing adaptor inducing interferon-β (TRIF) instead of recruitment of MyD88 to TLR4 in response to LPS, thereby activating the expression of interferon (IFN)-β and IFN-inducible genes like chemokine (C-X-C motif) ligand 10 (CXCL10) [15]–[18]. LPS is a TLR4 ligand and P. gingivalis LPS interacts with TLR4 to activate host response [19]–[21]. Nevertheless, it has been reported that P. gingivalis LPS could interact with TLR2 as well [22]–[24], due to the heterogeneity in lipid A structure of P. gingivalis LPS [8], [25], [26], and/or the contamination of LPS with some bioactive molecules like phosphorylated lipids and lipoproteins [27]–[29].

Recently, host modulatory therapy (HMT) has been proposed as a promising adjunct to conventional periodontal treatment [30], [31]. Some examples of HMT in treatment of periodontitis include subantimicrobial dose of doxycycline, lipoxins and resolvin E1 [32]–[34]. Scutellariae radix is an herb that has been used to treat inflammatory diseases in traditional Chinese medicine (TCM) since ancient times [35]. Baicalin is a flavonoid isolated from Scutellaria radix and it can suppress IL-8-induced metalloproteinase-8 (MMP-8) expression in human neutrophils [36]. In periodontal research, it has recently been shown that baicalin enables to inhibit the transcription of receptor activator of NF-κB ligand (RANKL) in human periodontal ligament cells, and reduces the loss of bone and collagens in rat models of periodontitis [37], [38]. Furthermore, baicalin may inhibit IL-1β-induced MMP-1 expression and stimulate collagen-I production in human periodontal ligament cells [39].

In the present study, we found that baicalin significantly downregulated P. gingivalis LPS-upregulated expression of IL-6 and IL-8. Baicalin also inhibited P. gingivalis LPS-induced activation of NF-κB, p38 MAPK and JNK proteins, and markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling, such as chemokine (C-C motif) ligand 2 (CCL2), granulocyte colony-stimulating factor (G-CSF or CSF3) and CXCL10.

Materials and Methods

Cell Culture

HOKs isolated from normal human oral mucosa (Sciencell, CA, USA) were cultured according to the manufacturer's instructions. Prior to cell culture, culture vessels were coated with poly-L-lysine (Sigma, MO, USA) at 2 µg/cm2 at 37°C for 1 h. Cells were seeded at 5000 cells/cm2 with the oral keratinocyte medium (Sciencell). The incubation condition was set at 37°C with an atmosphere of 5% CO2 and 95% air. The medium was changed every two days for the first four days and daily thereafter until a monolayer was formed.

Preparation of P. gingivalis LPS and Baicalin

Lyophilized LPS from P. gingivalis with type II fimA (strain code TDC60) was kindly provided by Prof. Y. Abiko (Nihon University, Japan). The LPS was prepared using the hot phenol water method [40], [41]. It was reconstituted in Dulbecco's phosphate-buffered saline (DPBS) to a concentration of 1.0 mg/ml, followed by filtration through a 0.2 µm cellulose acetate membrane filter (Millipore, MA, USA). Baicalin powder (solvent extracted with a purity >95% as tested by HPLC) was obtained from the Hong Kong Jockey Club Institute of Chinese Medicine, Hong Kong. It was dissolved in pure dimethyl sulfoxide (DMSO) (Sigma), and then diluted in DPBS to 1.0 mM and finally filtered for sterilization. Working solutions were made with fresh oral keratinocyte medium on the experiment day.

Total RNA Extraction and cDNA Synthesis

Total RNA was extracted using the RNeasy mini kit (Qiagen, CA, USA). Briefly, cells were lysed with the buffer RLT, and the lysate was applied to an RNeasy Mini spin column. After several rounds of washes using the buffer RW1 and RPE, total RNA was bound to the column and other cell components were efficiently washed away. At the end, total RNA was eluted in RNase-free water. To avoid the contamination of genomic DNA, on-column DNase digestion was performed during RNA purification. The concentration of purified RNA was quantified by measuring its 260 nm UV absorbance on a NanoDrop spectrophotometer (Thermo, MA, USA). The integrity of purified RNA was evaluated by checking the ratio of 28 S rRNA and 18 S rRNA bands on an agarose gel. cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen). In brief, 1.0 µg of total RNA was pre-incubated with the gDNA Wipeout Buffer at 42°C for 2 min to remove any residual genomic DNA. The mixture was then incubated with the Quantiscript Reverse Transcriptase, Quantiscript RT Buffer and RT Primer Mix at 42°C for 30 min, followed by a termination step at 95°C for 5 min.

Real-time Polymerase Chain Reaction (PCR)

Each real-time PCR reaction mix contained 10.0 µl of the QuantiFast SYBR green master mix (Qiagen), 1.0 µl of cDNA template (5.0 ng), 1.0 µl of forward primer (10 µM), 1.0 µl of reverse primer (10 µM) and 7.0 µl of ultra-pure water. The reaction condition was set as follows: an initial activation at 95°C for 5 min, followed by 40 cycles at 95°C for 10 s and 60°C for 30 s. The primer sequences were: for IL-6, 5′-AATCATCACTGGTCTTTTGGAG (forward), 5′-GCATTTGTGGTTGGGTCA (reverse); and for IL-8, 5′-GACATACTCCAAACCTTTCCACC (forward), 5′- AACTTCTCCACAACCCTCTGC (reverse); for β-actin (ACTB),5′-TTGGCAATGAGCGGTT (forward), 5′-AGTTGAAGGTAGTTTCGTGGAT (reverse). All the primers were designed to amplify a region that lasts 100–250 base pairs long and contains at least one intron. They had passed our in-house amplification efficiency and specificity tests prior to usage. To check for nonspecific primer binding or co-amplification of residual genomic DNA, the melting curve was analyzed after each running. To detect foreign DNA contamination, a no-template control which contained all the reagents except the cDNA template was included in each running. Raw fluorescence data were analyzed by an Excel workbook called DART-PCR which automatically calculates threshold cycles, relative quantification values and amplification efficiencies [42].

Enzyme-linked Immunosorbent Assay (ELISA)

ELISA kits (R&D, MN, USA) were used to quantitatively determine the concentrations of IL-6 and IL-8 in culture supernatants. In brief, protein samples were pipetted into a microplate pre-coated with anti-IL-6 or anti-IL-8 antibodies and incubated at room temperature (RT) for 2 h. The plate was then washed three times with washing buffer to remove unbound samples. Subsequently, enzyme-linked polyclonal anti-IL-6 or anti-IL-8 antibodies were added and incubated at RT for 1 h. Following another three washes, a substrate solution was added and incubated at RT for 20 min. A blue color was then developed in direct proportion to the amount of the target cytokine in each well. Lastly, a stop solution was added to stop the color reaction. The absorbance was measured at 450 nm by a microplate reader (PerkinElmer, MA, USA).

Protein Extraction

Cytoplasmic and nuclear proteins were extracted using the NE-PER Nuclear and Cytoplasmic Extraction kit (Thermo). Two reagents, the Cytoplasmic Extraction Reagents I and II, were added to cell pellets to lyse cells. The cytoplasmic proteins released were collected by centrifugation. The remaining intact nuclei were lysed with the Nuclear Extraction Reagent and the nuclear proteins released were collected by centrifugation. The concentrations of fractionated proteins were measured by the BCA protein assay kit (Thermo).

thumbnail
Download:
Figure 1. Baicalin significantly downregulates P. gingivalis LPS-upregulated IL-6 expression.

A. Baicalin (BI) at 40 µM and 80 µM significantly downregulated P. gingivalis (P.g.) LPS-upregulated IL-6 mRNA expression. B. Baicalin at 10 µM, 20 µM, 40 µM, and 80 µM markedly downregulated P.g. LPS-upregulated IL-6 protein expression. Cells treated with culture media alone served as the blank control group, and those treated with P.g. LPS (10 µg/ml) alone represented the positive control group. Cells treated with 0.08% DMSO and P.g. LPS at 10 µg/ml served as the vehicle control group. Data of three independent experiments were depicted as relative fold change as compared with the blank control group (set as 1) (A), or presented as protein concentration (B). *p<0.05 and **p<0.01 as compared with the positive control group (P.g. LPS).

https://doi.org/10.1371/journal.pone.0051008.g001

thumbnail
Download:
Figure 2. Baicalin significantly downregulates P. gingivalis LPS-upregulated IL-8 expression.

A. Baicalin (BI) at 80 µM significantly downregulated P. gingivalis (P.g.) LPS-upregulated IL-8 mRNA expression. B. Baicalin at 80 µM significantly downregulated P.g. LPS-upregulated IL-8 protein expression. Cells treated with culture media alone served as the blank control group, and those treated with P.g. LPS (10 µg/ml) alone represented the positive control group. Cells treated with 0.08% DMSO and P.g. LPS at 10 µg/ml served as the vehicle control group. Data of three independent experiments were depicted as relative fold change as compared to the blank control group (set as 1) (A), or presented as protein concentration (B). *p<0.01 as compared with the positive control group (P.g. LPS).

https://doi.org/10.1371/journal.pone.0051008.g002

Western Blot

Protein samples were separated on 10% SDS-polyacrylamide gels by electrophoresis and subsequently transferred to polyvinylidene difluoride membranes (Roche, IN, USA) by using the Mini-PROTEAN tetra electrophoresis system and Mini Trans-Blot transfer system (Bio-rad, CA, USA). Afterwards, the membranes were incubated with the Protein-Free T20 (TBS) Blocking Buffer (Thermo) at RT for 1 h and then probed with the primary antibodies (1∶2000) at 4°C overnight with gentle agitation. On the next day, the membranes were washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at RT for 1 h. They were then washed again and incubated with the SuperSignal West Pico Chemiluminescent Substrate (Thermo) for 5 min. The signals of antigen-antibody complexes were developed on X-ray films. The density of the developed bands was quantified by the ImageJ software. The rabbit monoclonal antibodies (mAbs) against human IκBα, phospho-IκBα (serine32), phospho-p38 MAPK (Thr180/Tyr182), phospho-JNK (Thr183/Tyr185) and α-tubulin were obtained from Cellsignaling (MA, USA). HRP-conjugated goat polyclonal antibodies against rabbit IgG were obtained from Thermo.

NF-κB p65 Transcription Factor Assay

A NF-κB p65 Transcription Factor Kit (Thermo) was used to measure the level of p65 transcription factor in nuclear protein samples. It contains a 96-well plate pre-coated with a biotinylated consensus DNA sequence which only binds p65. Briefly, nuclear protein samples were added to each well with binding buffer and incubated at RT for 1 h. The plate was then washed and incubated with primary anti-p65 antibody at RT for 1 h. Following another around of washing, secondary HRP-conjugated antibodies were added to the plate and incubated at RT for 1 h. Lastly, a chemiluminescent substrate solution was added to the wells. The signal image was captured with a CCD camera and the signal intensity was measured by a multiplate reader.

thumbnail
Download:
Figure 3. Baicalin inhibits P. gingivalis LPS-induced activation of NF-κB, p38 MAPK and JNK.

A. The representative western blot experiment was performed by pooling cytoplasmic protein extracts equally from three independent experiments. 25 µg aliquots were loaded into each lane. The membrane was firstly probed with the rabbit anti-phospho-IκBα mAbs (1∶2000), and sequentially stripped and re-probed with rabbit anti-phospho-p38 MAPK mAbs (1∶2000), rabbit anti-phospho-JNK mAbs (1∶2000), and rabbit anti-IκBα mAbs (1∶2000). For loading control, the membrane was probed with rabbit anti-α-tubulin mAbs (1∶4000). B. The densitometry analysis of the signals. Cells treated with culture media alone served as the blank control group, and those treated with P. gingivalis (P.g.) LPS (10 µg/ml) alone represented the positive control group. Cells treated with P.g. LPS at 10 µg/ml and 0.08% DMSO served as the vehicle control group. Data of three independent experiments were depicted as relative fold change as compared with the blank control group (set as 1). For the p-JNK protein, the positive control group (LPS) was set as 1 since the signals of the blank control group at 15 min and 30 min were undetectable. *p<0.05 and **p<0.01 as compared with the respective positive control group (LPS) at each time point. BI: baicain.

https://doi.org/10.1371/journal.pone.0051008.g003

PCR Array

A panel of 89 genes associated with TLR signal transduction was investigated simultaneously using the RT2 Profiler™ PCR Arrays (SAbiosciences, MD, USA). RNA samples were firstly reverse transcribed into cDNA templates by the RT2 First Strand Kit (SAbiosciences). The diluted cDNA templates were subsequently mixed with the RT2 qPCR Master Mix (SAbiosciences) and H2O. 25 µl of the mixture were loaded into each well of the array plate which contained pre-coated specific primers. The real-time PCR was performed as follows: an initial incubation at 95°C for 10 min, then 40 cycles at 95°C for 15 s and 60°C for 1 min. Data analysis was undertaken by using the SAbiosciences web-based PCR array data analysis software.

Statistical Analysis

All experiments were repeated three times. The data were presented as mean±SD and the statistical significance was evaluated by one way ANOVA using the SPSS 16.0 software. A p-value<0.05 was considered statistically significant.

thumbnail
Download:
Figure 4. Baicalin suppresses P. gingivalis LPS-induced nuclear translocation of p65.

A. The representative experiment was performed by pooling nuclear protein extracts equally from three independent experiments. 2 µg aliquots were added to each well. The assay was carried out according to the manufacturer’s instruction. B. The intensity analysis of the luminescent signals. Cells treated with culture media alone served as the blank control group, and those treated with P. gingivalis (P.g.) LPS (10 µg/ml) alone represented the positive control group. Cells treated with P.g. LPS at 10 µg/ml and 0.08% DMSO served as the vehicle control group. Data from three independent experiments were depicted as relative fold change as compared with the blank control groups (set as 1). *p<0.05 and **p<0.01 as compared with the respective positive control group (LPS) at each time point. BI: baicalin.

https://doi.org/10.1371/journal.pone.0051008.g004

Results

Baicalin Downregulated P. gingivalis LPS-upregulated Expression of IL-6 and IL-8

HOKs were pre-treated with baicalin (0–80 µM) for 24 h, and subsequently treated with fresh media containing P. gingivalis LPS (10 µg/ml) with or without baicalin (0–80 µM) for 3 h. The culture supernatants and total RNA were collected for ELISA and real-time PCR analyses, respectively. We discovered that baicalin at 40 µM and 80 µM significantly suppressed P. gingivalis LPS-upregulated IL-6 mRNA expression (Fig. 1A); and baicalin at 10 µM, 20 µM, 40 µM and 80 µM significantly downregulated P. gingivalis LPS-upregulated IL-6 protein expression (Fig. 1B). Baicalin at 80 µM also significantly suppressed P. gingivalis LPS-upregulated IL-8 mRNA and protein expression (Figs. 2A & 2B). As baicalin at 80 µM contained 0.08% DMSO, the observed downregulation could have been partially caused by DMSO. To exclude this possibility, a vehicle control group was set up by treating cells firstly with 0.08% DMSO for 24 h, and then with P. gingivalis LPS (10 µg/ml) and 0.08% DMSO for 3 h. No DMSO-mediated inhibition on IL-6 or IL-8 expression was found (Figs. 1 and 2).

thumbnail
Download:
Table 1. The fold change in the expression of genes in baicalin/P. gingivalis LPS-treated cells (test) with reference to the P. gingivalis LPS-treated cells (control).

https://doi.org/10.1371/journal.pone.0051008.t001

Baicalin Displayed Inhibitory Effect on P. gingivalis LPS-induced Activation of NF-κB, p38 MAPK and JNK

In resting cells, inactive NF-κB (p65/p50) is retained in the cytoplasm by an inhibitory protein called IκBα [43]. Upon stimulation, IκBα is ubiquitinated and degraded by 26 S proteasome, resulting in the translocation of NF-κB to the nucleus where it binds to the target genes and initiates gene transcription [43]. As NF-κB plays a central role in P. gingivalis LPS-mediated cell response and the expression of IL-6 and IL-8 is dependent on NF-κB signaling [44], we were interested to exam whether baicalin could have any inhibitory effects on P. gingivalis LPS-activated NF-κB. Cells were pre-treated with baicalin (80 µM) for 24 h, and thereafter treated with fresh media containing P. gingivalis LPS (10 µg/ml) with or without baicalin (80 µM) for 15, 30, and 60 min. A vehicle control group was set up by treating cells firstly with 0.08% DMSO for 24 h, and then with P. gingivalis LPS (10 µg/ml) and 0.08% DMSO for 15, 30, and 60 min. As shown in Fig. 3, baicalin significantly inhibited to different extents P. gingivalis LPS-induced phosphorylation of IκBα, p38 MAPK and JNK which act as the downstream of TLR2/4 signaling pathways [45].

Baicalin Suppressed P. gingivalis LPS-induced Nuclear Translocation of p65

The effect of baicalin on P. gingivalis LPS-induced nuclear translocation of p65 was examined by using a p65 transcription factor kit. Cells were pre-treated with baicalin (80 µM) for 24 h, and then treated with fresh media containing P. gingivalis LPS (10 µg/ml) with or without baicalin (80 µM) for 15, 30, and 60 min. Compared with P. gingivalis LPS-treated samples, baicalin succeeded to suppress the amount of translocated p65 in the nuclear protein extracts at 60 min (Fig. 4).

Baicalin Modulated P. gingivalis LPS-induced Expression of Genes Associated with TLR Signaling

Lastly, a PCR array assay was undertaken to profile the expression of genes associated with TLR signaling. Cells were pre-treated with baicalin (80 µM) or culture media for 24 h, and then treated with fresh media containing P. gingivalis LPS (10 µg/ml) with or without baicalin (80 µM) for 3 h. The total RNA was purified and reverse transcribed into cDNA templates. The templates used in PCR array were pooled equally from three independent experiments. Compared with the P. gingivalis LPS-treated cells, the expression of CCL2, CSF2, CSF3, CXCL10, IL-8, V-fos FBJ murine osteosarcoma viral oncogene homolog (FOS) and interferon, beta 1, fibroblast (IFNB1) was significantly downregulated over two folds in baicalin/P. gingivalis LPS treated cells (Table 1). Notably, CCL2, CSF3 and CXCL10 were markedly downregulated over four folds. On the other hand, other genes including cluster of differentiation 80 (CD80), interleukin-1 receptor-associated kinase 1 (IRAK1), jun proto-oncogene (JUN), TLR6, Ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), sterile α and TIR motif–containing 1 (SARM1), single Ig IL-1-related receptor (SIGIRR), TIR domain containing adaptor protein (TIRAP) and TLR1 were significantly upregulated over two folds in baicalin/LPS-treated cells (Table 1).

Discussion

Periodontal disease results essentially from the consequence of a disrupted immuno-inflammatory homeostasis of bacteria-host interactions [5]. In susceptible individuals, when host response fails to limit and resolve early infection timely, cytokine expression may become dysregulated and destructive to tissues [46], [47]. As IL-6 is a stimulator of bone resorption and IL-8 is a potent neutrophil chemoattractant and activator [48], [49], prolonged and excessive production of these pro-inflammatory cytokines could contribute to periodontal tissue damage. Our present study shows that baicalin could significantly downregulate P. gingivalis LPS-upregulated production of IL-6 and IL-8 in HOKs. This observation goes in line with the concept of host modulatory therapy, suggesting that baicalin could potentially be used for modulation of host response in treatment of periodontal disease.

The present study also reveals that baicalin may inhibit P. gingivalis LPS-induced activation of NF-κB, p38 MAPK and JNK. Due to their involvements in a variety of human diseases, NF-κB, p38 MAPK and JNK have become therapeutic targets and several NF-κB inhibitors have been discovered, such as sulindac [50], IKK inhibitor [51], [52] and resveratrol [53]. It has been shown that SD828, a p38 MAPK antagonist, could suppress LPS-induced alveolar bone loss in periodontitis rats [54], and JNK inhibitors like CEP-1347 and AS601245 exhibit protective effects on neurons [55], [56]. In the present study, the exact mechanism of baicalin-induced inhibition of P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs remains to be further elucidated. While it could be speculated that the inhibition observed could have been exerted directly on IKK, p38 MAPK and JNK; or on the upstream kinases such as transforming-growth-factor-β-activated kinase 1 (TAK1) (kinase of IKK and p38/JNK MAPK) [57]–[59], interleukin-1 receptor-associated kinase 1 (IRAK1) (kinase of TAK1), or IRAK4 (kinase of IRAK1) [60]–[62].

According to the PCR array results, CCL2 [63], CSF3 [64], [65] and CXCL10 [66] were greatly downregulated over four folds by baicalin treatment. The transcription of CCL2 and CSF3 is regulated by NF-κB [67], [68]. In response to LPS, CXCL10 is induced in a TLR4-mediated MyD88-independent pathway [15], [69], [70]. The exact reasons that baicalin could downregulate both LPS-induced MyD88-dependent and MyD88-independent genes remain unclear. The possible mechanisms are as follows: i) baicalin might enable to interfere with the binding of P. gingivalis LPS to TLR4; ii) it could inhibit multiple downstream kinases of TLR4 signaling, such as IKK, TAK1 and TANK-binding kinase 1 (TBK1) (kinase of IRF3) [71]; iii) as the optimal transcription of CXCL10 requires a coordinated binding of activated IRF3 and NF-κB to the promoter region [15], [69], baicalin-mediated inhibition of NF-κB could have interfered with the expression of CXCL10. Further study is warranted to clarify these points.

Over the last three decades, the growing knowledge of periodontal pathogenesis has appreciated the crucial role of host response in the initiation and development of periodontal disease. Recently, TLR signaling has become an attractive target of host modulation therapy due to its central role in activating immuno-imflammatory response in the development of periodontitis [72]. To date, a number of negative regulatory strategies for over-activated TLR signaling have been proposed, such as natural/synthetic antagonists [73], [74], BB-loop peptides [75], miRNA [76] and kinase inhibitors [77]. Here, we report for the first time that baicalin can significantly downregulate P. gingivalis LPS-upregulated IL-6 and IL-8 expression in HOKs, through negative regulation of TLR signaling. Based on these findings, baicalin may potentially serve as a host response modulator in the control of periodontal disease by negative regulation of TLR signaling. Further clinical study is warranted to investigate the effectiveness of baicalin as a potential adjunct in treatment of patients with inflammatory diseases like periodontal disease.

Acknowledgments

We are grateful to Prof. Y. Abiko (Nihon University, Japan) for providing P. gingivalis LPS in the study.

Author Contributions

Conceived and designed the experiments: LJJ WL CYW. Performed the experiments: WL. Analyzed the data: WL LJJ CYW. Contributed reagents/materials/analysis tools: LJJ CYW. Wrote the paper: WL LJJ.

References

  1. 1. Jin LJ, Armitage GC, Klinge B, Lang NP, Tonetti M, et al. (2011) Global oral health inequalities: Task group-periodontal disease. Adv Dent Res 23: 221–226.
  2. 2. Parahitiyawa NB, Jin LJ, Leung WK, Yam WC, Samaranayake LP (2009) Microbiology of odontogenic bacteraemia: beyond endocarditis. Clin Microbiol Rev 22: 46–64.
  3. 3. Li X, Tse HF, Jin LJ (2011) Novel endothelial biomarkers: implications for periodontal disease and CVD. J Dent Res 90: 1062–1069.
  4. 4. Lalla E, Papapanou PN (2011) Diabetes mellitus and periodontitis: a tale of two common interrelated diseases. Nat Rev Endocrinol 7: 738–748.
  5. 5. Darveau RP (2010) Periodontitis: a polymicrobial disruption of host homeostasis. Nat Rev Microbiol 8: 481–490.
  6. 6. Yilmaz O (2008) The chronicles of Porphyromonas gingivalis: the microbium, the human oral epithelium and their interplay. Microbiology 154: 2897–2903.
  7. 7. Jain S, Darveau RP (2010) Contribution of Porphyromonas gingivalis lipopolysaccharide to periodontitis. Periodontol 2000 54: 53–70.
  8. 8. Herath TDK, Wang Y, Seneviratne CJ, Lu Q, Darveau RP, et al. (2011) Porphyromonas gingivalis lipopolysaccharide lipid A heterogeneity differentially modulates the expression of IL-6 and IL-8 in human gingival fibroblasts. J Clin Periodontol 38: 694–701.
  9. 9. Souza PP, Palmqvist P, Lundgren I, Lie A, Costa-Neto CM, et al. (2010) Stimulation of IL-6 cytokines in fibroblasts by toll-like receptors 2. J Periodontal Res 89: 802–807.
  10. 10. Seo T, Cha S, Kim TI, Lee JS, Woo KM (2012) Porphyromonas gingivalis-derived lipopolysaccharide-mediated activation of MAPK signaling regulates inflammatory response and differentiation in human periodontal ligament fibroblasts. J Microbiol 50: 311–319.
  11. 11. Akira S, Takeda K (2004) Toll-like receptor signalling. Nat Rev Immunol 4: 499–511.
  12. 12. Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao Z (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7: 837–847.
  13. 13. Medzhitov R, Preston-Hurlburt P, Kopp E, Stadlen A, Chen C, et al. (1998) MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol Cell 2: 253–258.
  14. 14. Kawai T, Adachi O, Ogawa T, Takeda K, Akira S (1999) Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11: 115–122.
  15. 15. Kawai T, Takeuchi O, Fujita T, Inoue J, Mühlradt PF, et al. (2001) Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J Immunol 167: 5887–5894.
  16. 16. Hoshino K, Kaisho T, Iwabe T, Takeuchi O, Akira S (2002) Differential involvement of IFN-β in Toll-like receptor stimulated dendritic cell activation. Int Immunol 14: 1225–1231.
  17. 17. Yamamoto M, Sato S, Hemmi H, Hoshino K, Kaisho T, et al. (2003) Role of adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. Science 301: 640–643.
  18. 18. Sakaguchi S, Negishi H, Asagiri M, Nakajima C, Mizutani T, et al. (2003) Essential role of IRF-3 in lipopolysaccharide-induced interferon-beta gene expression and endotoxin shock. Biochem Biophys Res Commun 306: 860–866.
  19. 19. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, et al. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088.
  20. 20. Ogawa T, Asai Y, Hashimoto M, Takeuchi O, Kurita T, et al. (2002) Cell activation by Porphyromonas gingivalis lipid A molecule through Toll-like receptor 4- and myeloid differentiation factor 88-dependent signaling pathway. Int Immunol 14: 1325–1332.
  21. 21. Sawada N, Ogawa T, Asai Y, Makimura Y, Sugiyama A (2007) Toll-like receptor 4-dependent recognition of structurally different forms of chemically synthesized lipid As of Porphyromonas gingivalis. Clin Exp Immunol 148: 529–536.
  22. 22. Hirschfeld M, Weis JJ, Toshchakov V, Salkowski CA, Cody MJ, et al. (2001) Signaling by toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect Immun 69: 1477–1482.
  23. 23. Yoshimura A, Kaneko T, Kato Y, Golenbock DT, Hara Y (2002) Lipopolysaccharides from periodontopathic bacteria Porphyromonas gingivalis and Capnocytophaga ochracea are antagonists for human toll-like receptor 4. Infect Immun 70: 218–225.
  24. 24. Burns E, Bachrach G, Shapira L, Nussbaum G (2006) Cutting edge: TLR2 is required for the innate response to Porphyromonas gingivalis: activation leads to bacterial persistence and TLR2 deficiency attenuates induced alveolar bone resorption. J Immunol 177: 8296–8300.
  25. 25. Netea MG, van Deuren M, Kullberg BJ, Cavaillon JM, Van der Meer JW (2002) Does the shape of lipid A determine the interaction of LPS with Toll-like receptors? Trends Immunol 23: 135–139.
  26. 26. Darveau RP, Pham TT, Lemley K, Reife RA, Bainbridge BW, et al. (2004) Porphyromonas gingivalis lipopolysaccharide contains multiple lipid A species that functionally interact with both toll-like receptors 2 and 4. Infect Immun 72: 5041–5051.
  27. 27. Hirschfeld M, Ma Y, Weis JH, Vogel SN, Weis JJ (2000) Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J Immunol 165: 618–622.
  28. 28. Ogawa T, Asai Y, Makimura Y, Tamai R (2007) Chemical structure and immunobiological activity of Porphyromonas gingivalis lipid A. Front Biosci. 12: 3795–3812.
  29. 29. Kumada H, Haishima Y, Watanabe K, Hasegawa C, Tsuchiya T, et al. (2008) Biological properties of the native and synthetic lipid A of Porphyromonas gingivalis lipopolysaccharide. Oral Microbiol Immunol 23: 60–69.
  30. 30. Oringer RJ, Research Science (2002) Therapy Committee of the American Academy of Periodontology (2002) Modulation of the host response in periodontal therapy. J Periodontol 73: 460–470.
  31. 31. Bhatavadekar NB, Williams RC (2009) Modulation of the host inflammatory response in periodontal disease management: exciting new directions. Int Dent J 59: 305–308.
  32. 32. Serhan CN, Jain A, Marleau S, Clish C, Kantarci A, et al. (2003) Reduced inflammation and tissue damage in transgenic rabbits overexpressing 15-lipoxygenase and endogenous anti-inflammatory lipid mediators. J Immunol 171: 6856–6865.
  33. 33. Preshaw PM, Hefti AF, Jepsen S, Etienne D, Walker C, et al. (2004) Subantimicrobial dose doxycycline as adjunctive treatment for periodontitis. A review. J Clin Periodontol 31: 697–707.
  34. 34. Hasturk H, Kantarci A, Goguet-Surmenian E, Blackwood A, Andry C, et al. (2007) Resolvin E1 regulates inflammation at the cellular and tissue level and restores tissue homeostasis in vivo. J Immunol 179: 7021–7029.
  35. 35. Ikemoto S, Sugimura K, Yoshida N, Yasumoto R, Wada S, et al. (2000) Antitumor effects of Scutellariae radix and its components baicalein, baicalin, and wogonin on bladder cancer cell lines. Urology 55: 951–955.
  36. 36. Zhu G, Li C, Cao Z (2007) Inhibitory effect of flavonoid baicalin on degranulation of human polymorphonuclear leukocytes induced by interleukin-8: potential role in periodontal diseases. J Ethnopharmacol 109: 325–330.
  37. 37. Wang GF, Wu ZF, Wan L, Wang QT, Chen FM (2006) Influence of baicalin on the expression of receptor activator of nuclear factor-kappaB ligand in cultured human periodontal ligament cells. Pharmacology 77: 71–77.
  38. 38. Cai X, Li C, Du G, Cao Z (2008) Protective effects of baicalin on the ligature-induced periodontitis in rats. J Periodontal Res 43: 14–21.
  39. 39. Cao Z, Li C, Zhu G (2010) Inhibitory effects of baicalin on IL-1beta- induced MMP-1/TIMP-1 and its stimulated effect on collagen-I production in human periodontal ligament cells. Eur J Pharmacoly 641: 1–6.
  40. 40. Koga T, Nishihara T, Fujiwara T, Nisizawa T, Okahashi N, et al. (1985) Biochemical and immunobiological properties of lipopolysaccharide (LPS) from Bacteroides gingivalis and comparison with LPS from Escherichia coli. Infect Immun 47: 638–647.
  41. 41. Maruyama M, Hayakawa M, Zhang L, Shibata Y, Abiko Y (2009) Monoclonal antibodies produced against lipopolysaccharide from fimA Type II Porphyromonas gingivalis. Hybridoma 28: 431–434.
  42. 42. Peirson SN, Butler JN, Foster RG (2003) Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res 31: 73–80.
  43. 43. Karin M, Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: the control of NF-kB activity. Annu Rev Immunol 18: 621–663.
  44. 44. Carayol N, Chen J, Yang F, Jin T, Jin LJ, et al. (2006) A Dominant Function of IKK/NF-kB Signaling in Global Lipopolysaccharide-induced Gene Expression. J Biol Chem 281: 31142–31151.
  45. 45. Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410: 37–40.
  46. 46. Garlet GP (2010) Destructive and protective roles of cytokines in periodontitis: a re-appraisal from host defense and tissue destruction viewpoints. J Dent Res 89: 1349–1363.
  47. 47. Liu YC, Lerner UH, Teng YT (2010) Cytokine responses against periodontal infection: protective and destructive roles. Periodontol 2000 52: 163–120.
  48. 48. Baggiolini M, Walz A, Kunkel SL (1989) Neutrophil-activating peptide- 1/interleukin-8, a novel cytokine that activates neutrophils. J Clin Invest 84: 1045–1049.
  49. 49. Palmqvist P, Persson E, Conaway HH, Lerner UH (2002) IL-6, leukemia inhibitory factor, and oncostatin M stimulate bone resorption and regulate the expression of receptor activator of NF-kappa B ligand, osteoprotegerin, and receptor activator of NF-kappa B in mouse calvariae. J Immunol 169: 3353–3362.
  50. 50. Berman KS, Verma UN, Harburg G, Minna JD, Cobb MH, et al. (2002) Sulindac enhances tumor necrosis factor-α-mediated apoptosis of lung cancer cell lines by inhibition of nuclear factor-κB. Clin Cancer Res 8: 354–360.
  51. 51. Burke JR, Pattoli MA, Gregor KR, Brassil PJ, MacMaster JF, et al. (2003) BMS-345541 is a highly selective inhibitor of IκB kinase that binds at an allosteric site of the enzyme and blocks NF-κB-dependent transcription in mice. J Biol Chem 278: 1450–1456.
  52. 52. Kishore N, Sommers C, Mathialagan S, Guzova J, Yao M, et al. (2003) A selective IKK-2 inhibitor blocks NF-κBdependent gene expression in IL-1β stimulated synovial fibroblasts. J Biol Chem 278: 32861–32871.
  53. 53. Park HJ, Jeong SK, Kim SR, Bae SK, Kim WS, et al. (2009) Resveratrol inhibits Porphyromonas gingivalis lipopolysaccharideinduced endothelial adhesion molecule expression by suppressing NF-kappaB activation. Arch Pharm Res 32: 583–591.
  54. 54. Rogers JE, Li F, Coatney DD, Otremba J, Kriegl JM, et al. (2007) A p38 mitogen-activated protein kinase inhibitor arrests active alveolar bone loss in a rat periodontitis model. J Periodontol 78: 1992–1998.
  55. 55. Saporito MS, Brown EM, Miller MS, Carswell S (1999) CEP-1347/KT-7515, an inhibitor of c-jun N-terminal kinase activation, attenuates the 1-methyl-4-phenyl tetrahydropyridine-mediated loss of nigrostriatal dopaminergic neurons In vivo. J Pharmacol Exp Ther 288: 421–427.
  56. 56. Carboni S, Hiver A, Szyndralewiez C, Gaillard P, Gotteland JP, et al. (2004) AS601245 (1,3-benzothiazol-2-yl (2-[[2-(3-pyridinyl) ethyl] amino]-4 pyrimidinyl) acetonitrile): a c-Jun NH2-terminal protein kinase inhibitor with neuroprotective properties. J Pharmacol Exp Ther 310: 25–32.
  57. 57. Yamaguchi K, Shirakabe K, Shibuya H, Irie K, Oishi I, et al. (1995) Identification of a member of the MAPKKK family as a potential mediator of TGF-beta signal transduction. Science 270: 2008–2011.
  58. 58. Lee J, Mira-Arbibe L, Ulevitch RJ (2000) TAK1 regulates multiple protein kinase cascades activated by bacterial lipopolysaccharide. J Leukoc Biol 68: 909–915.
  59. 59. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, et al. (2001) TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346–351.
  60. 60. Cao Z, Henzel WJ, Gao X (1996) IRAK: a kinase associated with the interleukin-1 receptor. Science 271: 1128–1131.
  61. 61. Li S, Strelow A, Fontana EJ, Wesche H (2002) IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase. Proc Natl Acad Sci USA 99: 5567–5572.
  62. 62. Janssens S, Beyaert R (2003) Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol Cell 11: 293–302.
  63. 63. Deshmane SL, Kremlev S, Amini S, Sawaya BE (2009) Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res 29: 313–326.
  64. 64. Demetri GD, Griffin JD (1991) Granulocyte colony-stimulating factor and its receptor. Blood 78: 2791–2808.
  65. 65. Lieschke GJ, Grail D, Hodgson G, Metcalf D, Stanley E, et al. (1994) Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization. Blood 84: 1737–1746.
  66. 66. Liu M, Guo S, Hibbert JM, Jain V, Singh N, et al. (2011) CXCL10/IP-10 in infectious diseases pathogenesis and potential therapeutic implications. Cytokine Growth Factor Rev 22: 121–130.
  67. 67. Ueda A, Ishigatsubo Y, Okubo T, Yoshimura T (1997) Transcriptional regulation of the human monocyte chemoattractant protein-1 gene. Cooperation of two NF-kappaB sites and NF-kappaB/Rel subunit specificity. J Biol Chem 272: 31092–31099.
  68. 68. Campbell IK, van Nieuwenhuijze A, Segura E, O'Donnell K, Coghill E, et al. (2011) Differentiation of inflammatory dendritic cells is mediated by NF-κB1-dependent GM-CSF production in CD4 T cells. J Immunol 186: 5468–5477.
  69. 69. Doyle S, Vaidya S, O'Connell R, Dadgostar H, Dempsey P, et al. (2002) IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17: 251–263.
  70. 70. Toshchakov V, Jones BW, Perera PY, Thomas K, Cody MJ, et al. (2003) TLR4, but not TLR2, mediates IFN-beta-induced STAT1alpha/beta-dependent gene expression in macrophages. Nat Immunol 3: 392–398.
  71. 71. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, et al. (2003) IKKε and TBK1 are essential components of the IRF3 signaling pathway. Nature Immunol 4: 491–496.
  72. 72. Hajishengallis G (2009) Toll gates to periodontal host modulation and vaccine therapy. Periodontol 2000 51: 181–207.
  73. 73. Macagno A, Molteni M, Rinaldi A, Bertoni F, Lanzavecchia A, et al. (2006) A cyanobacterial LPS antagonist prevents endotoxin shock and blocks sustained TLR4 stimulation required for cytokine expression. J Exp Med 203: 1481–1492.
  74. 74. Kim HM, Park BS, Kim JI, Kim SE, Lee J, et al. (2007) Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran. Cell 130: 906–917.
  75. 75. Toshchakov VY, Fenton MJ, Vogel SN (2007) Cutting edge: differential inhibition of TLR signaling pathways by cell permeable peptides representing BB loops of TLRs. J Immunol 178: 2655–2660.
  76. 76. Benakanakere MR, Li Q, Eskan MA, Singh AV, Zhao J, et al. (2009) Modulation of TLR2 protein expression by miR-105 in human oral keratinocytes. J Biol Chem 284: 23107–23115.
  77. 77. Dominguez C, Powers DA, Tamayo N (2005) p38 MAP kinase inhibitors: many are made, but few are chosen. Curr Opin Drug Discov Devel 8: 421–430.