Lack of Trehalose Accelerates H2O2-Induced Candida albicans Apoptosis through Regulating Ca2+ Signaling Pathway and Caspase Activity

Hui Lu; ZhenYu Zhu; LingLing Dong; XinMing Jia; XuanRong Sun; Lan Yan; YiFeng Chai; YuanYing Jiang; YingYing Cao

doi:10.1371/journal.pone.0015808

Abstract

Trehalose is a non-reducing disaccharide and can be accumulated in response to heat or oxidative stresses in Candida albicans. Here we showed that a C. albicans tps1Δ mutant, which is deficient in trehalose synthesis, exhibited increased apoptosis rate upon H₂O₂ treatment together with an increase of intracellular Ca²⁺ level and caspase activity. When the intracellular Ca²⁺ level was stimulated by adding CaCl₂ or A23187, both the apoptosis rate and caspase activity were increased. In contrast, the presence of two calcium chelators, EGTA and BAPTA, could attenuate these effects. Moreover, we investigated the role of Ca²⁺ pathway in C. albicans apoptosis and found that both calcineurin and the calcineurin-dependent transcription factor, Crz1p, mutants showed decreased apoptosis and caspase activity upon H₂O₂ treatment compared to the wild-type cells. Expression of CaMCA1, the only gene found encoding a C. albicans metacaspase, in calcineurin-deleted or Crz1p-deleted cells restored the cell sensitivity to H₂O₂. Our results suggest that Ca²⁺ and its downstream calcineurin/Crz1p/CaMCA1 pathway are involved in H₂O₂ -induced C. albicans apoptosis. Inhibition of this pathway might be the mechanism for the protective role of trehalose in C. albicans.

Citation: Lu H, Zhu Z, Dong L, Jia X, Sun X, Yan L, et al. (2011) Lack of Trehalose Accelerates H₂O₂-Induced Candida albicans Apoptosis through Regulating Ca²⁺ Signaling Pathway and Caspase Activity. PLoS ONE 6(1): e15808. https://doi.org/10.1371/journal.pone.0015808

Editor: Gordon Langsley, INSERM U1016, Institut Cochin, France

Received: September 19, 2010; Accepted: November 23, 2010; Published: January 5, 2011

Copyright: © 2011 Cao et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the National Natural Science Foundation of China (No. 30630071, 30870105) and Shanghai Rising-Star Program (08QA14001). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Candida albicans is the most important human fungal pathogen, causing various diseases from superficial mucosal infections to life-threatening systemic disorders [1]–[3]. The number of clinical C. albicans infections worldwide has risen considerably in recent years, and the incidence of resistance to traditional antifungal therapies is also rising. Many existing antifungal therapies have unfortunate clinical side effects; therefore, strategies are needed to identify new targets for antifungal therapy.

In the past few years, it became evident that apoptosis might occur not only in multicellular, but also in unicellular organisms, such as fungi. The induction of cell apoptosis is considered as a new and promising strategy for antifungal therapy. It has been reported that Saccharomyces cerevisiae dies in an apoptotic manner in response to weak acid stress, oxidative stress, salt stress, and UV irradiation [4]–[7]. Ultrastructural and biochemical changes that are characteristic of apoptosis have also been reported in pathogenic fungi. C. albicans can be triggered to undergo an apoptotic cell death response when exposed to environmental stress such as H₂O₂, amphotericin B (AmB) or intracellular acidification. However, the mechanism of C. albicans apoptosis has not been fully revealed. Ras–cAMP–PKA was found to be involved in the apoptosis of C. albicans. Mutations that blocked Ras–cAMP–PKA signaling (ras1Δ, cdc35Δ, tpk1Δ, and tpk2Δ) suppressed or delayed the apoptotic response, whereas mutations that stimulated signaling (RAS1^val13 and pde2Δ) accelerated the rate of entry into apoptosis [8]–[10]. We recently found that CaMCA1, a homologue of Saccharomyces cerevisiae metacaspase YCA1, was involved in oxidative stress-induced apoptosis in C. albicans [11].

Trehalose, a non-reducing disaccharide, plays diverse roles, from energy source to stress protectant, and this sugar is found in bacteria, fungi, plants, and invertebrates but not in mammals [12]. In yeast, trehalose acts both as a main reserve of carbohydrates and as a cellular protector against a variety of nutritional and/or environmental stress challenges (oxidative, heat shock, osmotic and/or saline stress, xenobiotics etc.), increasing cell resistance to such insults [13]. The mechanism of trehalose protection is an active area of research that includes studies of the interaction of sugars with plasma membranes, the effects on cell osmotic responses, and the unique physicochemical properties of trehalose [14]. In yeast, trehalose is synthesized by a large enzyme complex comprising the two catalytic activities of trehalose biosynthesis. Trehalose-6-phosphate (Tre6P) synthase, encoded by TPS1, synthesizes Tre6P from glucose-6-phosphate and UDP-glucose. Tre6P is then hydrolyzed into trehalose by Tre6P phosphatase, encoded by TPS2 [15], [16]. In C. albicans, tps1/tps1 mutants are defective not only for Tre6P synthesis but also for growth on glucose or related rapidly fermented sugars and virulence [17], [18]. Previous work on C. albicans pointed to a specific role of trehalose in cellular protection against oxidative stress. A tps1/tps1 mutant was shown to be deficient in trehalose synthesis and was extremely sensitive to H₂O₂ exposure [19]. However, the underlying mechanism by which trehalose protects C. albicans from the injuries remains undefined.

Ca²⁺ is an important second messenger in developmental and stress signaling pathways. In fungi, Ca²⁺ is responsible for the regulation of several processes, including cation homeostasis, morphogenesis, virulence traits, and antifungal drug resistance [20]–[23]. A rise in cytoplasmic Ca²⁺ has been found to be responsible for pheromone-induced S. cerevisiae apoptosis [24]. Fungicidal activity of amiodarone is also tightly coupled to calcium influx [25]. A rise in cytosolic calcium activates the calcium-dependent signaling pathway via the phosphatase, calcineurin (consisting of a catalytic subunit A encoded by CMP1 and a regulatory subunit B encoded by CNB1) and the calcineurin-dependent transcription factor, Crz1p. In C. albicans, Ca²⁺ and its downstream calcineurin/Crz1p pathway are involved in azole resistance, cell morphogenesis and virulence [26]–[29].

In this study, we show that lack of trehalose can accelerate H₂O₂ -induced C. albicans apoptosis. Furthermore, this is linked to an increase of Ca²⁺ concentration and caspase activity. Addition or depletion of Ca²⁺ affected the cell death and caspase activity. Moreover, we investigated the role of Ca²⁺ signaling in C. albicans apoptosis, and found that both calcineurin-deleted and Crz1p-deleted cells showed decreased cell death and caspase activity compared to the wild-type cells. Expression of CaMCA1 in calcineurin-deleted or Crz1p-deleted cells restored the sensitivity to H₂O₂.

Results

Lack of Trehalose Accelerates H₂O₂-induced Apoptosis

In C. albicans, TPS1 encodes trehalose-6-phosphate (Tre6P) synthase that is required for trehalose synthesis. A tps1Δ mutant is deficient in trehalose accumulation. The impact of TPS1 mutation on trehalose accumulation is shown in Fig. 1A. Trehalose accumulation was increased in wild-type cells after 1 to 3 hours exposure to 1 mM H₂O₂. This increase did not appear in tps1Δ mutant.

Download:

Figure 1. Effects of trehalose accumulation on H₂O₂-induced apoptosis and ROS production.

(A) The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 1 mM H₂O₂ for up to 3 hours. At the indicated times, aliquots of cells were taken to measure trehalose content. (B) The cells were exposed to 1 mM H₂O₂. At the indicated times, aliquots of cells were taken to measure the intracellular ROS by POLARstar Galaxy with excitation at 485 nm and emission at 520 nm. (C) DNA damage of the cells after treatment with 1 mM H₂O₂ for 3 hours revealed by the TUNEL assay under a fluorescence microscope. (D) Percentage of cells that were classified as apoptotic by TUNEL assay after treatment with indicated concentrations of H₂O₂ for 3 hours using a BD FACS Calibur flow cytometer with excitation and emission wavelength settings at 488 and 520 nm, respectively. These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the control CAI4-EXP cells.

https://doi.org/10.1371/journal.pone.0015808.g001

Since it has been reported that H₂O₂ can induce apoptosis in C. albicans and reactive oxygen species (ROS) is an indicator of apoptosis [9], [22], we examined ROS generation of the cells with the fluorescent dye DCFH-DA. An increase of intracellular ROS level was observed in both tps1△ mutant and wild-type cells upon H₂O₂ treatment. However, this increase was even stronger in tps1△ mutant (Fig. 1B). Consistent with this, the tps1△ mutant showed a higher percentage of cells demonstrating ROS accumulation than the wild-type cells (Table 1).

Download:

Table 1. Percentages of cells demonstrating ROS accumulation after exposure to 1 mM H₂O₂ for the indicated time.

https://doi.org/10.1371/journal.pone.0015808.t001

To ascertain the role of trehalose in C. albicans apoptosis, we compared the apoptosis rate between the wild-type cells and tps1Δ mutant when exposed to different concentrations of H₂O₂. As shown in Fig. 1C, upon H₂O₂ treatment, the apoptosis rate of tps1Δ mutant was higher than wild-type cells. After 3 hours treatment with 2 mM H₂O₂, 78% of the tps1Δ mutant cells were apoptotic, while the apoptosis rate of the wild-type cells was 47%.

Lack of Trehalose Enhances Ca²⁺ Elevation And Caspase Activity

In S. cerevisiae, elevation of intracellular Ca²⁺ can lead to cell death [25]. We determined the intracellular Ca²⁺ upon H₂O₂ treatment using a fluorescent calcium indicator Fluo-3/AM. In the absence of H₂O₂, the intracellular levels of Ca²⁺ in both the tps1Δ mutant and wild-type cells were rather low and almost undetectable. After treatment with 1 mM H₂O₂ for 3 hours, both of the groups showed obvious elevation of intracellular Ca²⁺, while the tps1Δ mutant cells showed a higher level of Ca²⁺ than the wild-type cells (Fig. 2A, 2B).

Download:

Figure 2. Effects of trehalose accumulation on H₂O₂-induced Ca²⁺ elevation and caspase activity.

The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 1 mM H₂O₂ for 3 hours and stained with Fluo-3/AM. Ca²⁺ levels were determined by observing the fluorescence using a fluorescence microscope (A) or the POLARstar Galaxy (B). The caspase activity of the cells treated with 1 mM H₂O₂ for 3 hours was determined by staining the cells with D₂R and counting under a fluorescence microscope (C, D). Transcription levels of CaMCA1 in response to 1 mM H₂O₂ for 3 hours determined by real-time RT-PCR. The mRNA levels were normalized on the basis of their ACT1 levels. Gene expression was indicated as the fold increase of tps1△-EXP and tps1△-TPS1 cells relative to that of the wild-type (CAI4-EXP) strain (E). These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the control CAI4-EXP cells.

https://doi.org/10.1371/journal.pone.0015808.g002

Since we previously found that the caspase activity was increased in C. albicans apoptosis [11], here we investigated the caspase activity by staining the cells with D₂R, a nonfluorescent substrate, which is cleaved to green fluorescent monosubstituted rhodamine 110 and free rhodamine [10], [11], [30]. As shown in Fig. 2C and 2D, after treatment with 1 mM H₂O₂ for 3 hours, the cell number stainable by D₂R in the wild-type cells was 26%, while that in the tps1Δ mutant was 51%. Furthermore, the transcript levels of CaMCA1, which is responsible for caspase activity in C. albicans, were investigated by real time RT-PCR. As shown in Fig. 2E, in the absence of H₂O₂, there was no significant difference in the transcript level of CaMCA1 between the tps1Δ mutant and wild-type cells. However, a 4 fold increase of CaMCA1 transcript level was recorded in the tps1Δ mutant compared to that in the wild-type cells when exposed to 1 mM H₂O₂ for 3 hours.

Adding or Depleting Ca²⁺ Affected Apoptosis and Caspase Activity

Since the intracellular Ca²⁺ level could be increased by H₂O₂, especially in the tps1Δ mutant, we hypothesized that Ca²⁺ signaling might regulate C. albicans apoptosis, and the higher sensitivity of tps1Δ mutant to H₂O₂ might be due to its higher intracellular Ca²⁺ level. As shown in Fig. 3A, when we stimulated the intracellular Ca²⁺ level by adding CaCl₂ (0.5 mM), the apoptosis rate increased in both the tps1△ mutant and wild-type cells. Similar effects were observed when A23187 (0.5 µM), a calcium ionophore, was added. CaCl₂ and A23187 themselves at the concentrations tested had no effects on C. albicans growth. In addition, the presence of both CaCl₂ and A23187 resulted in an increased caspase activity in both the tps1△ mutant and wild-type cells (Fig. 3C).

Download:

Figure 3. Effects of adding or depleting Ca²⁺ on H₂O₂-induced apoptosis and caspase activity.

(A, B) The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 0.5 mM or 1 mM H₂O₂ for 3 hours in the absence or presence of CaCl₂ (0.5 mM), A23187 (0.5 µM), EGTA (1 mM), BAPTA (1 µM). Percentage of cells that were classified as apoptotic by TUNEL assay was shown. (C, D) Caspase activity determined by staining the cells with D₂R. These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the cells treated with the same concentrations of H₂O₂ only.

https://doi.org/10.1371/journal.pone.0015808.g003

Furthermore, we tested the effect of depleting Ca²⁺. As shown in Figure 3B, the presence of EGTA (1 mM), an extracellular calcium chelator, attenuated the H₂O₂-induced apoptosis in both tps1Δ mutant and wild-type cells, accompanied by the decrease of caspase activity (Fig. 3D). Similarly, when BAPTA (1 µM), an intracellular calcium chelator, was added, both the apoptosis rate and caspase activity in the two strains were decreased.

Deletion of Calcineurin or Crz1p Leads to a Decrease in Apoptosis and Caspase Activity

In C. albicans, calcineurin and Crz1p are two major proteins involved in Ca²⁺ signaling and play an important role in antifungal tolerance, cell morphogenesis and virulence [20], [21], [26]. So it is possible that the effects of Ca²⁺ on cell death are mediated by calcineurin and its downstream target Crz1p. To test this hypothesis, we examined the viability of calcineurin and Crz1p mutants [27] upon H₂O₂ treatment. After 3 hours treatment with 2 mM H₂O₂, 52% of wild-type cells were apoptotic while the apoptosis rates of cmp1Δ and crz1Δ mutants were 19% and 25%, respectively. In the cmp1Δ-CMP1 and crz1Δ-CRZ1 cells which contain reintroduced CMP1 and CRZ1 gene, the apoptosis rate was similar to the wild-type cells (Fig. 4A). As expected, the caspase activities in both the cmp1Δ and crz1Δ mutants were lower than that in wild-type cells (Fig. 4B). Consistent with this, the transcription levels of CaMCA1 in cmp1Δ and crz1Δ mutants were much lower than that in the wild-type cells (Fig. 4C). The potential role of calcineurin in H₂O₂-induced apoptosis was further examined using the calcineurin inhibitor cyclosporin A. Upon H₂O₂ treatment, the wild type cells showed lower apoptosis rates and caspase activity in the presence of 0.08 µM cyclosporin A as compared to the absence of this compound (Fig. 4A, 4B).

Download:

Figure 4. Effects of CMP1 deletion, CRZ1 deletion or expression of CaMCA1 on H₂O₂-induced apoptosis and caspase activity.

The wild-type (CAI4-EXP), cmp1Δ-EXP, crz1Δ-EXP, cmp1Δ-CMP1, crz1Δ-CRZ1 camca1Δ, CAI4-CaMCA1, cmp1Δ-CaMCA1 and crz1Δ-CaMCA1 cells were exposed to 2 mM H₂O₂ for 3 hours. In another experiment, the wild-type cells were exposed to 2 mM H₂O₂ for 3 hours in the presence of cyclosporin A (0.08 µM). (A) Percentage of cells that were classified as apoptotic by TUNEL assay was shown. (B) The caspase activity was determined by staining the cells with D₂R. (C) Transcription level of CaMCA1 in response to 2 mM H₂O₂ for 3 hours was determined by real time RT-PCR. The mRNA levels were normalized on the basis of their ACT1 levels. Gene expression is indicated as the fold increase of the mutant and CaMCA1-introduced cells relative to that of the wild-type cells. The data are mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values of CAI4-EXP treated with H₂O₂ only. ** indicates P<0.01 compared with values of parental cells without CaMCA1.

https://doi.org/10.1371/journal.pone.0015808.g004

Expression of CaMCA1 in Calcineurin-deleted and Crz1p-deleted Cells Restored the Sensitivities to H₂O₂

Since the caspase activity was decreased in cmp1Δ and crz1Δ mutants upon H₂O₂ exposure, we introduced CaMCA1 into the cmp1Δ and crz1Δ mutants and assessed the phenotype. Upon H₂O₂ treatment, the apoptosis rates (Fig. 4A) and caspase activities (Fig. 4B) of the CaMCA1-introduced cells were much higher than the cmp1Δ and crz1Δ mutants. Consistent with this, the transcription levels of CaMCA1 in cmp1Δ and crz1Δ mutants were lower than that in the wild-type cells, while the transcription levels of CaMCA1 in the CaMCA1-introduced cells were similar to that in the wild-type cells (Fig. 4C). In addition, the apoptosis rates and caspase activities of the camca1Δ mutant were lower than the wild-type cells. These data indicated that CaMCA1 could restore the decreased apoptosis and caspase activities of calcineurin-deleted and Crz1p-deleted cells.

Discussion

In yeasts, trehalose acts both as a main reserve of carbohydrates and as a cellular protector against a variety of nutritional and/or environmental stress challenges, increasing cell resistance to such injuries. Trehalose accumulation in C. albicans has been described as a defense mechanism against oxidative stress. A trehalose-deficient tps1Δ mutant is highly sensitive to H₂O₂ and prone to undergo phagocytic digestion [31]. However, the mechanism by which trehalose protects C. albicans from injuries remains unclear. Since apoptosis is now considered as one of the important ways of C. albicans death, we assessed the role of trehalose in H₂O₂-induced apoptosis using a tps1△ mutant. According to our result, lack of trehalose could accelerate H₂O₂ -induced apoptosis which was accompanied by an increase of ROS, an apoptosis indicator. This result revealed a mechanism for the protective role of trehalose in C. albicans. Similar results were reported by other researchers. Liu et al. found that trehalose could inhibit the phagocytosis of refrigerated platelets in vitro via preventing apoptosis [32]. Also, trehalose has been found to protect against ocular surface disorders in experimental murine dry eye through suppression of apoptosis [33].

Our detailed studies on the protective effect of trehalose revealed a role of Ca²⁺ signals in C. albicans apoptosis. We observed that there was an increase of intracellular Ca²⁺ level in both the tps1△ mutant and wild-type cells upon H₂O₂ treatment. However, this increase was much stronger in tps1△ mutant, which was consistent with the higher apoptosis rate induced in this strain. When we stimulated the intracellular Ca²⁺ level by adding CaCl₂ or A23187, the apoptosis rates in both the tps1△ mutant and wild-type cells were increased. In contrast, when Ca²⁺ was depleted by adding EGTA or BAPTA, the apoptosis rates in both the tps1△ mutant and wild-type cells were decreased. These results indicated that apoptosis could be induced in C. albicans through increasing intracellular Ca²⁺ level.

The role of Ca²⁺ in C. albicans apoptosis was further examined by the experiments with CMP1 and CRZ1, two genes involved in Ca²⁺ signaling. We found that cmp1Δ and crz1Δ mutants showed attenuated apoptosis upon H₂O₂ treatment, similar to the effect of depleting Ca²⁺ in wild-type cells. Consistent with this result, addition of cyclosporin A, a calcineurin inhibitor, could also attenuate apoptosis. Taken together, Ca²⁺ and its downstream calcineurin/Crz1p pathway are involved in H₂O₂ -induced C. albicans apoptosis.

In mammals, apoptosis can be directed by the activation caspases, which cleave specific substrates and trigger cell death. In the past few years, it has become evident that caspases might exist not only in multicellular, but also in unicellular organisms, such as fungi. In S. cerevisiae, YCA1 encodes a single metacaspase, which has caspase activity. YCA1 is involved in the apoptosis of yeast cells exposed to different environmental stresses, such as H₂O₂, acetic acid, sodium chloride, heat shock, and hyperosmosis [34]–[36]. In plants, metacaspases have been associated with Norway spruce apoptosis during embryogenesis and tomato plant apoptosis induced by fungal infection [37]–[39]. Using yeast as a heterologous system for apoptosis evaluation, the metacaspases AtMCP1b and AtMCP2b from the plant Arabidopsis thaliana were also found to be involved in apoptosis induced by H₂O₂ [40]. We recently found that H₂O₂-induced C. albicans apoptosis was accompanied with caspase activity, which was encoded by CaMCA1 [11]. In this study, we found that, upon H₂O₂ treatment, the caspase activities in tps1△ mutant were much higher than those in wild-type cells, similar to the phenomena of intracellular Ca²⁺ levels. The positive relation between Ca²⁺ level and caspase activity was proved by adding or depleting Ca²⁺. Moreover, both calcineurin-deleted and Crz1p-deleted cells showed lower caspase activity compared to the wild-type cells, indicating that CaMCA1 might be a downstream gene which is blocked in calcineurin-deleted or Crz1p-deleted cells (Fig. 5). As expected, when extraneous CaMCA1 was introduced into these cells, the caspase activity and cell sensitivity to H₂O₂ were resumed. Previous studies showed that C. albicans CaMCA1 could be activated by Ca²⁺ and regulated by calcineurin and Crz1p. Moreover, CDRE (calcineurin-dependent responsive element) was found in the promoter of CaMCA1 [26]. Based on these results, we conclude that CaMCA1 is likely to be one of the downstream genes influenced by the Ca²⁺ signaling and involved with the protective role of trehalose against H₂O₂-induced apoptosis.

Download:

Figure 5. A model for the role of trehalose in the regulation of H₂O₂-induced apoptosis in C. albicans.

When C. albicans is exposed to H₂O₂, the intracellular Ca²⁺ is increased and its downstream calcineurin/Crz1p pathway is activated. The calcineurin inhibitor cyclosporin A can block this pathway. Crz1p might up-regulate the expression of CaMCA1 through binding to the CDRE (calcineurin-dependent responsive element) in the promoter of CaMCA1. The increased expression of CaMCA1 results in the increased caspase activity and thus apoptosis occurs. tps1△ mutation results in the lack of trehalose accumulation thus accelerates C. albicans apoptosis.

https://doi.org/10.1371/journal.pone.0015808.g005

Materials and Methods

Media and Compounds

Yeast media used were YPD (1% yeast extract, 2% peptone, and 2% glucose) and SD [0.67% (w/v) Difco yeast nitrogen base without amino acids]. SD medium was supplemented with a complete synthetic mix containing all the amino acids and bases. For prototrophic selection of yeast, the relevant drop-out mixes were used. Because the capacity of the trehalose-deficient mutant tps1/tps1 to grow on exogenous glucose and fructose as carbon source is seriously compromised, some experiments were carried out in YPgal medium (1% yeast extract, 2% peptone, and 2% galactose) or SDgal [0.67% (w/v) Difco yeast nitrogen base without amino acids, 2% galactose]. Escherichia coli strain DH5α and LB (0.5% yeast extract, 1% peptone, and 1% NaCl) medium were used for transformation and plasmid DNA preparation. Fluo-3/AM, CaCl₂, A23187, BAPTA, EGTA, cyclosporin A (Sigma, U.S.A.) were dissolved in either medium or dimethyl sulfoxide (DMSO) and then diluted to the appropriate working concentration.

Plasmids and Strain Construction

The strains (Table 2) were cultivated at 30°C under constant shaking (200 rpm) or incubation. To reintroduce TPS1 to tps1Δ mutant, the ORF of TPS1 was amplified (using upstream primer 5′ ggatccatggttcaaggaaaagtc 3′ and downstream primer 5′ ctgcagctagtccctcaaactcttttg 3′) with Pyrobest DNA polymerase (TaKaRa Biotechnology, Dalian, P.R. China). After being purified, the BamHI-PstI digested PCR fragment was cloned into the integrative expression vector pCaEXP (Table 3) to generate the recombinant plasmid pCaEXP-TPS1 [41]. After sequencing, pCaEXP-TPS1 was linearized and used to transform tps1Δ cells, and selected on SD medium lacking uridine, methionine and cysteine. As controls, the empty plasmid pCaEXP was transformed into CAI4 and tps1Δ cell to produce CAI4-EXP and tps1Δ-EXP, respectively. The same expression vector and transformation method were used for reintroducing CMP1 (using upstream primer 5′ ggatccatgtcaggaaatactgttcaa 3′ and downstream primer 5′ ctgcagttaactttgagataatcttct 3′) and CRZ1 (using upstream primer 5′ ggatccatgtctaacaatcctcatccc 3′ and downstream primer 5′ ctgcagctaagtaatttcaacaccact 3′) genes to their corresponding mutants, and introducing CaMCA1 (using upstream primer 5′ ggatccatgtttccaggacaaggtag 3′ and downstream primer 5′ ctgcagttaaaaaataaattgcaagtt 3′) to cmp1Δ and crz1Δ mutants and CAI4. The expression of TPS1, CMP1, CRZ1 and CaMCA1 in their host cells was confirmed by real time RT-PCR (data not shown).

Download:

Table 2. C. albicans strains used in this study.

https://doi.org/10.1371/journal.pone.0015808.t002

Download:

Table 3. Plasmids used in this study.

https://doi.org/10.1371/journal.pone.0015808.t003

Cell Treatment and Apoptosis Measurement

Yeast cells grown to early exponential phase at 30°C were exposed to different concentrations of H₂O₂ for the required time (range 0–3 hours) and then harvested for apoptosis measurement. A terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) assay was performed in order to confirm the occurrence of the apoptosis process [4]. C. albicans cells were washed twice with PBS and fixed with a solution of 3.6% paraformaldehyde in PBS for 1 hour at 20°C. Cells were rinsed twice with PBS and then incubated with permeabilization solution for 2 minutes on ice. The cells were rinsed in PBS and labeled, using a solution of the label and enzyme solutions from an in situ cell death detection kit, fluorescein (Roche Applied Sciences, Mannheim, Germany), with appropriate controls labeled only with the label solution. The cells were incubated for 1 hour at 37°C in a humidified atmosphere in the dark, rinsed in PBS. The staining of the cells was observed by a fluorescence microscopy. Alternatively, the number of cells determined to be positive by the TUNEL assay was quantified using a BD FACSCalibur flow cytometer with excitation and emission wavelength settings at 488 and 520 nm, respectively.

Assay of the Intracellular Content of Trehalose

For analysis of the intracellular trehalose, the cells grown to early exponential phase at 30°C were exposed to 1 mM H₂O₂ for 3 hours. At the indicated times, aliquots of cells (about 5×10⁸) were taken and immediately centrifuged and washed with cold distilled water. Samples were microwaved (700 W) for 3×60 seconds with 30 seconds intervals between each, 1 ml of distilled water was then used to extract the trehalose for 1 hour. After centrifugation at 15,000×g for 10 minutes, the trehalose in the supernatants was analyzed by HPLC-MS with a detection limit of 1 ng. An HPLC system (Agilent1100, Wilmington, Germany) equipped with a G1946 mass spectrometer was used in the analysis. The operating conditions were as follows: Extracts were analyzed after separation of an Agilent Zorbax NH2 Column (4.6 mm×250 mm, 5 mm) at a flow rate of 1.0 ml/min. The mobile phase consisted of methanol∶ water 85∶15 (v/v). The HPLC eluant from the DAD detector was introduced into the mass spectrometer via a 1∶3 split. The column temperature was 25°C. A quadrupole mass spectrometer equipped with an ESI interface was used to obtain mass spectra, which were then examined by SIM in negative mode. The nebulizing gas was at 40 psi, and the drying gas temperature was 350°C. The fragmentor was set to 70 V, and the capillary voltage was 3.5 kV. The cell weight was determined as follows: another sample of the same volume of the corresponding cell suspension was filtered through pre-weighed filters (0.22 µm pore size). After washing with PBS, the filters were dried at 37°C for 48 h and then weighed. The trehalose content was showed as nmol/mg.

Measurement of ROS Levels

Intracellular levels of ROS were measured with DCFH-DA (Molecular Probes, U.S.A.). Briefly, cultured cells were collected by centrifugation and washed three times with PBS. Subsequently, the cells were adjusted to 2×10⁷ cells/ml. After being incubated with 20 µg/ml of DCFH-DA for 30 minutes at 30°C, the cells were exposed to H₂O₂ and incubated at 30°C with constant shaking (200 rpm). At specified intervals, cell suspensions were harvested and examined by fluorescence microscope or transferred to the wells of a flat-bottom microplate (BMG Microplate, 96 well, Blank) to detect fluoresence intensity on the POLARstar Galaxy (BMG, Labtech, Offenburg, Germany) with excitation at 485 nm and emission at 520 nm.

Ca²⁺ Detection

Cells were loaded with 5 µM Fluo-3/AM for 30 minutes at 37°C. Ca²⁺ levels were determined by a fluorescence microscopy. Alternatively, fluorescence intensity values were determined on the POLARstar Galaxy (BMG, Labtech, Offenburg, Germany) with excitation at 488 nm and emission at 525 nm.

Assessment of Caspase Activity

Caspase activity was detected by staining with D₂R (CaspSCREEN Flow Cytometric Apoptosis Detection Kit, BioVision, U.S.A.) [10], [11], [41]. According to the manufacturer's instructions, cells were in D₂R incubation buffer at 30°C for 45 minutes before viewing and counting under a fluorescence microscope with excitation at 488 nm and emission at 530 nm.

Real-time RT-PCR

RNA isolation and real-time RT-PCR were performed as described previously [42]. The isolated RNA was resuspended in diethyl pyrocarbonate-treated water. The OD₂₆₀ and OD₂₈₀ were measured, and the integrity of the RNA was visualized by subjecting 2 to 5 µl of the samples to electrophoresis through a 1% agarose-MOPS gel. First-strand cDNAs were synthesized from 3 µg of total RNA in a 60 µl reaction volume using the cDNA synthesis kit for RT-PCR (TaKaRa Biotechnology, Dalian, P.R. China) in accordance with the manufacturer's instructions. Triplicate independent quantitative real-time PCR were performed using the LightCycler System (Roche diagnostics, GmbH Mannheim, Germany). SYBR Green I (TaKaRa) was used to visualize and monitor the amplified product in real time according to the manufacturer's protocol. CaMCA1 was amplified with the forward primer 5′-TATAATAGACCTTCTGGAC-3′ and the reverse primer 5′- TTGGTGGACGAGAATAATG-3′.

The PCR protocol consisted of denaturation program (95°C for 10 seconds), 40 cycles of amplification and quantification program (95°C for 10 seconds, 60°C for 20 seconds, 72°C for 15 seconds with a single fluorescence measurement), melting curve program (60–95°C with a heating rate of 0.1°C per second and a continuous fluorescence measurement) and finally a cooling step to 40°C. A standard curve for each primer set was performed with 1∶10, 1∶25, 1∶50, 1∶100, 1∶250 and 1∶500 dilutions of the cDNAs. The slopes of the standard curves were within 10% of 100% efficiency. The change in fluorescence of SYBR Green I dye in every cycle was monitored by the LightCycler system software, and the threshold cycle (C_T) above background for each reaction was calculated. The C_T value of ACT1 (amplified with the forward primer 5′-CAACAAGGACAATACAATAG-3′ and the reverse primer 5′- GTTGGTGGACGAGAATAATG -3′) was subtracted from that of the tested genes to obtain a ΔC_T value. The ΔC_T value of an arbitrary calibrator was subtracted from the ΔC_T value of each sample to obtain a ΔΔC_T value. The gene expression level relative to the calibrator was expressed as 2^−ΔΔCT.

Acknowledgments

We thank Professor William A. Fonzi for kindly providing the C. albicans strains CAI4. We thank Professor Dominique Sanglard for kindly providing the C. albicans strains DSY2091 and DSY2195. We thank Professor Carlos Gancedo for kindly providing the C. albicans tps1Δ strain.

Author Contributions

Conceived and designed the experiments: YYC YYJ YFC. Performed the experiments: HL ZYZ LLD XRS. Analyzed the data: ZYZ XMJ LY. Wrote the paper: YYC ZYZ.

References

1. Fidel PL Jr (2006) Candida-host interactions in HIV disease: relationships in oropharyngeal candidiasis. Adv Dent Res 19: 80–84.
- View Article
- Google Scholar
2. Perlroth J, Choi B, Spellberg B (2007) Nosocomial fungal infections: epidemiology, diagnosis, and treatment. Med Mycol 45: 321–346.
- View Article
- Google Scholar
3. Redding SW, Zellars RC, Kirkpatrick WR, McAtee RK, Caceres MA, et al. (1999) Epidemiology of oropharyngeal Candida colonization and infection in patients receiving radiation for head and neck cancer. J Clin Microbiol 37: 3896–3900.
- View Article
- Google Scholar
4. Madeo F, Frohlich E, Frohlich KU (1997) A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol 139: 729–734.
- View Article
- Google Scholar
5. Madeo F, Fröhlich E, Ligr M, Grey M, Sigrist SJ, et al. (1999) Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 145: 757–767.
- View Article
- Google Scholar
6. Madeo F, Herker E, Maldener C, Wissing S, Lachel S (2002) A caspase-related protease regulates apoptosis in yeast. Mol Cell 9: 911–917.
- View Article
- Google Scholar
7. Silva RD, Sotoca R, Johansson B, Ludovico P, Sansonetty F (2005) Hyperosmotic stress induces metacaspase- and mitochondria-dependent apoptosis in Saccharomyces cerevisiae. Mol Microbiol 58: 824–834.
- View Article
- Google Scholar
8. Phillips AJ, Sudbery I, Ramsdale M (2003) Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc Natl Acad Sci USA 100: 14327–14332.
- View Article
- Google Scholar
9. Phillips AJ, Crowe JD, Ramsdale M (2006) Ras pathway signaling accelerates programmed cell death in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA 103: 726–731.
- View Article
- Google Scholar
10. Al-Dhaheri RS, Douglas LJ (2010) Apoptosis in Candida biofilms exposed to amphotericin B. J Med Microbiol 59: 149–157.
- View Article
- Google Scholar
11. Cao YY, Huang S, Dai BD, Zhu ZY, Lu H, et al. (2009) Candida albicans cells lacking CaMCA1-encoded metacaspase show resistance to oxidative stress-induced death and change in energy metabolism. Fungal Genet Biol 46: 183–189.
- View Article
- Google Scholar
12. Arguelles JC (2000) Physiological roles of trehalose in bacteria and yeast: a comparative analysis. Arch Microbiol 174: 217–224.
- View Article
- Google Scholar
13. Richards AB, Krakowka S, Dexter LB, Schmid H, Wolterbeek APM, et al. (2002) Trehalose: a review of properties, history of use and human tolerance, and results of multiple safety studies. Food Chem Toxicol 40: 871–898.
- View Article
- Google Scholar
14. Elbein AD, Pan YT, Pastuszak I, Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17–27.
- View Article
- Google Scholar
15. Van Dijck P, DeRop L, Szlufcik K, VanAel E, Thevelein JM (2002) Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phosphate phosphatase decreases infectivity without affecting hypha formation. Infect Immun 70: 1772–1782.
- View Article
- Google Scholar
16. Zaragoza O, de Virgilio C, Ponton J, Gancedo C (2002) Disruptionin Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity. Microbiology 148: 1281–1290.
- View Article
- Google Scholar
17. Thevelein JM, Hohmann S (1995) Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem Sci 20: 3–10.
- View Article
- Google Scholar
18. Zaragoza O, Blazquez MA, Gancedo C (1998) Disruption of the Candida albicans TPS1 gene encoding trehalose-6P- synthase impairs formation of hyphae and decreases infectivity. J Bacteriol 180: 3809–3815.
- View Article
- Google Scholar
19. Alvarez P, Francisco J, Zaragoza O, Pedreno Y, Arguelles JC (2002) Protective role of trehalose during severe oxidative stress caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans. Microbiology 148: 2599–2606.
- View Article
- Google Scholar
20. Bader T, Schroppel K, Bentink S, Agabian N, Kohler G, et al. (2006) Role of calcineurin in stress resistance, morphogenesis, and virulence of a Candida albicans wild-type strain. Infect Immun 74: 4366–4369.
- View Article
- Google Scholar
21. Cannon RD, Lamping E, Holmes AR, Niimi K, Tanabe K, et al. (2007) Candida albicans drug resistance: another way to cope with stress. Microbiology 153: 3211–3219.
- View Article
- Google Scholar
22. Hemenway CS, Heitman J (1999) Calcineurin. Structure, function and inhibition. Cell. Biochem Biophys 30: 115–151.
- View Article
- Google Scholar
23. Steinbach WJ, Reedy JL, Crame RA Jr, Perfect JR, Heitman J, et al. (2000) Calcineurin: Form and function. Physiol Rev 80: 1483–1521.
- View Article
- Google Scholar
24. Pozniakovsky AI, Knorre DA, Markova OV, Hyman AA, Skulachev VP, et al. (2005) Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast. J Cell Biology 168: 257–269.
- View Article
- Google Scholar
25. Gupta SS, Ton VK, Beaudr V, Rulli S, Cunningham K, et al. (2003) Antifungal activity of amiodarone is mediated by disruption of calcium homeostasis. J Biol Chem 278: 28831–28839.
- View Article
- Google Scholar
26. Karababa M, Valentino E, Pardini G, Coste AT, Bille J (2006) CRZ1, a target of the calcineurin pathway in Candida albicans. Mol Microbiol 59: 1429–1451.
- View Article
- Google Scholar
27. Onyewu C, Wormley FL, Perfec JR, Heitman J (2004) The calcineurin target, Crz1, functions in azole tolerance but is not required for virulence of Candida albicans. Infect Immun 72: 7330–7333.
- View Article
- Google Scholar
28. Sanglard D, Ischer F, Marchetti O, Entenza J, Bille J (2003) Calcineurin A of Candida albicans: Involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol 48: 959–976.
- View Article
- Google Scholar
29. Stathopoulos AM, Cyert MS (1997) Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev 11: 3432–3444.
- View Article
- Google Scholar
30. Vachova L, Palkova Z (2005) Physiological regulation of yeast cell death in multicellular colonies is triggered by ammonia. J Cell Biol 169: 711–717.
- View Article
- Google Scholar
31. Martínez-Esparza M, Aguinaga A, González-Párraga P, García-Peñarrubia P, Jouault T, et al. (2007) Role of trehalose in resistance to macrophage killing: study with a tps1/tps1 trehalose-deficient mutant of Candida albicans. Clin Microbiol Infect 13: 384–394.
- View Article
- Google Scholar
32. Liu Q, Xu L, Jiao SX, Wang TX, Song Y, et al. (2009) Trehalose inhibited the the phagocytosis of refrigerated platelets in vitro via preventing apoptosis. Transfusion 49: 2158–2166.
- View Article
- Google Scholar
33. Chen W, Zhang X, Liu M, Zhang J, Ye Y, et al. (2009) Trehalose protects against ocular surface disorders in experimental murine dry eye through suppression of apoptosis. Exp Eye Res 89: 311–318.
- View Article
- Google Scholar
34. Khan MA, Chock PB, Stadtman ER (2005) Knockout of caspase-like gene, YCA1, abrogates apoptosis and elevates oxidized proteins in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 102: 17326–1731.
- View Article
- Google Scholar
35. Madeo F, Herker E, Wissing S, Jungwirth H, Eisenberg T (2004) Apoptosis in yeast. Curr Opin Microbiol 7: 655–660.
- View Article
- Google Scholar
36. Wadskog I, Maldener C, Proksch A, Madeo F, Adler L (2004) Yeast lacking the SRO7/SOP1-encoded tumor suppressor homologue show increased susceptibility to apoptosis-like cell death on exposure to NaCl stress. Mol Biol Cell 15: 1436–1444.
- View Article
- Google Scholar
37. Bozhkov PV, Suarez MF, Filonova LH, Daniel G, Zamyatnin AA, et al. (2005) Cysteine protease mcII-Pa executes programmed cell death during plant organogenesis. Proc Natl Acad Sci USA 102: 14463–14468.
- View Article
- Google Scholar
38. Hoeberichts FA, ten Have A, Woltering EJ (2003) A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves. Planta 217: 517–522.
- View Article
- Google Scholar
39. Suarez MF, Filonova LH, Smertenko A, Savenkov EI, Clapham DH, et al. (2004) Metacaspase-dependent programmed cell death is essential for plant embryogenesis. Curr Biol 14: R339–40.
- View Article
- Google Scholar
40. Watanabe N, Lam E (2005) Two Arabidopsis metacaspases AtMCP1b and AtMCP2b are arginine/lysine-specific cysteine proteases and activate apoptosis-like cell death in yeast. J Biol Chem 280: 14691–14699.
- View Article
- Google Scholar
41. Care RS, Trevethick J, Binley KM, Sudbery PE (1999) The MET promoter: a new tool for Candida albicans molecular genetics. Mol Microbiol 34: 792–798.
- View Article
- Google Scholar
42. Wang Y, Cao YY, Jia XM, Cao YB, Gao PH, et al. (2006) Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free Radical Biol Med 40: 1201–1209.
- View Article
- Google Scholar

[ref1] 1. Fidel PL Jr (2006) Candida-host interactions in HIV disease: relationships in oropharyngeal candidiasis. Adv Dent Res 19: 80–84.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Perlroth J, Choi B, Spellberg B (2007) Nosocomial fungal infections: epidemiology, diagnosis, and treatment. Med Mycol 45: 321–346.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Redding SW, Zellars RC, Kirkpatrick WR, McAtee RK, Caceres MA, et al. (1999) Epidemiology of oropharyngeal Candida colonization and infection in patients receiving radiation for head and neck cancer. J Clin Microbiol 37: 3896–3900.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Madeo F, Frohlich E, Frohlich KU (1997) A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol 139: 729–734.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref5] 5. Madeo F, Fröhlich E, Ligr M, Grey M, Sigrist SJ, et al. (1999) Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 145: 757–767.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Madeo F, Herker E, Maldener C, Wissing S, Lachel S (2002) A caspase-related protease regulates apoptosis in yeast. Mol Cell 9: 911–917.
View Article
Google Scholar

[17] View Article

[18] Google Scholar

[ref7] 7. Silva RD, Sotoca R, Johansson B, Ludovico P, Sansonetty F (2005) Hyperosmotic stress induces metacaspase- and mitochondria-dependent apoptosis in Saccharomyces cerevisiae. Mol Microbiol 58: 824–834.
View Article
Google Scholar

[20] View Article

[21] Google Scholar

[ref8] 8. Phillips AJ, Sudbery I, Ramsdale M (2003) Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc Natl Acad Sci USA 100: 14327–14332.
View Article
Google Scholar

[23] View Article

[24] Google Scholar

[ref9] 9. Phillips AJ, Crowe JD, Ramsdale M (2006) Ras pathway signaling accelerates programmed cell death in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA 103: 726–731.
View Article
Google Scholar

[26] View Article

[27] Google Scholar

[ref10] 10. Al-Dhaheri RS, Douglas LJ (2010) Apoptosis in Candida biofilms exposed to amphotericin B. J Med Microbiol 59: 149–157.
View Article
Google Scholar

[29] View Article

[30] Google Scholar

[ref11] 11. Cao YY, Huang S, Dai BD, Zhu ZY, Lu H, et al. (2009) Candida albicans cells lacking CaMCA1-encoded metacaspase show resistance to oxidative stress-induced death and change in energy metabolism. Fungal Genet Biol 46: 183–189.
View Article
Google Scholar

[32] View Article

[33] Google Scholar

[ref12] 12. Arguelles JC (2000) Physiological roles of trehalose in bacteria and yeast: a comparative analysis. Arch Microbiol 174: 217–224.
View Article
Google Scholar

[35] View Article

[36] Google Scholar

[ref13] 13. Richards AB, Krakowka S, Dexter LB, Schmid H, Wolterbeek APM, et al. (2002) Trehalose: a review of properties, history of use and human tolerance, and results of multiple safety studies. Food Chem Toxicol 40: 871–898.
View Article
Google Scholar

[38] View Article

[39] Google Scholar

[ref14] 14. Elbein AD, Pan YT, Pastuszak I, Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17–27.
View Article
Google Scholar

[41] View Article

[42] Google Scholar

[ref15] 15. Van Dijck P, DeRop L, Szlufcik K, VanAel E, Thevelein JM (2002) Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phosphate phosphatase decreases infectivity without affecting hypha formation. Infect Immun 70: 1772–1782.
View Article
Google Scholar

[44] View Article

[45] Google Scholar

[ref16] 16. Zaragoza O, de Virgilio C, Ponton J, Gancedo C (2002) Disruptionin Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity. Microbiology 148: 1281–1290.
View Article
Google Scholar

[47] View Article

[48] Google Scholar

[ref17] 17. Thevelein JM, Hohmann S (1995) Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem Sci 20: 3–10.
View Article
Google Scholar

[50] View Article

[51] Google Scholar

[ref18] 18. Zaragoza O, Blazquez MA, Gancedo C (1998) Disruption of the Candida albicans TPS1 gene encoding trehalose-6P- synthase impairs formation of hyphae and decreases infectivity. J Bacteriol 180: 3809–3815.
View Article
Google Scholar

[53] View Article

[54] Google Scholar

[ref19] 19. Alvarez P, Francisco J, Zaragoza O, Pedreno Y, Arguelles JC (2002) Protective role of trehalose during severe oxidative stress caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans. Microbiology 148: 2599–2606.
View Article
Google Scholar

[56] View Article

[57] Google Scholar

[ref20] 20. Bader T, Schroppel K, Bentink S, Agabian N, Kohler G, et al. (2006) Role of calcineurin in stress resistance, morphogenesis, and virulence of a Candida albicans wild-type strain. Infect Immun 74: 4366–4369.
View Article
Google Scholar

[59] View Article

[60] Google Scholar

[ref21] 21. Cannon RD, Lamping E, Holmes AR, Niimi K, Tanabe K, et al. (2007) Candida albicans drug resistance: another way to cope with stress. Microbiology 153: 3211–3219.
View Article
Google Scholar

[62] View Article

[63] Google Scholar

[ref22] 22. Hemenway CS, Heitman J (1999) Calcineurin. Structure, function and inhibition. Cell. Biochem Biophys 30: 115–151.
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref23] 23. Steinbach WJ, Reedy JL, Crame RA Jr, Perfect JR, Heitman J, et al. (2000) Calcineurin: Form and function. Physiol Rev 80: 1483–1521.
View Article
Google Scholar

[68] View Article

[69] Google Scholar

[ref24] 24. Pozniakovsky AI, Knorre DA, Markova OV, Hyman AA, Skulachev VP, et al. (2005) Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast. J Cell Biology 168: 257–269.
View Article
Google Scholar

[71] View Article

[72] Google Scholar

[ref25] 25. Gupta SS, Ton VK, Beaudr V, Rulli S, Cunningham K, et al. (2003) Antifungal activity of amiodarone is mediated by disruption of calcium homeostasis. J Biol Chem 278: 28831–28839.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref26] 26. Karababa M, Valentino E, Pardini G, Coste AT, Bille J (2006) CRZ1, a target of the calcineurin pathway in Candida albicans. Mol Microbiol 59: 1429–1451.
View Article
Google Scholar

[77] View Article

[78] Google Scholar

[ref27] 27. Onyewu C, Wormley FL, Perfec JR, Heitman J (2004) The calcineurin target, Crz1, functions in azole tolerance but is not required for virulence of Candida albicans. Infect Immun 72: 7330–7333.
View Article
Google Scholar

[80] View Article

[81] Google Scholar

[ref28] 28. Sanglard D, Ischer F, Marchetti O, Entenza J, Bille J (2003) Calcineurin A of Candida albicans: Involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol 48: 959–976.
View Article
Google Scholar

[83] View Article

[84] Google Scholar

[ref29] 29. Stathopoulos AM, Cyert MS (1997) Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev 11: 3432–3444.
View Article
Google Scholar

[86] View Article

[87] Google Scholar

[ref30] 30. Vachova L, Palkova Z (2005) Physiological regulation of yeast cell death in multicellular colonies is triggered by ammonia. J Cell Biol 169: 711–717.
View Article
Google Scholar

[89] View Article

[90] Google Scholar

[ref31] 31. Martínez-Esparza M, Aguinaga A, González-Párraga P, García-Peñarrubia P, Jouault T, et al. (2007) Role of trehalose in resistance to macrophage killing: study with a tps1/tps1 trehalose-deficient mutant of Candida albicans. Clin Microbiol Infect 13: 384–394.
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref32] 32. Liu Q, Xu L, Jiao SX, Wang TX, Song Y, et al. (2009) Trehalose inhibited the the phagocytosis of refrigerated platelets in vitro via preventing apoptosis. Transfusion 49: 2158–2166.
View Article
Google Scholar

[95] View Article

[96] Google Scholar

[ref33] 33. Chen W, Zhang X, Liu M, Zhang J, Ye Y, et al. (2009) Trehalose protects against ocular surface disorders in experimental murine dry eye through suppression of apoptosis. Exp Eye Res 89: 311–318.
View Article
Google Scholar

[98] View Article

[99] Google Scholar

[ref34] 34. Khan MA, Chock PB, Stadtman ER (2005) Knockout of caspase-like gene, YCA1, abrogates apoptosis and elevates oxidized proteins in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 102: 17326–1731.
View Article
Google Scholar

[101] View Article

[102] Google Scholar

[ref35] 35. Madeo F, Herker E, Wissing S, Jungwirth H, Eisenberg T (2004) Apoptosis in yeast. Curr Opin Microbiol 7: 655–660.
View Article
Google Scholar

[104] View Article

[105] Google Scholar

[ref36] 36. Wadskog I, Maldener C, Proksch A, Madeo F, Adler L (2004) Yeast lacking the SRO7/SOP1-encoded tumor suppressor homologue show increased susceptibility to apoptosis-like cell death on exposure to NaCl stress. Mol Biol Cell 15: 1436–1444.
View Article
Google Scholar

[107] View Article

[108] Google Scholar

[ref37] 37. Bozhkov PV, Suarez MF, Filonova LH, Daniel G, Zamyatnin AA, et al. (2005) Cysteine protease mcII-Pa executes programmed cell death during plant organogenesis. Proc Natl Acad Sci USA 102: 14463–14468.
View Article
Google Scholar

[110] View Article

[111] Google Scholar

[ref38] 38. Hoeberichts FA, ten Have A, Woltering EJ (2003) A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves. Planta 217: 517–522.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref39] 39. Suarez MF, Filonova LH, Smertenko A, Savenkov EI, Clapham DH, et al. (2004) Metacaspase-dependent programmed cell death is essential for plant embryogenesis. Curr Biol 14: R339–40.
View Article
Google Scholar

[116] View Article

[117] Google Scholar

[ref40] 40. Watanabe N, Lam E (2005) Two Arabidopsis metacaspases AtMCP1b and AtMCP2b are arginine/lysine-specific cysteine proteases and activate apoptosis-like cell death in yeast. J Biol Chem 280: 14691–14699.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref41] 41. Care RS, Trevethick J, Binley KM, Sudbery PE (1999) The MET promoter: a new tool for Candida albicans molecular genetics. Mol Microbiol 34: 792–798.
View Article
Google Scholar

[122] View Article

[123] Google Scholar

[ref42] 42. Wang Y, Cao YY, Jia XM, Cao YB, Gao PH, et al. (2006) Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free Radical Biol Med 40: 1201–1209.
View Article
Google Scholar

[125] View Article

[126] Google Scholar

Lack of Trehalose Accelerates H₂O₂-Induced Candida albicans Apoptosis through Regulating Ca²⁺ Signaling Pathway and Caspase Activity

Lack of Trehalose Accelerates H₂O₂-Induced Candida albicans Apoptosis through Regulating Ca²⁺ Signaling Pathway and Caspase Activity

Figures

Abstract

Introduction

Results

Lack of Trehalose Accelerates H₂O₂-induced Apoptosis

Lack of Trehalose Enhances Ca²⁺ Elevation And Caspase Activity

Adding or Depleting Ca²⁺ Affected Apoptosis and Caspase Activity

Deletion of Calcineurin or Crz1p Leads to a Decrease in Apoptosis and Caspase Activity

Expression of CaMCA1 in Calcineurin-deleted and Crz1p-deleted Cells Restored the Sensitivities to H₂O₂

Discussion

Materials and Methods

Media and Compounds

Plasmids and Strain Construction

Cell Treatment and Apoptosis Measurement

Assay of the Intracellular Content of Trehalose

Measurement of ROS Levels

Ca²⁺ Detection

Assessment of Caspase Activity

Real-time RT-PCR

Acknowledgments

Author Contributions

References

Figures

Abstract

Introduction

Results

Lack of Trehalose Accelerates H2O2-induced Apoptosis

Lack of Trehalose Enhances Ca2+ Elevation And Caspase Activity

Adding or Depleting Ca2+ Affected Apoptosis and Caspase Activity

Deletion of Calcineurin or Crz1p Leads to a Decrease in Apoptosis and Caspase Activity

Expression of CaMCA1 in Calcineurin-deleted and Crz1p-deleted Cells Restored the Sensitivities to H2O2

Discussion

Materials and Methods

Media and Compounds

Plasmids and Strain Construction

Cell Treatment and Apoptosis Measurement

Assay of the Intracellular Content of Trehalose

Measurement of ROS Levels

Ca2+ Detection

Assessment of Caspase Activity

Real-time RT-PCR

Acknowledgments

Author Contributions

References

Lack of Trehalose Accelerates H₂O₂-induced Apoptosis

Lack of Trehalose Enhances Ca²⁺ Elevation And Caspase Activity

Adding or Depleting Ca²⁺ Affected Apoptosis and Caspase Activity

Expression of CaMCA1 in Calcineurin-deleted and Crz1p-deleted Cells Restored the Sensitivities to H₂O₂

Ca²⁺ Detection