Figures
Abstract
The rainbowfishes of the family Melanotaeniidae represent one of the largest radiations of freshwater fishes from the Indo-Australian archipelago. A total of 75 nominal species have been described, among which several have become very popular among tropical fish hobbyists because of their tendency to form large schools of colourful individuals. Facing habitat loss and competition or predation by introduced species, this group has become a priority in the conservation of ornamental fishes in Indonesia. In this context, several expeditions have been conducted between 2007 and 2010 in Indonesian Papua with the aim to initiate a large-scale survey of the genetic resources in this group. We assessed the diversity of the Papua rainbowfishes with DNA barcoding. We sequenced the mitochondrial COI gene for 350 specimens belonging to 53 nominal species throughout the Indo-Australian archipelago. Unexpected levels of cryptic diversity and endemism were detected since additional cryptic lineages were detected in several watersheds from the Vogelkop and the Lengguru massif. DNA barcoding supports the presence of nearly 30 evolutionary lineages among the 15 nominal species sampled in the Vogelkop and all these lineages are endemic to a single lake or watershed. This result highlights that the diversity of the family has been largely underestimated and urges for the identification of conservation priorities in Papua.
Citation: Kadarusman, Hubert N, Hadiaty RK, Sudarto, Paradis E, Pouyaud L (2012) Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding: Implications for Conservation in a Biodiversity Hotspot Candidate. PLoS ONE 7(7): e40627. https://doi.org/10.1371/journal.pone.0040627
Editor: M. Alex Smith, University of Guelph, Canada
Received: February 7, 2012; Accepted: June 11, 2012; Published: July 19, 2012
Copyright: © 2012 Kadarusman et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Funding was provided by the french Fondation de la Recherche pour la Biodiversité, the COLAS Company in Indonesia, and the Veolia Environment Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: Funding was provided by the COLAS company in Indonesia. This does not alter the authors’ adherence to all the PLoS ONE policies on sharing data and materials.
Introduction
Species diversity is not evenly distributed on earth. Several regions, because they are exceptionally rich in endemic species and are facing massive habitat loss, have been identified as biodiversity hotspots [1]. Several terrestrial and marine biodiversity hotspots have been identified in the Indonesian archipelago as a consequence of unusual high levels of biodiversity threatened by increasing anthropogenic pressures [1], [2], [3]. In terrestrial biotas, two major hotspots have been identified on each side of the Wallace line: the Sundaland on the West including Borneo, Java, Sumatra and Bali, and Wallacea on the East including Sulawesi and Maluku [1]. Indonesian Papua and Papua New Guinea constitute New Guinea, the easternmost island of the Indonesian archipelago and currently one of the most poorly known regions of the world despite its proximity to remarkable biodiversity hotspots [4], [5], [6], [7].
Separated from Walacea by the Weber and Lydekker lines (Fig. 1), New Guinea is exceptionally rich in limestone karsts, some of the most inaccessible and understudied ecosystems in South East Asia [6], [7], [8], [9], [10]. Limestone karsts (karsts herein) are sedimentary outcrops mainly formed by reef-building corals in the past, erected above sea-level as a consequence of either tectonic activity or sea-level decrease and subsequently cleaned up from soft sediments through physical or chemical weathering [6]. These geological formations host a high diversity of species as a consequence of both a large array of ecological conditions due to complex landscapes from cliffs to subterranean structures and variable climatic conditions [9]. The presence of large karstic massifs is certainly one of the factors explaining why diversity and endemism is high in New Guinea [4], [5], [6], [7], [9]. At the same time, the anthropogenic pressure threatening karst biodiversity has significantly increased in South East Asia during the last decade as a consequence of mining [6], land burning for crop cultivation [11], logging activities [12], [13], and contamination [6].
The rainbowfishes of the family Melanotaeniidae provide a clear illustration of the biodiversity of New Guinea: (1) they represent one of the largest radiations of freshwater fishes from the Indo-Australian archipelago with 75 valid nominal species [14]; (2) a large number of species of the family are endemic to New Guinea where most species are confined to a single lake or tributary [4], [5], [14], [15], [16], [17], [18], [19]; (3) deforestation, mining activities and introduction of exotic species for aquaculture are increasing and constitute important threats to endemic species [5], [20]; and (4) several species of rainbowfishes are very popular among tropical fish hobbyists and catches in the field have dramatically increased during the last decade [14], [17].
Overall, species richness and number of endemic species are lower in New Guinea than in either Sundaland (Sumatra, Java, Borneo) or Wallacea (Sulawesi and Maluku) and, consequently, New Guinea has not been previously listed as a biodiversity hotspot candidate [1]. Given the deficit of biological prospection during the second half of the twentieth century compared to Borneo or Java [21], the number of endemic species may be expected to be underestimated and comparable to those observed elsewhere in the Indonesian archipelago. Considering the proliferation of threats on the ecosystems of New Guinea, extensive biological inventories are urgently needed to achieve conservation plans and identify priorities [22]. DNA barcoding, the use of a standardized molecular tag located in the mitochondrial cytochrome oxydase I gene for the identification of species [23], [24], has proven to be an effective tool for detecting cryptic diversity [25], [26], [27], [28]. In this context, we DNA-barcoded 350 specimens assigned with morphological characters to 53 nominal species of the families Melanotaeniidae and Atherinidae. All specimens were either collected during several expeditions conducted between 2007 and 2010 in Indonesian Papua, or obtained through the ‘Internationale Regenbogenfisch-Gesellschaft’ (IRG, the German association of rainbowfish hobbyists), which has successfully bred and maintained in captivity some referenced strains from New Guinea and Australia for several years. Overall, 15 among the 68 lineages found in the present study correspond to new and independent barcode clusters suggesting that both species diversity and endemism levels of the rainbowfishes of Papua are largely underestimated. Some implications for the conservation of the Papua freshwater biotas are discussed.
Materials and Methods
Four expeditions were conducted between 2007 and 2010 in Indonesian Papua with the aim to conduct a large-scale survey of the rainbowfishes diversity through an integrative approach including barcoding as a primer step. A total of 350 specimens were barcoded. The samples came from two distinct sources: (1) the four above-mentioned expeditions were conducted by the French Institut de Recherche pour le Développement (IRD), the Indonesian Agency of Marine and Fisheries Research and Development (AMFRAD), the Indonesian Institute of Sciences (LIPI), and the Fisheries Academy of Sorong (Akademi Perikanan Sorong, APS) in the framework of a collaborative effort on the domestication and conservation of Indonesian rainbowfishes; (2) several samples were obtained through the IRG. In order to insure that the newly sampled populations are not representatives of some Australian lineages, 29 Australian rainbowfish species were included in our analysis. All the Australian species were obtained through the IRG. Likewise, the four above-mentioned institutions (IRD, AMAFRAD, LIPI and APS) approved all the expeditions and the present study. For each specimen, detailed geographic information and photographs were recorded, and reference specimens were deposited as vouchers in publicly available collections: the Museum Zoologicum Bogoriense in Bogor (MZB, Indonesia), the Naturalis Museum in Leiden (RMNH, Netherlands), and the Muséum National d’Histoire Naturelle in Paris (MNHN, France). Identifications were done by several of the present authors based on morphological criteria (colour, meristic counts) currently recognized in recent monographs and available data on the species ranges.
Genomic DNA was extracted using the Genomic DNA mini Kit (Tissue) of Geneaid Ltd according to manufacturer specifications and further used with no dilution for amplification and sequencing. The complete cytochrome oxydase I gene (COI) was amplified (1800 bp) using the primers FMEL-5′TCTTAGTTAACAGCTAAGCGC3′ and RMEL-5′GCGTCTTGGAATCCTAGTTG3′ (present study). When amplifications failed using this set of primers, a 650-bp segment from the 5′ region was amplified using the alternative reverse primers RANG-5′GTTGCGGAGGTAAAATAGGC3′, RMUN-5′GTCGCGGAAGTGAAATAGGC3′, RVOG-5′GTTGCAGAGGTGAAATAGGC3′ and RCATH-5′TGTTGCAGAGGTAAAATAGGC3′ (present study). Double-stranded DNA amplifications were performed with the FastStart PCR Master kit from Roche Ltd in 26 µL total reaction volume containing 13 µL of 2× master mix, 2 µL of each primer (stock solution 10 µM), 5 µL of template DNA (250–1000 ng) and 4 µL of ddH2O. Amplifications were carried out with an initial denaturation step at 95°C for 3 min followed by a cycle of three steps (94°C for 1 min, 58°C for 2 min, 72°C for 2 min 30 sec) repeated 34 times and ended by a final extension at 72°C for 10 min. Both strands of purified PCR fragments were sequenced by GenoScreen (Lille, France) using BIGDYE 3.1 protocol on 3730 XL 96 capillary sequencers (Applied Biosystems) using the same primers as for amplifications.
All the sequences have been deposited in GenBank and BOLD [29]. Accession numbers for the barcodes, specimen and collection data, sequences, trace files and primer details are available within the ‘Barcoding Indonesian Fishes - part I. Rainbowfishes from Papua’ (BIFA) project file under the general container ‘Barcoding fish – FishBOL’ in BOLD (http://www.barcodinglife.org; Table S1). Sequence divergence was calculated using the Kimura 2-parameter (K2P) model and the mid-point rooted Neighbour-joining (NJ) tree of K2P distances was created to provide a graphic representation of the species divergence as implemented in the ‘Sequence Analysis’ module of BOLD (Fig. S1). The phylogenetic structure of rainbowfish lineages across the main geographic regions sampled here was assessed with the additive partitioning approach of Hardy and Senterre [30]. The index of phylogenetic community structure, denoted as ∏ST, was computed and its significance was tested through 10,000 permutations using the R package SpacodiR [31]. This index provides a standardized estimate of phylogenetic community structure: ∏ST <0 in case of phylogenetic dispersion across communities (i.e., species present in the same locality tend to be phylogenetically distant), whereas ∏ST >0 if communities are phylogenetically clustered (i.e., species present in the same locality tend to be more phylogenetically related than on average). Finally, several hypotheses on the substitution rates of mitochondrial genes were compared to our geology-based calibrations of substitution rate for COI using dated tectonic events in Papua (Fig. 1).
Results
A 1800-bp PCR product for the complete COI gene was generated for 252 of the 350 individuals using the primer set FMEL and RMEL. Alternatively, a 650-bp PCR product for the 5′ half of the COI gene was obtained for the 98 remaining individuals using the reverse primers RANG (25 individuals), RCATH (11), RMUN (2) and RVOG (60). No insertions/deletions or codon stops were found as expected in protein-coding functional sequences, and thus the sequences were easily aligned. The full K2P-NJ tree is available as Supplementary Information (Fig. S1). A total of 350 barcodes were recovered for two families including one unidentified species from the genus Craterocephalus (Atherinidae) and 52 identified species from the family Melanotaeniidae belonging to the genera Melanotaenia (38 species), Chilatherina (5), Glossolepis (8) and Iriatherina (1). In addition, 14 new localities for Melanotaenia and one new locality for Chilatherina were discovered during the 2007–2010 expeditions (Table S1). Overall, four major clades are highlighted within the genera Melanotaenia, Glossolepis and Chilatherina, all being polyphyletic according to the COI sequences (Table S1; Fig. 1, 2 and S1). The first clade includes all Melanotaenia species from the Vogelkop beginning in the tree of Figure S1 with M. arfakensis and ending with M. synergos. The first clade is further divided into three sub-clades: IA from the main Vogelkop including from M. arfakensis to M. sp6, IB in the South Vogelkop (Bomberaï) from M. irianjaya to M. sp9, and IC in the Northen Raja Ampat from M. catherinae to M. synergos (Fig. 1, 2 and S1; Table S1). The second clade is monospecific and includes the very divergent M. mairasi, an endemic species from the Lengguru massif. The third clade includes all the Melanotaenia species from Australia and South New Guinea (from M. pigmae to M. trifasciata in Fig. S1). The fourth clade is restricted to North New Guinea and includes the genera Glossolepis, Chilatherina and part of Melanotaenia with M. rubripinnis, M. affinis, M. maccullochi, M. praecox and M. vanheurni. We assessed phylogenetic community structure across the seven main regions covered by the present study, Raja Ampat, Volgelkop, Bomberaï, Lengguru, South New Guinea, North New Guinea and Australia (Fig. 2), and found a highly significant pattern of phylogenetic clustering (∏ST = 0.561, p-value <0.001). This result is consistent with the spatial structure depicted in Fig. 2.
A, Neighbour-joining tree of 360 COI barcodes with the four major clades identified. B, Map of the four clade range distributions.
Among the 52 species of Melanotaeniidae, the COI barcodes failed to capture species boundaries for 8 species of Melanotaenia and 3 species of Glossolepis whereas 30 species of Melanotaenia, 5 species of Glossolepis and the 5 species of Chilatherina exhibited non-overlapping COI clusters (Fig. S1). Mixed COI clusters were found between the populations of Melanotaenia angfa from Yakati and M. parva, among M. kamaka, M. lakamora and M. pierucciae, and between M. rubripinnis and Glossolepis leggeti from Wapoga (Fig. 1; Fig. S1). Interestingly, the populations found at the 14 new localities for Melanotaenia and the new locality for Chilatherina were all characterized by a private COI cluster suggesting their evolutionary distinctiveness from all the nominal species sampled in Papua (Fig. S1). Furthermore, these 15 new lineages were all distinct from the Australian species.
When considering the 53 identified species and these 15 new lineages, a steady increase in genetic variation with increasing taxonomic levels was observed (Table 1; Fig. 3). Overall, genetic divergence among congeneric species was 14-fold higher on average than among individuals of the same species, a ratio twice smaller, however, than previously observed for fishes [32], [33], [34]. As a consequence of mixed COI clusters between some species, the minimum K2P distance among species was zero within genus (Table 1). More surprisingly, haplotype sharing between species was detected within family and between genera as the same haplotype was found in M. rubripinnis and Glossolepis leggeti leading to a minimum K2P distance of zero (Table 1). The distribution of the K2P distance to the nearest-neighbour shows that most sister-species diverge by K2P distances of less than 1% in either Melanotaenia, Chilatherina, or Glossolepis (Table 2; Fig. 4). When comparing this distribution among clades, only clade III harbours K2P distance to the nearest-neighbour higher than 1% in most of the species pairs examined (Table 2).
The initial divergence among Clades I, II, III and IV was estimated to have occurred during the Miocene between 27.4 and 21 Myr according to the ‘minimum’ substitution rate or between 6.9 and 5.3 Myr according to the canonical ‘vertebrate’ substitution rate (Table 3). The canonical ‘fish’ substitution rate provided an intermediate estimate between 11.4 and 8.8 Myr which is contemporaneous with an important stage of orogenic activity in the area that led to the uplift of the Lengguru arch between 12 and 9 Myr (Table 3). Likewise, calibrating the substitution rate with the uplift of the Lengguru arch provided an estimate of substitution rate between 0.010 and 0.017 substitutions per Myr, which is more in agreement with the canonical ‘fish’ rate than the two others.
Discussion
The present DNA barcoding study has shown that the diversity of rainbowfishes in Papua is largely underestimated. This is particularly spectacular in the genus Melanotaenia where the 14 newly discovered populations exhibit private barcode clusters diverging from their nearest neighbor by K2P distances similar to those observed among valid species characterized by diagnostic morphological characters [14]. Altogether with the new lineage of Chilatherina, 15 new lineages of rainbowfishes are reported here. When compared with the 20 known species of Melanotaenia and Chilatherina sampled in West Papua during the present survey, DNA barcoding helped to highlight a cryptic diversity that almost multiply by two the number of known lineages in the area. By contrast, only 6 species among the 20 known species of Melanotaenia, Chilatherina and Glossolepis sampled in West Papua during the present study, exhibit complex boundaries that COI barcodes failed to capture (i.e., 13% of the 45 lineages sampled here). Thus, DNA barcoding was not only effective for the identification of species, but it proved to be effective for the discovery of provisional cryptic diversity awaiting further screening through integrative approaches as previously predicted by some authors [25], [26], [27], [28].
COI DNA barcoding has become an attractive approach for molecular identification due to the ease of amplification and sequencing of mitochondrial DNA, thanks to the large libraries of primers available and accessibility of this genome [35]. The maternal inheritance of this haploid genome, however, limits its power when applying to young species as a consequence of recent ancestry or hybridization that may prevent species delineation and identification if prior information is not available [36]. Hybridization has been previously reported in rainbowfishes including between species from distinct genera [17], [18], [19]. Here, only three cases of shared polymorphism were found between two species with mixed COI barcode clusters as Melanotaenia angfa (Lake Kurumoi) and M. parva, M. kamaka and M. pierucciae or M. rubripinnis and Glossolepis leggetti in the Wapoga River. Hybridization between Melanotaenia and Glossolepis is not unlikely since Melanotaenia is not monophyletic and encompass several lineages with at least two species (i.e., M. rubripinnis and M. affinis) more closely related to Glossolepis species than other Melanotaenia species. Interestingly, inter-generic hybridization has been previously reported between Melanotaenia and Chilatherina [17] and the presence of haplotype sharing makes the hypothesis of hybridization and introgression of mitochondrial DNA very likely [36]. These limitations, however, are unlikely to affect our estimation of the number of cryptic lineages since all the 15 new lineages identified here are spatially isolated and characterized by a private set of barcode cluster.
The pattern of cryptic diversity detected here largely confirms the importance of New Guinea and Papua for the biodiversity of the rainbowfishes and shed new light on the potential influence of this area in their evolution [18], [19], [37]. First, this survey confirms that most of the phylogenetic diversity is found in Papua since the four clades identified here are present there. Second, in agreement with the comparisons made here between previously published hypotheses of calibration of substitution rates [38], [39], [40] and the present geology-based calibrations [41], [42], it is likely that the uplift of the Lengguru massif is at the origin of the first cladogenetic events in the genera Melanotaenia, Chilatherina and Glossolepis and the emergence of the clades I, II, III and IV (Fig. 1 and 2). This assumption is supported by the agreement of the substitution rate estimates obtained through the specific calibration of COI for fishes [39] and the geology-based estimates obtained here [41], [42], which points to an early diversification stage in the Melanotaeniidae crown group around 11 Myr contemporaneous with the uplift of the Lengguru arch between 11 and 8 Myr. Furthermore, Clade 2 is constituted by a single species, Melanotaenia maerasi, endemic to the Lake Kuweri, a watershed that has been isolated during the uplift of the Lengguru Arch. Quite interestingly, M. maerasi is estimated to have emerged around 11 Myr and constitutes the oldest rainbowfish species reported to date. Third, Clades I and II are the oldest clades according to our estimations as their divergence is estimated to have occured around 11.4 Myr while the eastern clades III and IV are estimated to have diverged around 8.8 Myr (Fig. 2; Table 3). Altogether these results suggest that Western Papua including the Vogelkop is a persistence of the centre of origin of the group that probably took place in this area during the last 10 Myr, a result which has been previously suggested [18], [19] but needed a thorough molecular survey in West Papua.
The present study provides also some new insights on the evolution of biodiversity in New Guinea since the high number of lineages detected here, belonging to a single river or lake, confirms that karsts are highly fragmented landscapes which foster geographic isolation and promote endemism [4], [5], [6], [7]. Endemism levels are likely to be underestimated in Papua, however, as a consequence of the complexity of karstic landscapes and the remoteness of the area. Our results suggest that diversity might be twice as high as previously thought and endemism dominate in karstic communities. Yet, the estimated freshwater fish diversity and endemism of New Guinea freshwater fishes is lower than that observed in Borneo, Sumatra or Java which exhibit twice as many species [43]. Given the threats on their biodiversity, Borneo, Sumatra and Java have been identified as a biodiversity hotspot and a priority for conservation [1]. Our results suggest, however, that the number of endemic species may be actually higher in New Guinea than elsewhere in the Indonesian archipelago and that there might be no objective reasons to not consider New Guinea as a biodiversity hotspot for freshwaters in the future.
Several human activities are currently threatening natural ecosystems in New Guinea including logging, oil and gas concessions, mining activities, land burning for crop cultivation and development of new roads [44], [45]. Altogether, these threats have conducted to the physical degradation and contamination of the New Guinea inland water ecosystems further threatened by the harvesting of natural resources including fisheries and ornamental trade but also the introduction of exotic species [4], [9], [15], [20]. Many rainbowfish species are tightly restricted to single lakes or small watersheds and as such, they are highly vulnerable to environmental disturbances [15], [17], [37]. As a consequence, 7 species of the genus Melanotaenia from the 20 species reported here from Papua are already considered threatened according to Conservation International 2002 and IUCN 2009. Conservation of the rainbowfishes biodiversity is challenging, however, as reproductive compatibilities among species seem to be maintained long time after speciation leading to ease of hybridization even among inter-generic species [18], [19], [37]. The great diversity of phenotypes found in the family, which is at the origin of its success in the aquarium trade, however, is tightly linked to the maintenance of their genetic diversity as previously reported for other emblematic species of the aquarium fish trade [46], [47]. As a consequence, conservation programs implying breeding plans should pay attention to hybridization in order to prevent the loss of phenotypic diversity or alter fitness in natural populations through translocation programs. Considering the large amount of cryptic diversity discovered here, this is undoubtedly a challenging task.
Supporting Information
Figure S1.
Neighbour-joining tree of 360 COI barcodes belonging to the 69 species examined here and extracted from BOLD.
https://doi.org/10.1371/journal.pone.0040627.s001
(PDF)
Table S1.
Details of species and specimens. Barcode of Life Database (BOLD) specimen numbers given, along with GenBank accession numbers, geographic locality and voucher details. Assignation of each species and specimens to one of the four major clades according to the neighbour-joining tree (Fig. S1) are indicated here.
https://doi.org/10.1371/journal.pone.0040627.s002
(XLS)
Acknowledgments
We thank all people in West Papua for their warm welcome and more especially to O. Ihalauw (Head Regency of Sorong Selatan), S. Kocu and E. Krenak (Dinas Perikanan Sorong Selatan). G. Yarangga, I. Damayanti and their staff (Dinas Perikanan dan Kelautan Kabupaten Kaimana), M. Mairuma (Head Regency Kaimana), A. Yokab (District Arguni Bawah), M. Bogra (District Arguni Atas), I. W. Subamia and R. Gustiano (Litbang-KKP), M. Wanma (Head Regency of Raja Ampat), J.B. Rahawarin (Dinas Perikanan Raja Ampat), Muhfizar and the staff from the APSOR, A.J. Arief (Kabid Zoologi LIPI), K. Amas, J.L Sroyer and their staff from BTNLTC Manokwari, N. Rumkorem and P. Lesubun (Dinas Perikanan Manokwari), A. Fabanyo (Dinas Perikanan Sorong), M. Kadam (Dinas Perikanan Teluk Wondama), I.M Suyasa (Dinas Perikanan Nabire), A. Manibui (Head Regency of Teluk Bintuni), H. Hieronimus (President IRG), G. Maebe, J. Félix and M. Dielen (IRG Belgium). Many thanks to the people that participated to the expeditions namely J. Slembrouck, Sumanta, D. Caruso, R. Bourhis, V. Roubinet, A. Ajambua, C. Tournadre, R.Ogistira, J. Chantung, A. Pairing, Ridwan and G.S. Wibawa, N. Lemauk, P. Ruwe, S. Sauri, I.N.B Hismayasari, A. Suruwaky, R.V Kusumah and S. Cindelaras. We thank G.R. Allen and P. Unmack for helpful comments on the previous descriptions of new species, R.R. de Ruiter, M.J.P. van Oijen and J.I.J. Smit for their kind help during our visit at Naturalis Museum (Leiden), B. Dreyfus, M. Legendre, M. Larue, JP Toutain for their support (IRD), C. Voy (COLAS), V. Sitorus (PT. ABS) and C. Vanbelle for the scientific papers compilation. Finally, we thank the academic editor, Alex Smith, and the two anonymous reviewers for their helpful comments on a previous version of the manuscript. This is publication ISEM 2012–052.
Author Contributions
Conceived and designed the experiments: K LP NH. Performed the experiments: K NH RKH S EP LP. Analyzed the data: K NH EP LP. Contributed reagents/materials/analysis tools: K RKH S. Wrote the paper: K NH LP. Obtained sampling permits: K RKH S.
References
- 1. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2002) Biodiversity hotspots for conservation priorities. Nature 403: 853–858.
- 2. Roberts CM, McClean CJ, Veron JEN, Hawkins JP, Allen GR, et al. (2002) Marine biodiversity hotspots and conservation priorities for tropical reefs. Science 295: 1280–1284.
- 3. Mora C, Chittaro PM, Sale PF, Kritzer JP, Ludsin SA (2003) Patterns and processes in reef fish diversity. Nature 421: 933–936.
- 4.
Polhemus DA, Allen GR (2006) Freshwater biogeography of Papua. In: Marshall AJ, Beehler BM, editors. Singapore: Periplus Editions.
- 5.
Polhemus DA, Englund RA, Allen GR (2004) Freshwater biotas of new guinea and nearby islands: analysis of endemism, richness, and threats. 68 p.
- 6. Clements R, Sodhi NS, Schilthuizen M, Ng PKL (2006) Limestone karsts of Southeast Asia: imperiled arks of biodiversity. Bioscience 56: 733–742.
- 7. Clements R, Ng PKL, Lu XX, Ambu S, Schilthuizen M, et al. (2008) Using biogeographical patterns of endemic land snails to improve conservation planning for limestone karsts. Biological Conservation 141: 2751–2764.
- 8. Dennis C, Aldhous P (2004) Biodiversity: a tragedy with many players. Nature 430: 396–398.
- 9.
Marshall AJ (2006) The diversity and conservation of Papua’s ecosystems. In: Marshall AJ, Beehler BM, editors. Singapore: Periplus Editions.
- 10.
Marshall AJ, Beehler BM (2006) The ecology of Papua. Singapore: Periplus Editions.
- 11. Schilthuizen M, Liew TS, Bin Elehan B, Lackman-Ancrenaz I (2005) Effects of karst forest degradation on pulmonate and prosobranch land snail communities in Sabah, Malaysian Borneo. Conservation Biology 19: 949–954.
- 12.
Kiew R (1991) The limestone flora. In: Kiew R, editor. pp. 42–50. Kuala Lumpur (Malaysia): Malayan Nature Society.
- 13. Culver DC, Master LL, Christman MC, Hobbs HH (2000) Obligate cave fauna of the 48 contiguous united states. Conservation Biology 14: 386–401.
- 14.
Tappin AR (2011) Rainbowfishes - Their care & keeping in captivity. Second edition: Art publications.
- 15.
Allen GR (2006) Fishes of Papua. In: Marshall AJ, Beehler BM, editors. pp. 637–653. Singapore: Periplus Editions.
- 16.
Froese R, Pauly D (2011) Fishbase. (06/2011).
- 17.
Allen GR, Cross NJ (1982) Rainbowfishes of Australia and Papua New Guinea. New Jersey: T.F.H. Publications.
- 18. McGuigan K, Zhu D, Allen GR, Moritz C (2000) Phylogenetic relationships and historical biogeography of melanotaeniid fishes in Australia and New Guinea. Marine & Freshwater Research 51: 713–723.
- 19. Zhu D, Jamieson A, Hugall A, Moritz C (1994) Sequence evolution and phylogenetic signal in control-region and cytochrome b sequences of rainbowfishes (Melanotaeniidae). Molecular Biology and Evolution 11: 672–683.
- 20.
Fraser S (2006) Threats to biodiversity. In: Marshall AJ, Beehler BM, editors. pp. 1199–1229. Singapore: Periplus Editions.
- 21.
Frodin DG (2006) Biological exploration of New Guinea. In: Marshall AJ, Beehler BM, editors. pp. 14–107. Singapore: Periplus editions.
- 22.
Burnett JB (2006) Setting priorities and planning conservation in Papua. In: Marshall AJ, Beehler BM, editors. pp. 1230–1250. Singapore: Periplus Editions.
- 23. Hebert PDN, Cywinska A, Ball SL, de WaardJR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B 270: 313–321.
- 24. Hebert PDN, Gregory TR (2005) The promise of DNA barcoding for taxonomy. Systematic Biology 54: 852–859.
- 25. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences, USA 101: 14812–14817.
- 26. Smith AM, Rodriguez JJ, Whitfield JB, Deans AR, Janzen DH, et al. (2008) Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proceedings of the National Academy of Sciences, USA 105: 12359–12364.
- 27. Smith MA, Wood DM, Janzen DH, Hallwachs W, Hebert PDN (2007) DNA barcodes affirm that 16 species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are not all generalists. Proceedings of the National Academy of Sciences, USA 104: 4967–4972.
- 28. Hubert N, Meyer C, Bruggemann JH, Guérin F, Komeno RJL, et al. (2012) Cryptic diversity in Indo-Pacific coral reef fishes revealed by DNA-barcoding provides new support to the centre-of-overlap hypothesis. PLoS one 7: e28987.
- 29. Ratnasingham S, Hebert PDN (2007) Molecular ecology notes 7: 355–364. Bold: The barcode of life data system (www.barcodinglife.org).
- 30. Hardy OJ, Senterre B (2007) Characterizing the phylogenetic structure of communities by an additive partitioning of phylogenetic diversity. Journal of Ecology 95: 493–506.
- 31. Eastman JM, Paine CET, Hardy OJ (2011) spacodiR: structuring of phylogenetic diversity in ecological commuities. Bioinformatics 27: 2437–2438.
- 32. Hubert N, Hanner RH, Holm E, Mandrak NE, Taylor EB, et al. (2008) Identifying Canadian freshwater fishes through DNA barcodes. PLoS one 3: e2490.
- 33. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA barcoding Australia’s fish species. Phylosophical Transactions of the Royal Society B 360: 1847–1857.
- 34. April J, Mayden RL, Hanner RH, Bernatchez L (2011) Genetic calibration of species diversity among North America’s freshwater fishes. Proceedings of the National Academy of Sciences, USA 108: 10602–10607.
- 35. Schindel D, Miller SE (2005) DNA barcoding, a useful tool for taxonomist. Nature 435: 17.
- 36. Funk DJ, Omland KE (2003) Species-level paraphyly and polyphyly: frequency, causes and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology and Systematic 34: 397–423.
- 37.
Allen GR (1995) Rainbowfishes in nature and the aquarium. Melle, Germany: Tetra Publications.
- 38. Read CI, Bellwood DR, Herwerden van L (2006) Ancient origins of Indo-Pacific coral reef fish biodiversity: a case study of the Leopard wrasses (Labridae: Macropharyngodon). Molecular Phylogenetics and Evolution 38: 808–819.
- 39.
Bermingham E, McCafferty S, Martin AP (1997) Fish biogeography and molecular clocks: perspectives from the Panamanian isthmus. In: Kocher TD, Stepien CA, editors. pp. 113–128. San Diego: CA Academic Press.
- 40. Hardman M, Lundberg JG (2006) Molecular phylogeny and chronology of diversification for “phractocephaline” catfishes (Siluriformes: Pimelodidae) based on mitochondrial DNA and DNA recombination activating gene 2 sequences. Molecular Phylogenetics and Evolution 40: 410–418.
- 41.
Villeneuve M, Martini R, Bellon H, Réhault J-P, Cornée J-J, et al. (2010) Deciphering of six blocks of Gondwana origin within Eastern Indonesia (South East Asia). Gondwana Research. pp. 420–437.
- 42. Bailly V, Pubellier M, Ringenbach JC, de Sigoyer J, Sapin F (2009) Deformation zone ‘jumps’ in a young convergent setting; the Lengguru fold-and-thrust belt, New Guinea Island. Lithos 113: 306–317.
- 43. Abell R, Thieme ML, Revenga C, Bryer M, Kottelat M, et al. (2008) Freshwater ecoregions of the world: A new map of biogeographic units for freshwater biodiversity conservation. Bioscience 58: 403–414.
- 44.
Mertens B (2002) Spatial analyses for the rapid assessment of conservation and economy (RACE) in Papua. Centre for International Forestry Research.
- 45. McAlpine JR, Freyne DF (2001) Land use change and intensificarion in Papua New Guinea 1975–1996. Asia PAcific Viewpoint 42: 209–218.
- 46. Steinke D, Zemlak TS, Hebert PDN (2009) Barcoding Nemo: DNA-based identifications for the ornamental fish trade. PLoS one 4: e6300.
- 47. Sriwattanarothai N, Steinke D, Ruenwongsa P, Hanner R, Panijpan B (2010) Molecular and morphological evidence supports the species status of the mahachai fighter (Betta sp. mahachai) and reveals new species of Betta from Thailand. Journal of Fish Biology 77: 414–424.