Figures
Abstract
Mouse preimplantation development is characterized by three major transitions and two lineage segregations. Each transition or lineage segregation entails pronounced changes in the pattern of gene expression. Thus, research into the function of genes with obvious changes in expression pattern will shed light on the molecular basis of preimplantation development. We have described a simplified and effective method–electroporation–of introducing plasmid DNA and morpholinos into mouse preimplantation embryos and verified effectiveness of this approach by testing the procedure on the endogenous gene Oct4. Before electroporation, the zona pellucida was weakened by the treatment of acid Tyrode’s solution. Then we optimized the parameters such as voltage, pulse duration, number of pulses and repeats, and applied these parameters to subsequent experiments. Compared with the control groups, the number of apoptotic cells and the expression and localization of OCT3/4 or CDX2 was not significantly changed in blastocysts developed from 1-cell embryos, which were electroporated with pIRES2-AcGFP1-Nuc eukaryotic expression vector or mismatched morpholino oligonucleotides. Furthermore, electroporated plasmid DNA and morpholinos targeting the endogenous gene Oct4 were able to sharply down regulate expression of OCT4 protein and actually cause expected phenotypes in mouse preimplantation embryos. In conclusion, plasmid DNA and morpholinos could be efficient delivered into mouse preimplantation embryos by electroporation and exert their functions, and normal development of preimplantation embryos was not affected.
Citation: Peng H, Wu Y, Zhang Y (2012) Efficient Delivery of DNA and Morpholinos into Mouse Preimplantation Embryos by Electroporation. PLoS ONE 7(8): e43748. https://doi.org/10.1371/journal.pone.0043748
Editor: Austin John Cooney, Baylor College of Medicine, United States of America
Received: May 4, 2012; Accepted: July 23, 2012; Published: August 21, 2012
Copyright: © Peng et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the National Major Project for Production of Transgenic Breeding, People’s Republic of China (No.2011ZX08007–004) (http://www.most.gov.cn). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
One essential method to understand the genetic mechanisms controlling embryonic development contains governing gene expression and analyzing the subsequent effects on developmental processes. Introduction of exogenous genes into embryos and targeting of given genes by homologous recombination are conventional and classical techniques to research gene function. Traditionally, the introduction of genes into cells or genomes is dependent on transfection [1], [2], viral infection [3], [4] or microinjection [5], [6], while loss-of-function of genes relies on knock-down or knock-out technologies [7], [8]. However, as far as the stage of preimplantation embryo development in the mouse is concerned, introduction of genes into preimplantation embryos by transfection or viral infection is difficult as embryos are encompassed by zona pellucida. Knock-out technology is not widely used, as it is a time-consuming, laborious and expensive process. To date, exogenous genes and sequences including double-stranded RNA (dsRNA), small interfering RNA (siRNA) and morpholino antisense oligonucleotides for knock-down gene expression have been introduced into mouse zygotes or blastomeres by microinjection [9], [10], [11], [12]. It is not efficient as a method of introducing these molecules into all of the blastomeres of embryos at the 2-cell to morula stage, and only a single embryo can be microinjected at any one time, although this approach is likely to be valuable for following the gain or loss of gene function in a single blastomere.
For years, electroporation has been an effective method for introducing DNA into Drosophila [13], insect [14], zebrafish [15], [16], [17], Xenopus laevis [18] and chicken embryos [19], [20], [21]. Apart from DNA, antisense morpholinos, bounded to and blocked translation of mRNA, have been successfully delivered into cells or embryos by electroporation [17], [22], [23], [24]. This technique is based on electric pulses generating transient pores in the plasma membrane through which molecules can enter. It is universally accepted that electropermeabilization and electrophoresis are pivotal for successful electroporation; other mechanisms such as passive diffusion and electroendocytosis might also play a role in electroporation.
Electroporation has previously been mainly applied on cells and postimplantation embryos in the mouse [24], [25], [26], [27], [28], [29]. Although some literature involved electroporation that introduced DNA into mouse preimplantation embryos, their protocols injected DNA into the perivitelline space (between the plasma membrane and zona pellucida) of zygotes, and then subjected them to electroporation with very low efficiency [30]. Recently, electroporation was also successfully used to deliver dsRNA and siRNA into mouse preimplantation embryos [31], [32]. However, the electroporation of morpholinos introduced into mouse preimplantation embryos has not been reported. Here we describe a simplified and effective method–electroporation–of introducing DNA and morpholinos into mouse preimplantation embryos and verify effectiveness of this approach by testing the procedure on the endogenous gene Oct4. This approach will facilitate the analysis of gene function and extend the knowledge of zygote to blastocyst development in the mouse.
(A) A stereoscopic microscope for embryo manipulation. (B) Chamber-type electrodes with 1-mm gap used in this experiment. (C) Electro Cell Manipulator for generating electric pulses. (D) Nikon DS-Ri1 digital camera for image capture.
Materials and Methods
Ethics Statement
The entire experimental procedure was approved by the Animal Care Commission of the College of Veterinary Medicine, Northwest A&F University. Adult male and female ICR mice were purchased from the Experimental Animal Center of the Fourth Military Medical University (Xi’an, China). They were maintained on a 14L:10D cycle with free access to food and water in the Laboratory Animal Facility of the College of Veterinary Medicine, Northwest A&F University.
(A) Fluorescence level of the standard control morpholinos (C-MOs) in the 2-cell stage embryos when 1-cell embryos were treated with acid Tyrode’s solution, electroporated and cultured for 24 h in vitro. Each sample was counterstained with Hoechst 33342 to visualize DNA (blue). Original magnification was ×200. (B) Quantification of the lissamine conjugated morpholinos signal intensities in treated embryos that were incubated in acid Tyrode’s solution for different durations. Labeling intensity was expressed relative to that of the treated 0 s embryos (set as 100%). Values with different superscripts differ significantly (P<0.05). The experiments were replicated 4 times. In each replication, n = 10–15 per group. (C) Embryonic survival rate following electroporation of 1-cell stage embryos incubated in acid Tyrode’s solution for different durations.
Chemicals
All chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, USA) unless stated otherwise. Sterile plasticware was purchased from Nunclon (Roskilde, Denmark).
Collection and Culture of Embryos
Zygotes (1-cell embryos) were obtained from 8–10-week-old female mice superovulated with 10 IU of pregnant mare serum gonadotrophin and 10 IU human chorionic gonadotrophin 48 h later and mated with males. Zygotes were released from ampullae of oviducts 20 h after human chorionic gonadotrophin and cumulus cells were removed by hyaluronidase (1 mg/ml) treatment and pipetting in Hepes-buffered KSOM medium [33]. Collection of embryos (2-cell, 4-cell, 8-cell and morula) was performed according to previously described protocols [32]. Embryos were cultured in groups of 30–50 in microdrops (100 µl) of KSOMaa medium [34] supplemented with 4 mg/ml bovine serum albumin (KSOMaa-BSA) under liquid paraffin oil in a humidified atmosphere of 5% CO2/95% air at 37°C.
1-cell embryos, 2-cell embryos, 4-cell embryos, 8-cell embryos and morulas were electroporated with pIRES2-AcGFP1-Nuc (A) or the lissamine conjugated morpholinos (B) and cultured for 24 h. pIRES2-AcGFP1-Nuc and morpholinos introduce, revealed by green fluorescent protein and lissamine fluorescence, respectively, is efficient. 4-cell embryos and 8-cell embryos were all developed from the electroporated 2-cell embryos. Original magnification was ×200.
Preparation of DNA and Morpholinos Solution
pIRES2-AcGFP1-Nuc (Clontech, Otsu, Japan) eukaryotic expression vector (pIRES2) was purified by routine methods and finally diluted into Opti-MEM® I (Invitrogen, Carlsbad, CA, USA) medium with a concentration of 40 µg/ml for electroporation. The gene-specific shRNA expression plasmids (Origene, TG511384, Origene Technologies, Inc., Rockville, MD, USA) for specifically knocking down mouse Oct4 expression (Oct4-shRNA) were diluted into Opti-MEM® I medium with the different concentrations (0, 10, 40 and 100 µg/ml). The blank Opti-MEM® I medium was used as electroporation control (EP). An empty vector without shRNA cassette insert (Origene, TR30007) was used as vector control (V-C). The vector containing noneffective 29-mer scrambled shRNA cassette (Origene, TR30013) was used as a negative control (N-C).
The morpholino oligonucleotides were purchased from Gene-Tools, LLC (Corvallis, OR, USA). The standard control oligo sequence was 5′–CCTCTTACCTCAGTTACAATTTATA–3′ and modified with lissamine to visualize within the electroporated embryos. To optimize the treatment times with acid Tyrode’s solution for weakening the zona pellucida, this modified morpholinos were diluted in Opti-MEM® I medium with a concentration of 0.2 mM for electroporation. The Oct4 morpholino oligonucleotides (Oct4-MOs) sequence was 5′-AGTCTGAAGCCAGGTGTCCAGCCAT-3′. Oct4-MOs were diluted into Opti-MEM® I medium with the different concentrations (0, 0.2, 0.3 and 0.4 mM). The blank Opti-MEM® I medium was used as electroporation control (EP). The standard control oligo was used as a control morpholino (C-MOs). The mismatched oligo sequence was 5′-ACTCTCAAGCCACGTGTGCAGCGAT-3′ and used as a negative control (M-MOs).
(A) TUNEL apoptosis assay of blastocysts (green). Each sample was counterstained with Hoechst 33342 to visualize DNA (blue). The original magnification was ×200. (B) Number of apoptotic cells in each blastocyst.
Apparatus for Electroporation
Embryos were manipulated under a stereoscopic microscope (Nikon, Tokyo, Japan) (Fig. 1A) and then electroporated in a flat electrode chamber (Fig. 1B) supplied by BTX Inc. Square pulses were delivered using a 2001 Electro Cell Manipulator (ECM 2001; BTX, San Diego, CA) (Fig. 1C). Fluorescence was visualized using a Nikon Eclipse Ti-S microscope equipped with a 198 Nikon DS-Ri1 digital camera (Nikon) (Fig. 1D).
Immunostaining of CDX2 (red) and OCT4 (green) in blastocysts developed from unelectroporated embryos (C0), EP group, pIRES2-AcGFP1-Nuc (pIRES2) and mismatched morpholino oligonucleotides (M-MOs) electroporation. The original magnification was ×200.
Optimization of Treatment of Zona Pellucida and Electroporation Parameters
Freshly collected embryos at the different stages were washed in H-KSOM and then incubated in pre-warmed acid Tyrode’s solution for 0, 10, 20 or 30 s to weaken the zona pellucida rather than remove it. Zona-weakened embryos were washed twice in fresh H-KSOM and prepared for electroporation.
(A) Blastocyst development following electroporation of zygotes with custom Oct4-specific shRNA expression vectors at different concentrations and cultured for 3.5 d. (B) Blastocyst development following electroporation of zygotes with different shRNA expression vectors with a concentration of 100 µg/ml. (C) Morphological appearance of electroporated zygotes obtained from the control and Oct4-shRNA groups after being cultured for 3.5 d. Morphology (top) and fluorescence (bottom). The original magnification was ×100.
To optimize the treatment times of zona pellucida with acid Tyrode’s solution, zona-weakened 1-cell embryos were electroporated with modified morpholino oligonucleotides. After culturing for 24 h, embryos were stained with Hoechst 33342 (C1025; Beyotime, Jiangsu, China) for 30 min, and then observed using a Nikon Eclipse Ti-S microscope (Nikon). Images were obtained with the same exposure times and adjustments of the microscope. The intensity of lissamine fluorescence was analyzed using MetaMorph software (Version 6.1; Universal Imaging Corporation) as described previously [35], [36]. To quantify fluorescence intensity, the values of the treated embryos were presented relative to the mean value of untreated embryos.
Nuclear Oct4 expression is absent in Oct4-shRNA electroporated embryos at the multi-cell (A) and blastocyst stage (B) but present in embryos obtained from the control groups. Each sample was counterstained with Hoechst 33342 to visualize DNA (blue). The original magnification was ×200.
Parameters such as voltage, pulse duration, number of pulses and repeats for plasmid DNA and morpholinos electroporation were optimized as described above.
(A) Blastocyst development following electroporation of zygotes with customized Oct4 morpholinos at different concentrations and cultured for 3.5 d. (B) Blastocyst development following electroporation of zygotes with different morpholinos with a concentration of 0.4 mM. (C) Morphological appearance of electroporated zygotes obtained from the control and Oct4-MOs groups after being cultured for 3.5 d. The original magnification was ×100. (D) Nuclear Oct4 expression is absent in Oct4-MOs electroporated embryos but present in embryos obtained from the control groups. Each sample was counterstained with Hoechst 33342 to visualize DNA (blue). The original magnification was ×200.
Embryo Electroporation with Plasmid DNA and Morpholinos
A suitably sized drop (30 µl) of the diluted plasmid DNA or morpholinos solution was added between the two electrodes fixed in an electroporation chamber. Zona-weakened embryos were linearly arranged in the flat chamber; simultaneously, the 2001 Electro Cell Manipulator was switched on. A series of electrical square pulses were given to the zona-weakened embryos. After electroporation, embryos were washed three times and cultured in KSOMaa-BSA for 24 h or 3.5 d.
TUNEL Assays
To evaluate the degree of embryo damage after electroporation, TUNEL (TdT-mediated dUTP nick end labeling) apoptosis assays were carried out with the DeadEnd™ Fluorometric TUNEL System (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Apoptosis assays of blastocysts were performed as described [37].
Immunofluorescence Staining
After 3.5 d electroporation, embryos were washed three times, fixed in 4% paraformaldehyde for 45 min, permeabilized in PBS/0.2% Triton X-100 for 20 min, blocked in PBS/3% BSA for 2 h at room temperature (RT) and incubated with the primary antibody diluted in PBS containing 1% BSA overnight at 4°C. Anti-CDX2 rabbit polyclonal IgG (sc-134468; Santa Cruz) and anti-OCT4 mouse monoclonal antibody (sc-5279; Santa Cruz) was diluted 1∶50, respectively. After washing in PBS containing 0.3% polyvinylpyrrolidone, embryos were incubated for 1 h at RT with the secondary antibodies of Alexa Fluor 555-labeled goat anti-rabbit IgG (A0452; Beyotime) for CDX2 and Alexa Fluor 488-labeled goat anti-mouse IgG (A0428; Beyotime) for OCT4. The secondary antibodies were diluted 1∶500 with PBS containing 1% BSA. After washing in PBS/0.3% polyvinylpyrrolidone, nuclei were stained with Hoechst 33342 for 5 min. Embryos were observed using a Nikon eclipse Ti-S microscope (Nikon).
Results
Treatment of Zona Pellucida with Acid Tyrode’s Solution Improved Electroporation Efficiency
For ease of optimization of treatment times with acid Tyrode’s solution, zygotes were electroporated with modified morpholino oligonucleotides and cultured for 24 h. As shown in Figures 2A and 2B, the level of lissamine fluorescence was progressively enhanced with the increase of treatment times with acid Tyrode’s solution. However, the post electroporation embryo survival rate was gradually decreased (Fig. 2C). Based on an overall analysis of above factors, the optimum treatment time was 20 s for the zona pellucida to be incubated in acid Tyrode’s solution.
Optimization of Electroporation Parameters
Based on an overall analysis of embryo survival rate and the fluorescence level, parameters such as voltage, pulse duration, number of pulses and repeats for plasmid DNA and morpholinos electroporation were optimized, and are detailed in Table 1. As shown in Figures 3A and 3B, pIRES2-AcGFP1-Nuc and standard control oligonucleotides were all effectively delivered into mouse preimplantation embryos using the optimal parameters.
Evaluation of Degree of Embryo Damage after Electroporation
To evaluate the degree of embryo damage using TUNEL assay, blastocysts obtained from unelectroporated embryos (C0), EP group, pIRES2-AcGFP1-Nuc and mismatched morpholino oligonucleotides electroporation were performed. As shown in Figure 4, the number of apoptotic cells in blastocysts derived from the four groups was no significantly difference.
Electroporation did not Affect Cell Differentiation in Blastocysts
To determine whether electroporation would influence normal development of embryos, we investigated the expression levels of OCT4 and CDX2, markers of pluripotency and trophectoderm differentiation [38], [39], respectively. As shown in Figure 5, the final cell fate and differentiation in blastocysts developed from unelectroporated embryos (C0), EP group, pIRES2-AcGFP1-Nuc and mismatched morpholino oligonucleotides electroporation was not affected in terms of the expression of these markers.
Electroporation of Oct4-specific shRNA Expression Plasmids Leads to Down Regulation of its Endogenous Expression
To determine if electroporated plasmid DNA is effective in mouse preimplantation embryos, zygotes were electroporated with customized Oct4-specific shRNA expression plasmids. As shown in Figures 6A and 6B, we had determined 100 µg/ml Oct4-specific shRNA expression plasmids to be the effective concentration that would allow normal rates of blastocyst development in the control groups. Hence, this concentration was used to subsequent experiments. After electroporation, the embryonic developmental stages and their morphological appearance after being cultured for 3.5 days are presented in Figure 6C. Zygotes obtained from the control groups reached the blastocyst stage. However, the majority of embryos derived from the Oct4-shRNA group were arrested the multi-cell stage and had no apparent inner cell mass (ICM). Furthermore, a remarkable reduces of the OCT4 protein level in Oct4-shRNA electroporated embryos at the multi-cell stage was observed compared with the control groups (Fig. 7A). Importantly, those minor blastocysts derived from the Oct4-shRNA group were not stained by anti-OCT4 antibodies in indirect immunofluorescence experiments (Fig. 7B). Thus, Oct4-specific shRNA expression plasmids were able to effectively deliver into mouse preimplantation embryos by electroporation and down regulate endogenous expression of OCT4 protein.
Reproducible Phenotype of Oct4-deficient Embryo by Morpholinos Electroporation
To investigate if electroporated morpholinos are also effective in down regulating genes in mouse preimplantation embryos, zygotes were electroporated with customized Oct4 morpholinos. As shown in Figures 8A and 8B, 0.4 mM Oct4 morpholinos was determined to be the effective concentration that would allow normal rates of blastocyst development in the control groups. Hence, this concentration was used to subsequent experiments. Zygotes that were electroporated with the standard control and the mismatched morpholinos or without morpholinos developed into blastocysts with normal morphology after being cultured for 3.5 days. In contrast, zygotes electroporated with customized Oct4 morpholinos appeared condensed and did not reach the blastocyst stage (Fig. 8C). Most remarkably, OCT4 protein expression was declined sharply in Oct4 morpholinos electroporated embryos at the multi-cell stage (Fig. 8D). The reproducible phenotype of Oct4-deficient embryos, as determined by electroporation, was identical with that previously determined by microinjection [40]. We therefore concluded that electroporation enabled Oct4 morpholinos to introduce into mouse preimplantation embryos and specifically block the translation of Oct4 mRNA.
Discussion
Mouse preimplantation development is characterized by three major transitions and two lineage segregations. The three major transitions are maternal-to-zygotic transition, compaction and blastocyst formation. At the compacting morula stage, trophectoderm and ICM emerge, and later the ICM gives rise to primitive endoderm and epiblast. Each transition or lineage segregation entails pronounced changes in the pattern of gene expression. Thus, research into the function of genes with obvious changes in expression pattern will shed light on the molecular basis underlying preimplantation development. However, conventional approaches to research the gain or loss of gene function are time-consuming, laborious and expensive processes. Here, we described a simplified and effective method–electroporation–of introducing plasmid DNA and morpholinos into mouse preimplantation embryos and verified the effectiveness of this approach.
Before electroporation of preimplantation embryos, the zona pellucida was weakened by the treatment of acid Tyrode’s solution, but not removed. The zona pellucida is important for the embryo’s development; therefore, developmental potential of zona-free mouse embryos is often lower than that of zona-enclosed embryos. We found that the level of lissamine fluorescence was progressively enhanced with the increase of treatment times, suggesting that the thinner the zona pellucida, the more easily a macromolecule can enter under identical electric pulses. However, the thinner the zona pellucida, the lower the embryo viability after electroporation. Thus, the treatment time with acid Tyrode’s solution is very important for electroporation efficiency and embryo survival rate.
We optimized the parameters, such as voltage, pulse duration, number of pulses and repeats, and demonstrated that plasmid DNA and morpholinos were efficiently delivered into mouse preimplantation embryos by electroporation. Compared with the control groups, the number of apoptotic cells in blastocysts developed from electroporated 1-cell embryos was not significantly increased, implying that embryo damage by electroporation might be happening, but to a lesser degree. Furthermore, the expression and localization of OCT4 or CDX2 was not significantly changed in blastocysts developed from electroporated 1-cell embryos, suggesting that this approach does not affect normal development of preimplantation embryos.
To further demonstrate whether electroporated plasmid DNA and morpholinos are effective in mouse preimplantation embryos, we chose Oct4 as the target gene. Oct4 is an important regulator of pluripotency that is essential for maintaining ICM cell fate and pluripotency of ES cells [39], [41]. Consistent with previous experiments that knock down Oct4 expression with siRNA or siRNA vectors via microinjection [10], [42], we confirmed that Oct4 gene expression was downregulated in preimplantation embryos developed from 1-cell embryos, which were electroporated with Oct4-specific shRNA expression plasmids, implying that electroporated plasmid DNA is effective in mouse preimplantation embryos. Furthermore, we also demonstrated that OCT4 protein expression was indeed declined in Oct4 morpholinos electroporated embryos at the multi-cell stage and the reproducible phenotype of Oct4-deficient embryos occurred, as previously reported by microinjection [40], suggesting that electroporated morpholinos are extremely efficient in mouse preimplantation embryos. Thus, electroporated plasmid DNA and morpholinos were able to exert their functions and actually cause expected phenotypes.
Electroporation is a powerful means for spatially and temporally analyzing gene function in development. As far as the gain or loss of gene function is concerned, this approach is easier to implement than classical techniques. This technique has several advantages over those classical techniques for mouse preimplantation development. First, electroporation can save time, economize labor and be more cost-effective. Second, this technique is very simple, and complicated manipulation is not required. Third, the technique is less toxic and highly efficient for embryos. Fourth, morpholinos can be introduced into mouse preimplantation embryos. Finally, this technique can be used to simultaneously co-deliver multiple compounds or plasmids.
Electroporation is a versatile technique applicable to the delivery of a wide range of molecules, including DNA, mRNA, dsRNA, siRNA, morpholinos, peptides, proteins, antibodies, dyes and drugs [31], [43], [44], [45], [46], [47], [48], [49], [50], [51]. Thus, using electroporation in combination with other techniques will extend the knowledge of preimplantation development in the mouse. For example, in combination with microinjection, electroporation can be used to trace blastomere differentiation and two lineage segregations. Moreover, in combination with other molecular techniques, electroporation will be able to provide insights into the developmental stages from zygotes to blastocysts.
In summary, we optimized the parameters such as voltage, pulse duration, number of pulses and repeats, and demonstrated that plasmid DNA and morpholinos were efficiently delivered into mouse preimplantation embryos by electroporation. Meanwhile, the normal development of preimplantation embryos was not affected. Furthermore, we have verified effectiveness of this approach by testing the procedure on the endogenous gene Oct4.
Acknowledgments
The authors thank Prof. Suzhu Qing for critically reading the manuscript and Dr. Jianmin Su for editorial assistance.
Author Contributions
Conceived and designed the experiments: HP YZ. Performed the experiments: HP YYW. Analyzed the data: HP YZ. Contributed reagents/materials/analysis tools: HP YYW. Wrote the paper: HP YZ.
References
- 1. Muramatsu T, Mizutani Y, Ohmori Y, Okumura J (1997) Comparison of three nonviral transfection methods for foreign gene expression in early chicken embryos in ovo. Biochem Biophys Res Commun 230: 376–380.
- 2. Li H, Chen G, Zhou B, Duan S (2008) Actin filament assembly by myristoylated alanine-rich C kinase substrate-phosphatidylinositol-4,5-diphosphate signaling is critical for dendrite branching. Mol Biol Cell 19: 4804–4813.
- 3. Smith C (1992) Retroviral vector-mediated gene transfer into hematopoietic cells: prospects and issues. J Hematother 1: 155–166.
- 4. Morgan BA, Fekete DM (1996) Manipulating gene expression with replication-competent retroviruses. Methods Cell Biol 51: 185–218.
- 5. Shen YM, Hirschhorn RR, Mercer WE, Surmacz E, Tsutsui Y, et al. (1982) Gene transfer: DNA microinjection compared with DNA transfection with a very high efficiency. Mol Cell Biol 2: 1145–1154.
- 6. Li L, Baibakov B, Dean J (2008) A subcortical maternal complex essential for preimplantation mouse embryogenesis. Dev Cell 15: 416–425.
- 7. Johnson CW, Hernandez-Lagunas L, Feng W, Melvin VS, Williams T, et al. (2011) Vgll2a is required for neural crest cell survival during zebrafish craniofacial development. Dev Biol 357: 269–281.
- 8. Gershon E, Plaks V, Aharon I, Galiani D, Reizel Y, et al. (2008) Oocyte-directed depletion of connexin43 using the Cre-LoxP system leads to subfertility in female mice. Dev Biol 313: 1–12.
- 9. Coonrod SA, Bolling LC, Wright PW, Visconti PE, Herr JC (2001) A morpholino phenocopy of the mouse mos mutation. Genesis 30: 198–200.
- 10. Haraguchi S, Saga Y, Naito K, Inoue H, Seto A (2004) Specific gene silencing in the pre-implantation stage mouse embryo by an siRNA expression vector system. Mol Reprod Dev 68: 17–24.
- 11. Jedrusik A, Bruce AW, Tan MH, Leong DE, Skamagki M, et al. (2010) Maternally and zygotically provided Cdx2 have novel and critical roles for early development of the mouse embryo. Dev Biol 344: 66–78.
- 12. Nabti I, Reis A, Levasseur M, Stemmann O, Jones KT (2008) Securin and not CDK1/cyclin B1 regulates sister chromatid disjunction during meiosis II in mouse eggs. Dev Biol 321: 379–386.
- 13. Kamdar KP, Wagner TN, Finnerty V (1995) Electroporation of Drosophila embryos. Methods Mol Biol 48: 239–243.
- 14. Leopold RA, Hughes KJ, DeVault JD (1996) Using electroporation and a slot cuvette to deliver plasmid DNA to insect embryos. Genet Anal 12: 197–200.
- 15. Buono RJ, Linser PJ (1992) Transient expression of RSVCAT in transgenic zebrafish made by electroporation. Mol Mar Biol Biotechnol 1: 271–275.
- 16. Muller F, Lele Z, Varadi L, Menczel L, Orban L (1993) Efficient transient expression system based on square pulse electroporation and in vivo luciferase assay of fertilized fish eggs. FEBS Lett 324: 27–32.
- 17. Cerda GA, Thomas JE, Allende ML, Karlstrom RO, Palma V (2006) Electroporation of DNA, RNA, and morpholinos into zebrafish embryos. Methods 39: 207–211.
- 18. Eide FF, Eisenberg SR, Sanders TA (2000) Electroporation-mediated gene transfer in free-swimming embryonic Xenopus laevis. FEBS Lett 486: 29–32.
- 19. Itasaki N, Bel-Vialar S, Krumlauf R (1999) ‘Shocking’ developments in chick embryology: electroporation and in ovo gene expression. Nat Cell Biol 1: E203–207.
- 20. Timmer J, Johnson J, Niswander L (2001) The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis 29: 123–132.
- 21. Nakamura H, Katahira T, Sato T, Watanabe Y, Funahashi J (2004) Gain- and loss-of-function in chick embryos by electroporation. Mech Dev 121: 1137–1143.
- 22. Nasevicius A, Ekker SC (2000) Effective targeted gene ‘knockdown’ in zebrafish. Nat Genet 26: 216–220.
- 23. Tucker RP (2001) Abnormal neural crest cell migration after the in vivo knockdown of tenascin-C expression with morpholino antisense oligonucleotides. Dev Dyn 222: 115–119.
- 24. Mellitzer G, Hallonet M, Chen L, Ang SL (2002) Spatial and temporal ‘knock down’ of gene expression by electroporation of double-stranded RNA and morpholinos into early postimplantation mouse embryos. Mech Dev 118: 57–63.
- 25. Akamatsu W, Okano HJ, Osumi N, Inoue T, Nakamura S, et al. (1999) Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc Natl Acad Sci U S A 96: 9885–9890.
- 26. Potter H, Weir L, Leder P (1984) Enhancer-dependent expression of human kappa immunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation. Proc Natl Acad Sci U S A 81: 7161–7165.
- 27. Osumi N, Inoue T (2001) Gene transfer into cultured mammalian embryos by electroporation. Methods 24: 35–42.
- 28. Fukuchi-Shimogori T, Grove EA (2001) Neocortex patterning by the secreted signaling molecule FGF8. Science 294: 1071–1074.
- 29. Tabata H, Nakajima K (2001) Efficient in utero gene transfer system to the developing mouse brain using electroporation: visualization of neuronal migration in the developing cortex. Neuroscience 103: 865–872.
- 30. L.A. Nemec LCS, J.M Goy, D.C Kraemer (1989) Introduction of DNA into murine embryos by electroporation. Theriogenology 31: 233.
- 31. Grabarek JB, Plusa B, Glover DM, Zernicka-Goetz M (2002) Efficient delivery of dsRNA into zona-enclosed mouse oocytes and preimplantation embryos by electroporation. Genesis 32: 269–276.
- 32. Wang H, Ding T, Brown N, Yamamoto Y, Prince LS, et al. (2008) Zonula occludens-1 (ZO-1) is involved in morula to blastocyst transformation in the mouse. Dev Biol 318: 112–125.
- 33. Biggers JD, McGinnis LK, Raffin M (2000) Amino acids and preimplantation development of the mouse in protein-free potassium simplex optimized medium. Biol Reprod 63: 281–293.
- 34. Lawitts JA, Biggers JD (1991) Optimization of mouse embryo culture media using simplex methods. J Reprod Fertil 91: 543–556.
- 35. Das ZC, Gupta MK, Uhm SJ, Lee HT (2010) Increasing histone acetylation of cloned embryos, but not donor cells, by sodium butyrate improves their in vitro development in pigs. Cell Reprogram 12: 95–104.
- 36. Yamanaka K, Sugimura S, Wakai T, Kawahara M, Sato E (2009) Acetylation level of histone H3 in early embryonic stages affects subsequent development of miniature pig somatic cell nuclear transfer embryos. J Reprod Dev 55: 638–644.
- 37. Su J, Wang Y, Li Y, Li R, Li Q, et al. (2011) Oxamflatin significantly improves nuclear reprogramming, blastocyst quality, and in vitro development of bovine SCNT embryos. PLoS One 6: e23805.
- 38. Beck F, Erler T, Russell A, James R (1995) Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev Dyn 204: 219–227.
- 39. Palmieri SL, Peter W, Hess H, Scholer HR (1994) Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev Biol 166: 259–267.
- 40. Foygel K, Choi B, Jun S, Leong DE, Lee A, et al. (2008) A novel and critical role for Oct4 as a regulator of the maternal-embryonic transition. PLoS One 3: e4109.
- 41. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95: 379–391.
- 42. Kim MH, Yuan X, Okumura S, Ishikawa F (2002) Successful inactivation of endogenous Oct-3/4 and c-mos genes in mouse preimplantation embryos and oocytes using short interfering RNAs. Biochem Biophys Res Commun 296: 1372–1377.
- 43. Baron S, Poast J, Rizzo D, McFarland E, Kieff E (2000) Electroporation of antibodies, DNA, and other macromolecules into cells: a highly efficient method. J Immunol Methods 242: 115–126.
- 44. Nishi T, Yoshizato K, Yamashiro S, Takeshima H, Sato K, et al. (1996) High-efficiency in vivo gene transfer using intraarterial plasmid DNA injection following in vivo electroporation. Cancer Res 56: 1050–1055.
- 45. Fakhrai H, Dorigo O, Shawler DL, Lin H, Mercola D, et al. (1996) Eradication of established intracranial rat gliomas by transforming growth factor beta antisense gene therapy. Proc Natl Acad Sci U S A 93: 2909–2914.
- 46. Van Tendeloo VF, Ponsaerts P, Lardon F, Nijs G, Lenjou M, et al. (2001) Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells. Blood 98: 49–56.
- 47. Engstrom PE, Ivarsson K, Tranberg KG, Stenram U, Salford LG, et al. (2001) Electrically mediated drug delivery for treatment of an adenocarcinoma transplanted into rat liver. Anticancer Res 21: 1817–1822.
- 48. Rols MP, Delteil C, Golzio M, Dumond P, Cros S, et al. (1998) In vivo electrically mediated protein and gene transfer in murine melanoma. Nat Biotechnol 16: 168–171.
- 49. Montano X, Jimenez A (1995) Intracellular expression of the monoclonal anti-ras antibody Y13–259 blocks the transforming activity of ras oncogenes. Cell Growth Differ 6: 597–605.
- 50. Richardson JH, Marasco WA (1995) Intracellular antibodies: development and therapeutic potential. Trends Biotechnol 13: 306–310.
- 51. Tewari D, Goldstein SL, Notkins AL, Zhou P (1998) cDNA encoding a single-chain antibody to HIV p17 with cytoplasmic or nuclear retention signals inhibits HIV-1 replication. J Immunol 161: 2642–2647.