Identification of the Gene Trap Insertion Site

Long range PCR kit (Roche) was applied for candidate forward primers designed for 5 Kb intervals of intron 12 of the Mcph1-gene. One common reverse primer specific to the vector sequence was applied in all reactions (5′- CTTCCTGTAGCCAGCTTTCATCAACATT-3′). Amplification with forward primers P18 (5′-GAGGAAAAATCTCTCACATCTCCACACG-3′) and P19 (5′- TCAAGTTCACCTCCAACTAAAGGGAAGG–3′) resulted in the amplification of distinct PCR-products of approximately 6.5 kb and 1.5 kb, respectively. PCR conditions were used as follows: 92°C for 10 sec for the first 10 cycles then 15 sec in the next 25 cycles, extension at 68°C for 4 min in the first 10 cycles adding 20 sec per cycle for the next 25 cycles. Final extension was at 68°C for 7 min. Subsequently, the PCR products were analyzed by sequence analysis on a 3730 DNA Analyzer (Applied Biosystems) applying standard procedures.

Quantitative Real-Time PCR

For relative quantification total RNA was isolated from brain, liver and spleen of 3 Mcph1^gt/gt and 3 wild type mice (of same age and generation) using TRIzol (Invitrogen), in accordance with the manufacturer's instructions. First strand synthesis was performed with 2 µg of total RNA using SuperScript III First-Strand Kit (Invitrogen). First strand samples from 50 ng RNA were used for real-time PCRs. qPCRs were carried out using POWER SYBR® GREEN PCR Master Mix (Applied Biosystems) and Applied Biosystems 7500 Real-Time PCR System according to the manufacturer's recommendations. Forty five two-step cycles were performed (15 s at 95°C and 60 s at 60°C). Relative quantification was achieved by the ΔΔCt-method using Mcph1-specific primers F1: 5′-ACTCTCTGAAACCTTCCCTGCAG-3′ and R1: 5′-GGCGCTATGAACATCTTCGG- 3′, F2: 5′-ACTCTCTGAAACCTTCCCTGCAG-3′ and R2: 5′-GGCGCTATGAACATCTTCGG-3′, and Hprt-specific primers F: 5′-TGCTCGAGATGTCATGAAGG-3′ and R: 5′-AATCCAGCAGGTCAGCAAAG-3′.

For absolute quantification the PCR products of Hprt and the wild type and trap alleles of Mcph1 were cloned using the Topo 2.1 Cloning Kit (Invitrogen). The Mcph1-specific primers described above and a primer pair amplifying the Mcph1-trap fusion (F: 5′-TAGAGTTGGGCCACTGGATTTCT-3′ and R: 5′-CTGCGTTCTTCTTCTTTGGTTTTC-3′) were used for PCR cloning. The plasmid concentrations were determined by UV photometry. The plasmids were diluted to generate standard curves from 10⁹ copies/µl to 10⁰ copies/µl. First strand synthesis was performed as described above. First strand samples from 50 ng RNA were used for real-time PCRs. Homogeneous loading was controlled by comparing the Ct-values of β-actin primers F: 5′-CGTGAAAAGATGACCCAGATCA-3′, R: 5′-GGGACAGCACAGCCTGGAt-3′. The respective Ct-values of the Hprt, and Mcph1 wild type and trap alleles were related to the standard curves. The absolute number of target copies per microgram total RNA was calculated and compared in brain, liver, spleen, and fibroblasts between wild type and Mcph1^gt/gt mice.

Generation of the Mcph1 Deficient Mice

The RR0608 ES cells (129/OLA) were microinjected into blastocysts from C57BL/6 mice. Chimeras were identified by coat color and crossed with wild type C57BL/6. Germline transmission resulted in two heterozygote animal, a male and a female, which were crossed inter se. Pairing of heterozygous animals resulted in viable homozygous offspring. All animal experiments were performed according to institutional guidelines. Mice were genotyped by PCR with primers flanking the integration site for the wild type allele (wt-F 5′-AGCCCAGAGCCTAGAGAGGA-3′, wt-R 5′-ATCTGTGCATAGGAGACAACACTGATAG-3′) and a forward primer flanking the 5′-integration site and a reverse primer specific for the trap vector identifying the trapped allele (gt-F 5′-TGCCTATGTGCAATGTTTCAA-3′, gt-R 5′-TGACCTTGGGCAAGAACATA-3′) resulting in PCR products of 989 bp and 181 bp, respectively. PCR conditions for the wild type allele were 96°C for 10 s, 56.5°C for 45 s, 70°C for 1 min 15 s for a total of 35 cycles. The trap allele was amplified by 35 cycles of 96°C for 10 s, 52°C for 45 s, 72°C for 45 s.

Establishment of Fibroblast Cultures

Mouse tail tips or peritoneum pieces were washed in Earle's Medium containing antibiotics, cut into small pieces and transferred to falcon tubes for trypsin-collagenase treatment. Tail tips were trypsinized for 1 h at 37°C with 0.5% trypsin-EDTA. Subsequently, the supernatant was removed and replaced by 10% collagenase/DMEM for 1 h at 37°C. The resulting cell suspension was washed and transferred to culture flasks. The cells were grown in DMEM supplemented with 15% fetal calf serum and antibiotics.

Chromosome Preparation and PLC-Assay

Cytogenetic preparations were performed on fibroblasts using standard diagnostic laboratory procedures to prepare metaphase spreads. Slides were stained by immersion in fresh 10% Giemsa stain for 10 min. 2,000 nuclei were counted and percentage of prophase/prophase-like and metaphase nuclei was determined among total nuclei.

Analysis of Cell Cycle Progression by ³[H]-Thymidine Autoradiography

Logarithmically growing mouse fibroblast cell lines were exposed for 10 min to 1 µCi/ml ³[H]-thymidine, washed twice with 37°C pre-warmed filtered sterile PBS, and harvested at one-hour intervals (1–4 hours after labeling). The slides were coated with nuclear track emulsion (Ilford) and exposed for one week. Autoradiograms were developed and stained with Giemsa. The labeling patterns of 100 prophases were scored for each time.

Decondensation Assay

Cytokinesis of primary mouse fibroblasts was blocked with 6 µg/ml of Cytochalasin B for 2 hs before harvesting. Cells were subjected to hypotonic treatment with 0.075 M of KCl for 2 min and were fixed two times with a 3∶1 mix of methanol and acetic acid, and the last fixation was in a 7∶1 mix of methanol and acetic acid. Nuclei were stained with Giemsa. Postmitotic cells were distinguished by their binucleate appearance. Slides were coded and n≥100 binucleated cells were counted from each sample.

Chromosomal Breakage Analysis

Logarithmically proliferating diploid fibroblast cultures were irradiated using an X-ray source (Muller MG 150, Ua  = 100 kV, I = 10 mA, filter 0.3 mm Ni, dosis rate: 2.1 Gy/min). Chromosomes were prepared at 3 hs and 6 hs after the time of irradiation as described above. Slides were coded and 25 metaphases were scored for each sample at each time point.

Flow Cytometry

Primary fibroblasts from three Mcph1^gt/gt and three wildtype mice were seeded (4.000 cells/cm²) in duplicate flasks. The cells were allowed to attach overnight. One culture of each strain was exposed to high-energy X-ray photons provided by a linear accelerator with dosimetry. The dosage level equaled 4 Gy. After another 2 h of incubation, matched irradiated and unirradiated cultures were harvested. The cells were washed in PBS and fixed in 2% para-formaldehyde. Permeabilization was by 90% methanol for 30 min on ice. Phospho-Histone H3 was detected by mouse monoclonal anti p-H3 primary antibody (Cell Signaling Technology, #9706) at a dilution of 1∶25 and goat anti-mouse IgG (H+L) Alexa Fluor 647-conjugated secondary antibody (Molecular Probes, A21237). DAPI was used as counterstain for DNA content and cell cycle distribution. HeCd and Ar laser excitation and fluorescence detection was performed on an analytical flow cytometer (Becton Dickinson, LSRII). p-H3-positive signals were expressed relative to all recorded events.

Preparation of Meiotic Chromosomes

Meiotic chromosomes were prepared from the testes of adult male mice by conventional chromosome preparation [20]. Briefly, the testes were cut into small pieces. After hypotonic treatment for 15 min at room temperature, the cells were fixed with acetic acid:methanol (1∶3). The cell suspension was dropped onto slides and stained with Giemsa.

Preparation of Testes Sections

Testes were fixed with Methacarn (60% methanol, 30% chloroform, 10% acetic acid), dehydrated in ethanol, substituted with xylene, and embedded in paraffin. Paraffin sections (5 µm thick) were stained with HE.

Immunofluorescence

Cells were grown on cover slips to approximately 70% confluency. Cells were fixed with 2% paraformaldehyde in PBS for 30 min. Permeabilization was performed on ice with 0.5% triton X-100/PBS for 5 min. Cover slips were blocked for 1 h in 3% BSA/PBS. Anti- p-H3-S10 (abcam), anti-Aurora B (abcam), anti-53BP1 (Novus), and anti-H2AX-Ser139 (Upstate) were used for immunodetection. Fluorescence staining was performed with secondary antibodies anti-mouse-TRITC (Sigma) and anti-rabbit (SantaCruz). Nuclei were counterstained with DAPI. For the analyses of the formation of DNA repair foci, cell cultures were treated for two hours before fixation with 0.5 µg/ml of the radiomimetic agent adriamycin or 10 µg/ml of the radiomimetic agent bleomycin to induce DNA double strand breaks.

Magnetic Resonance Imaging

To assess cerebral volume in vivo, wild-type (n = 5), and homozygous Mcph1^gt/gt (n = 11) were anaesthetized with 3% isoflurane (Forene, Abbot, Wiesbaden, Germany) mixed with O2 using a Vapor 2000 Vaporizer (Dräger Medical, Lübeck, Germany) and a flowmeter for O2/N2O. During the remainder of the imaging session anaesthesia was maintained with 1.5–2.0% isofluran. To ensure constant body temperature of 37°C mice were placed on a heated circulating water blanket. Respiration was monitored using Small Animal Monitoring & Gating System (SA Instruments, Stony Brook, New York, USA).

Brain images were acquired using a 7 Tesla Bruker rodent scanner (Pharmascan 70/16AS, Bruker BioSpin, Ettlingen, Germany) and a 20 mm Quadrature-Volume-Resonator.

High-resolution T2-weighted images of the whole brain including olfactory bulb and cerebellum were acquired with a 2D turbo spin-echo sequence (TR/TE  = 4059/36 ms, RARE factor 8.4 averages). 35 axial slices with a slice thickness of 0.5 mm, a field of view of 2.85×2.85 cm and a matrix of 256×256 were positioned over the whole brain resulting in an in plane resolution of 111 µm.

Calculation of Brain Volume

Calculation of brain volume was carried out using Analyze 5.0 software (AnalyzeDirect, Inc.; Lenexa USA). Brains were assigned with a Region of Interest Tool resulting in 3D object maps for each single mouse brain. The volumes of 3D maps were then automatically calculated.

Brain Proteome Analysis

Control and Mcph1^gt/gt mice at 15 weeks of age (n = 4) were sacrificed by cervical dislocation. All brains were immediately removed, weighted, the cortex removed, snap-frozen in liquid nitrogen and stored at −80°C for protein extraction. Total protein extracts were prepared from brain tissue. Frozen tissue, 1.6 parts v/w of buffer P (50 mM TRIZMA Base (Sigma-Aldrich, Steinheim, Germany), 50 mM KCl and 20% w/v glycerol at pH 7.5), supplemented with a final CHAPS concentration of 4% w/v in the sample, 0.08 parts of protease inhibitor solution I (1 Complete tablet (Roche Applied Science, Mannheim, Germany) dissolved in 2 mL of buffer 1) and 0.02 parts of protease inhibitor solution II (1.4 M pepstatin A and 1 mM phenylmethylsulfonyl fluoride in ethanol) were ground to fine powder in a mortar pre-cooled in liquid nitrogen. The tissue powder was transferred into a 2 mL tube (Eppendorf, Hamburg, Germany), quickly thawed and supplied with glass beads (0.034 units of glass beads per combined weight of tissue, buffers and inhibitors in mg; glass beads, 2.5 mm±0.05 mm diameter, Worf Glaskugeln GmbH, Mainz, Germany). Each sample was sonicated 6 times in an ice-cold water bath for 10 s each, with cooling intervals of 1 min 50 s in between. The homogenate was stirred for 30 min in buffer P without CHAPS at 4°C in the presence of 0.025 parts v/w of benzonase (Merck, Darmstadt, Germany) and a final concentration of 5 mM magnesium chloride in the sample. Subsequently, 6.5 M urea and 2 M thiourea were added, and stirring was continued for 30 min at room temperature until urea and thiourea were completely dissolved. The protein extract was supplied with 70 mM dithiothreitol (Biorad, Munich, Germany), 2% v/w of ampholyte mixture Servalyte pH 2–4 (Serva, Heidelberg, Germany), corrected by the amount of urea added (correction factor  =  sample weight prior to addition of urea/sample weight after addition of urea), and stored at −80°C. Protein concentrations were determined in sample aliquots without urea using Biorad DC Protein Assay according to the protocol supplied by the manufacturer.

Two-Dimensional Gel Electrophoresis

Protein samples were separated by the large-gel 2-DE technique developed in our laboratory as described previously [21]. The gel format was 40 cm (isoelectric focusing)×30 cm (SDS-PAGE)×0.75 mm (gel width). For isoelectric focusing (IEF) using the carrier ampholyte technique, we applied 6 L (∼20 g/L) protein extract of each sample to the anodic end of an IEF-gel and used a carrier ampholyte mixture to establish a pH-gradient from 3 to 10. Proteins were visualized in SDS-PAGE polyacrylamide gels by high sensitivity silver staining. 2-D gels were dried as described [21] and scanned at 300 dpi and 16 bits gray scale using a scanner (Microtek Scan Maker 9800XL, Evestar GmbH, Willich, Germany). The 2-D gel images were subsequently saved in Tiff format to avoid loss of quality due to compression.

After up-loading the 2-D gel images, protein spot patterns were evaluated by Delta2D imaging software version 3.6 (DECODON, Greifswald, Germany) as was already described recently in detail elsewhere [22]. Delta2D is our standard 2-D gel evaluation software and was validated already in many of our studies [23], [24], [25], [26], [27], [28]. Briefly, 2-D spot patterns of Mcph1^gt/gt and control mouse brains were matched using the Delta2D “exact” mode matching protocol. First sample pairs (Mcph1^gt/gt and control) were matched individually. Subsequently, all Mcph1^gt/gt gels were matched to create a “match link” between all 2-D spot patterns using match vectors [22]. Using “union” mode a fusion image was generated, including the visible spots for each 2-D gel. Only the fusion image was used for spot detection employing the following settings for Delta2D: local background region: 100, average spot size: 1, sensitivity: 100%. Spots were not edited manually after spot detection. About 2,000 spots on the fusion image were transferred to all other 2-D gel images for each time point. This ensures that for each stage investigated the ID for each spot on a gel is identical. Relative spot volume intensities (fractions of 100%) were used for quantitative protein expression analysis. After background subtraction, normalized spot intensity values were copied into Excel spreadsheets for statistical analysis. Data sets were analyzed applying a paired Student's t-Test.

Expression Profiling

Total RNA was isolated from brain, liver and spleen of 3 MCPH1^gt/gt and 3 wild type mice (of same age and generation) using TRIzol (Invitrogen), in accordance with the manufacturer's instructions. Aliquots of RNA samples (500 ng) were amplified according to the specifications of the Illumina Total Prep RNA Amplification Kit (Ambion, Austin, TX, USA). The cRNA samples were applied to the arrays of Sentrix^® Mouse-6 Expression BeadChip (Illumina, San Diego, CA, USA). Signal was developed with streptavidin-Cy3, and the Sentrix BeadChip was scanned with the Illumina BeadArray Reader. The DiffScore parameters were used to determine gene expression in the Illumina BeadStudio software program (v3.1.3.0). We utilized the rank-invariant method algorithm provided by BeadStudio Gene Expression Module for normalization of sample signals.

Characterization of the Gene Trap in the ES Cell Line RR0608

The gene trap vector used by BayGenomics contains a splice-acceptor sequence upstream of a reporter gene (β–geo, a fusion of β–galactosidase and neomycin phosphotransferase). The insertion of the vector into an intron of a gene results in a fusion transcript that joins the sequence of the exon lying 5′- to the insertion site and the β-geo reporter resulting in a truncated traceable fusion protein [29]. In the ES cell line RR0608 the gene trap vector inserted between exons 12 and 13 of the Mcph1 gene as identified by 5′RACE (BayGenomics database, http://baygenomics.ucsf.edu, now moved to http://www.genetrap.org/) resulting in a truncated protein lacking 97 amino acids in the most C-terminal BRCT-domain. The mutant allele will be referred to as Mcph1^gt. The truncated transcript was characterized by RT-PCR using gene and trap-specific primers and subsequent sequencing. Sequencing of the PCR product confirmed the fusion of Mcph1 exon 12 and the reporter.

It was crucial to identify the genomic insertion site, as the gene Angpt2 resides in intron 12 of the Mcph1 gene (Figure 1). Thus, the insertion of the gene trap may have disrupted Angpt2 which is a lethal condition in mouse [30]. For this purpose we subdivided the intron (intron size is 99,179 bp) into sections of approximately 5,000 bp by designing sequence specific forward primers. We then tried to achieve PCR amplification by long range PCR using a trap specific reverse primer. PCR using primer P19 (5′-TCAAGTTCACCTCCAACTAAAGGGAAGG-3′) resulted in the amplification of a 1,500 bp product. Subsequent sequencing of the PCR product determined the insertion site of the trap at the position 18,778,752 of the genomic sequence (USCS; version July 2007) c.2,176-9,486pGT2lxf, therefore, in a distance of approximately 37,200 bp of exon 1 of the Angpt2 gene (Figure 1A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Characterization of the gene trap allele.

(A) The vector was inserted into intron 12 of the Mcph1 gene. The gene Anpt2 is localized on the opposite strand within this intron. Flanking Mcph1 exons are displayed in black, Angpt2 exons are displayed in white and the vector is displayed as grey box. The vector inserted 37.2 kb upstream of exon 1 of Anpt2 and 9.49 kb upstream of exon 13 of Mcph1. (B) Relative quantification of residual wild type Mcph1-mRNA in tissues of Mcph1^gt/gt animals by real-time PCR. The expression of wild type Mcph1-mRNA is significantly reduced in all analyzed tissues, although a considerable residual amount of wild type Mcph1-mRNA is detected. (C) The expression levels of the β-geo-fusion-mRNA compared to residual wild type Mcph1-mRNA in different tissues of Mcph1^gt/gt animals expressed as the ratio of β-geo-fusion-mRNA to wild type Mcph1-mRNA. Wild type and β-geo-fusion-mRNA are expressed at roughly the same low levels. The absolute numbers of mRNA copies per microgram RNA were determined by quantitative PCR.

https://doi.org/10.1371/journal.pone.0009242.g001

Quantitative real time PCR confirmed that the expression of the Mcph1 wild type transcript is markedly reduced in different tissues of Mcph1^gt/gt mice. Primer pairs spanning introns 12 or 13 were used for the amplification of the Mcph1 wild type transcript. The relative quantification was achieved applying the ΔΔCT method. Normalization was reached using Hprt as endogenous reference gene, and RNA from wild type animals was used for standardization. We compared the expression in liver, brain, and spleen of three Mcph1^gt/gt animals to three controls by relative quantification. In Mcph1^gt/gt the mRNA level of wt Mcph1 was reduced to approximately 9%±2.5 in spleen, 19%±3.2 in liver, and 28%±4.3 in brain, indicating that the Mcph1 genetrap mutation results - as expected - in a preferential splicing of exon 11 of the Mcph1-gene to the gene trap vector. Obviously, however, alternative splicing allows a strongly reduced but still detectable expression of the wild type allele and this expression varies between different tissues (Figure 1B).

Residual wild type protein might be able to exert some function, however with significantly diminished activity due to its reduced abundance. In addition, even the trap-allele may adopt some Mcph1-functions because the genetrap truncates only the C-terminus of the protein. Therefore, we intended to further characterize the expression from both the wild type- and trap-allele. Unfortunately, we were not able to detect the wild type Mcph1 protein by western blotting neither in protein samples from wild type nor Mcph1^gt/gt animals. Also the β–geo reporter was not traceable in Mcph1^gt/gt neither by X-gal staining nor by anti-β–galactosidase antibodies. This may be explained by low expression rates of Mcph1. Therefore, we decided to perform an absolute quantification of the mRNAs of both alleles and an endogenous control gene (Hprt) in the different tissues by real time PCR. The results revealed that in comparison to the low-abundant endogenous control gene Hprt, Mcph1 is expressed at very low levels in all analyzed tissues. In wild type tissues the copy numbers of Mcph1 per microgram RNA compared to Hprt were 3.7±1.6 times less in spleen, 10.7±1.2 times less in liver, and 21.6±3.7 times lower in brain and accordingly even lower in the tissues of the Mcph1^gt/gt animals (76.9±21.1 times, 45.1±12.1 times, 46.3±3.6, respectively). Thus, our problems detecting the Mcph1 protein can be explained by these very low expression levels. Surprisingly, the analyses also revealed that the gene trap allele is expressed at approximately the same low level as the remaining wild type allele in the tissues of the Mcph1^gt/gt animals (the ratios of expressed gene trap to wild type allele were 0,85 in brain, 1,07 liver, and 0,68 in spleen, Figure 1c). Therefore, the addition of the β-geo cassette may either interfere with the regulation of gene expression or destabilize the mRNA expressed by the trap-allele. Thus, the low expression level not only may explain our problems detecting the reporter protein but also infers that it may not be possible for the fusion protein to substantially adopt Mcph1-functions.

Phenotypic Description of the Mice

Mcph1^gt/gt animals did not differ significantly in body weight compared to wild type animals (mean 32.3 g±1.8, n = 14 vs. 33.5 g±2.6, n = 12, respectively, unpaired t-testing results in a two-tailed P-value P = 0.193) (Figure 2A). By conventional criteria this difference is not considered to be statistically significant. Equally, the proportionate weight of the brains of Mcph1^gt/gt animals was not reduced as compared to wild type (mean 1.4%±0.21, n = 14 vs. 1.32±0.16, n = 12, respectively, P = 0.275), (Figure2B). Measurement of brain volumes by MRI supported these findings. The average volume of Mcph1^gt/gt brains (n = 11) was 522.5 mm³±22.8 compared to 514.4 mm³±10.4 in wild type animals (n = 4). Moreover MRI analyses did not reveal any obvious malformations of the brain (Figure 3). However, in one of the 11 Mcph1^gt/gt animals aplasia of the corpus callosum and atrophy of the 3^rd ventricle was found. Ventricular malformation indicates a midline defect caused by a developmental disorder of the forebrain (Figure 3A). This is rarely observed in mice, but as it represents a single event, it must be rated anecdotal, as long as no further incidences are found.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Evaluation of the physical phenotype of Mcph1^gt/gt mice.

Boxplots showing that Mcph1^gt/gt mice do not differ significantly from wild type animals concerning body weight (P = 0.193) (A) and the proportionate weight of their brains (% brain of body weight, P = 0.275) (B). Mcph1^gt/gt mice do not show a reduction in fertility (P = 0.441) (C). Kaplan-Meier survival curves of Mcph1^gt/gt compared to wild type mice show significantly reduced survival rates of Mcph1^gt/gt compared to wild type and heterozygote animals (D).

https://doi.org/10.1371/journal.pone.0009242.g002

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. T2-weighted MR images of Mcph1^gt/gt mouse brains.

(A) Different brain sections of the single Mcph1^gt/gt mouse presenting with hypoplasia of the corpus callosum (dark line, CC) and ventricular (light structures, V) malformation. (B) The brains of the majority of Mcph1^gt/gt mice showed normal forebrain anatomy and did not differ from those of WT animals. (C) Wild type mouse with normal forebrain anatomy.

https://doi.org/10.1371/journal.pone.0009242.g003

Most importantly however, the overall survival is reduced compared to wild type and heterozygous animals. 21 Mcph1^gt/gt, 17 heterozygous and 15 wt animals were maintained under standard conditions to examine survival. The difference in survival develops after animals have reached an age of >65 weeks and is statistically significant for the comparison of Mcph1^gt/gt and wt animals (log rank test χ² = 4.1818, P = 0.0409) as well as the comparison of Mcph1^gt/gt and heterozygous animals (log rank test χ² = 10.1002, P = 0.0015, Figure 2D). Unfortunately, we could so far not determine the precise causes of deaths for the Mcph1^gt/gt animals.

Analyses of Chromosome Condensation

Primary fibroblast cultures from 11 Mcph1^gt/gt mice and 12 wild type animals were established from mouse tails and propagated under standard conditions. Cytological preparations were made in parallel from those 11 Mcph1^gt/gt and 12 Mcph1^wt cultures to analyse chromosome morphology. The slides were coded and the fraction of prophase-like cells (PLCs) was determined by visual cell counts. 2,000 nuclei were counted from each sample and the proportion of nuclei with prophase-like morphology and the metaphase indices were determined. Mcph1^gt/gt cell lines showed a dramatic increase of nuclei displaying condensed prophase-like chromatin (7.7%±0.8) compared to wild type cell lines (1.0%±0.5, χ² = 1306.49, p<0.001) (Figure 4A). In contrast, the metaphase indices were at the same level: 0.6%±0.3 and 0.7%±0.2 for gt/gt and wt cell lines, respectively. The similar metaphase indices confirm similar proliferative activities in gt/gt and wt/wt cell cultures. Quantitative analyses in 5 heterozygous cell lines revealed no increase in the proportion of prophase-like cells (1.22%±0.5), an observation arguing against a potential dominant-negative effect of the gene trap allele.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Analyses of chromosome condensation behavior in Mcph1 ^gt/gt cells.

(A) Determination of the fraction of prophase-like cells (PLCs) and metaphase indices in Mcph1^gt/gt and WT cell cultures. Mcph1^gt/gt show significantly increased proportions of PLCs: 7.7% vs. 1.0% in WT cell cultures (χ² = 1306.49, p<0.001). In contrast, metaphase indices (MI) are within the range of wild type cell cultures, indicating comparable proliferative activity. (B) Cell cycle analysis after 3H-thymidine-pulse-labeling of logarithmically growing fibroblast cell lines from Mcph1^gt/gt (grey diamonds) and WT animals (white squares). The first labeled cells with prophase-like appearance in the Mcph1^gt/gt cells occur within the first hour after the pulse. (C) Proportion of cells with condensed chromosomes postmitosis in Mcph1^gt/gt and control cells. Many Cytochalasin-treated binucleated G1-cells of Mcph1^gt/gt cells show condensed chromatin (19.8%) compared with control cells (2.8%). (D) To the left one exemplary cell displaying premature chromosome condensation in the G2 phase of the cell cycle defined by focal (centromeric) staining of phosphorylated histone H3(-Ser10), note that the phosphorylation has not spread into the chromosome arms. To the right two cells showing delayed decondensation in G1 post-mitosis defined by the formation of a midbody.

https://doi.org/10.1371/journal.pone.0009242.g004

We determined the timing of chromosome condensation following S phase by ³[H]-thymidine pulse labeling. For this purpose, we compared one logarithmically growing diploid fibroblast cell line and one transformed cell line from Mcph1^gt/gt mice to wild type cell lines in 1 h intervals (1 h–4 h) by autoradiography after pulse-labeling with ³[H]-thymidine for 10 min. N≥100 prophases or prophase-like cells were scored per time point and per cell line and the proportion of labeled cells was determined. We observed a significant difference between the gt/gt and wt cell lines in the proportion of prophase/prophase-like cells that were labeled within this period. Already 1 h after the pulse, 12% of the prophase-like cells of the diploid gt/gt mouse but none of the prophase cells in the control showed 3H-thymidine labeling. After 2 h, 42% of PLCs in the diploid Mcph1^gt/gt cells and 12% of the prophases in wt cells were labeled (see Figure 4B). Similar results were obtained for the transformed cell lines. 1 h after the pulse 35% of PLCs were labeled in the Mcph1^gt/gt cell line compared to only 12% in the wild type (Figure S1). Consequently, chromosome condensation in the Mcph1^gt/gt cells starts in the early G2 phase of the cell cycle as soon as 1 h after the end of the S-phase or even earlier. Thus, the observed premature chromosome condensation phenotype described in the cells of human patients with MCPH1-deficiency is also found in mouse cells homozygous for the trap-allele.

To investigate the chromosome decondensation behavior of the Mcph1^gt/gt cell lines in the early G1 phase of the cell cycle we treated three logarithmically growing Mcph1^gt/gt fibroblast cell lines and three wild type fibroblast cell lines with the inhibitor of cytokinesis Cytochalasin B. Treatment with Cytochalasin B results in binucleated cells. Cytological preparations were performed following 2 hs of Cytochalasin treatment. Consequently, all binucleated cells must have exited mitosis within these two hours and, therefore, be in early G1 phase. 19.8% (± 2.7) of binucleated Mcph1^gt/gt cells displayed condensed chromatin, while only 2.8% (± 1.2) of wild type binucleated cells showed signs of chromatin condensation, (χ² = 84.32, p<0.001) (Figure 4C). Thus, there is a delayed decondensation in Mcph1^gt/gt cells.

These data were supported by immunofluorescence analyses. In normal prophases phosphorylation of histone H3 at serine 10 (p-H3) usually has spread to the chromosome arms while human MCPH1 cells show prophase like cells in the G2 phase of the cell cycle without full phospho-histone H3 labeling (Alderton et al, 2006). Similarly, we observed high numbers of equivalent cells in Mcph1^gt/gt fibroblast cultures. Figure 4D shows a cell displaying clearly condensed chromatin with only centromeric p-H3-labeling. These cells are accordingly in G2 and show prophase-like condensation but are different from normal prophases on a molecular level, because in normal prophases histone H3-phosphorylation has spread out over the whole chromosome arms (see Figure S2 for an exemplary normal prophase cell). Pairs of post-mitotic cells can be defined by the formation of a midbody between daughter cells. Following midbody staining with antibodies against Aurora B kinase, we observed a high proportion of post-mitotic cells with clearly condensed chromatin (Figure 4D). Therefore, these cells show delayed chromosome decondensation post-mitosis equal to cultured human fibroblasts with MCPH1 mutations [7]. In summary, these results confirm a defective chromosome condensation in the Mcph1^gt/gt cells similar to MCPH1-deficiency in human.

Meiosis and Fertility

We were interested whether the gene trap mutation may also perturb meiosis and in particular meiotic chromosome condensation. Therefore, male meiosis was investigated by the analyses of testes sections and conventional chromosome preparations. Testes sections show perfectly normal morphology with numerous mature sperm in the lumen. More than 20 metaphase I cells were investigated all of which showed perfectly normal pairing of the homologues. Thus, the analyses of male meiosis revealed normal progression through both meiotic divisions and the production of mature gametes (Figure 5).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Meiosis in male Mcph1^gt/gt germ cells.

(A) Section of a testes biopsy from a male Mcph1^gt/gt showing normal morphology, (B) diakinesis/metaphase I from a male Mcph1^gt/gt reveals normal pairing of the autosomal bivalents and the sex chromosomes (XY), (C) normal metaphase II cell from a male Mcph1^gt/gt. For comparison a diakinesis/metaphase I (D) and a metaphase II cell (E) from a male wt/wt mouse are presented.

https://doi.org/10.1371/journal.pone.0009242.g005

In addition, pairing homozygous Mcph1^gt/gt mice inter se revealed no reduction in fertility. Average litter size of gt/gt animals was 6.3±2.8 which is not significantly different from that of wild type animals 6.9±2.9 (two-tailed P-value, P = 0.441) (Figure 2C). Likewise, we could not identify any sex specific differences in the breeding success.

DNA Damage

Several reports attribute a crucial function in DNA damage response to microcephalin/BRIT1. Xu et al. (2004) and Lin et al. (2005) observed that downregulation of MCPH1 by RNAi impaired the ionizing radiation-induced G2/M checkpoint response in U2OS osteosarcoma cells. In contrast, accurate G2/M checkpoint function had previously been reported in MCPH1-mutated patient-derived lymphoblastoid cell lines [4]. In order to examine the DNA-damage induced G2/M checkpoint response in Mcph1^gt/gt mouse fibroblasts, phospho-histone H3 (Ser¹⁰) (p-H3) expression was studied as a mitotic marker. Using G2 phase irradiation under exactly identical conditions as described by Xu et al. (2004), flow cytometric analysis revealed a decrease of p-H3-positive Mcph1^gt/gt fibroblasts by 87.2% 2 h after provision of 4 Gy. For comparison, wildtype mouse fibroblasts treated in the same way showed a reduction of p-H3-positive cells by 81.2%. In triplicate experiments, these figures were not statistically significantly different (single-tailed t-test, p = 0.189). The corresponding figures 4 h after exposure towards 4 Gy were 86.8% p-H3 reduction in Mcph1^gt/gt fibroblasts and 79.6% reduction in wildtype fibroblasts (single-tailed t-test, p = 0.200). Therefore, decreased Mcph1 expression in Mcph1^gt/gt mouse fibroblasts is not associated with defective G2/M checkpoint functions. These data show that Mcph1^gt/gt mouse fibroblasts can efficiently prevent mitotic entry despite the gene trap mutation.

Moreover, it was reported that microcephalin function is essential for targeting DNA damage response proteins such as 53BP1 to DNA repair foci at the sites of DNA double strand breaks (Rai et al. 2006). The targeting of microcephalin/BRIT1 itself to the repair foci was assigned to the C-terminal BRCT-domains (Wood et al. 2007; Jeffers et al. 2008). Therefore, we explored whether the gene trap deleting the last C-terminal BRCT domain interfered with foci formation following DNA double strand break induction. In contrast to the reported results, the formation of 53BP1 foci that co-localized to γH2AX-foci seemed not disturbed in diploid fibroblast cell cultures of Mcph1^gt/gt mice following 2 hours treatment with 0.5 µg/ml of the radiomimetic agent adriamycin (Figure 6A). We did not observe any obvious difference in the formation of repair foci compared to wild type cell cultures. Possibly, this may be explained by residual wild type Mcph1 protein. Also the truncated protein produced by the gene trap allele may be sufficient to enable 53BP1 foci formation. Therefore, we repeated the experiment with cultures of transformed fibroblasts of wild type and Mcph1^gt/gt mice and depleted the cells of both Mcph1 wild type and Mcph1^gt alleles by RNAi. Quantitative real time PCR showed that Mcph1 and Mcph1^gt were efficiently depleted by >70% (Figure S3). Determination of the number of prophase-like cells confirmed that the depletion was efficient enough to induce the cellular phenotype of misregulated chromosome condensation (Figure S3). In wild type cells the number of prophase-like cells increased from 2.0%±0.3 to 11.8%±1.6 after siRNA treatment while the percentage of PLCs was not increased in Mcph1^gt/gt cells (11.1%±2.6 in the mock treated cells, 12,1%±2,2 in the siRNA treated cells). Again, there was no obvious difference in the formation of 53BP1-foci between wild type and Mcph1^gt/gt cells following the induction of DNA double strand breaks for 2 hs with 10 µg/ml bleomycin. Surprisingly, there was also no obvious difference between RNAi treated and mock treated cells neither in wt nor in Mcph1^gt/gt cells (see Figure 6B for overview pictures of the different preparations). To exclude a more subtle effect the different preparations were analyzed quantitatively. Several overview pictures were taken randomly from different areas of each preparation. The pictures were coded and foci numbers in >100 cells were scored for each sample from these coded pictures of single focal planes by four different evaluators in two experiments. Also the quantitative analysis revealed no difference between Mcph1^gt/gt and wild type cells. As well, there was no difference in foci numbers between RNAi treated and mock treated cells (Figure 6C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. DNA damage response in Mcph1^gt/gt cell culture.

(A) 53BP1 (green) localizes to repair foci in Mcph1^gt/gt cells induced by treatment with the radiomimetic drug adriamycin. The foci co-localize with γ-H2AX foci (red) confirming that the focal staining represents indeed repair foci at the sites of DNA double strand breaks. (B) Overview pictures of 53BP1 foci formation (red) in wild type and Mcph1^gt/gt cells following the induction of DNA double strand breaks by the radiomimetic drug bleomycin and treatment with Mcph1-siRNAs (bottom) and mock treatment (top). No obvious difference is detectable in the Mcph1^gt/gt cells or siRNA treated cells compared to the controls. (C) Quantitative analyses of the same experiments. No significant difference in the formation of 53BP1 foci in the Mcph1^gt/gt cells or siRNA treated cells compared to the controls could be detected. (D) Chromosomal breakage rates in Mcph1^gt/gt and wt cells following ionizing irradiation with 2 Gy. There is no significant difference between wild type and Mcph1^gt/gt cells.

https://doi.org/10.1371/journal.pone.0009242.g006

It was also reported that RNAi against MCPH1 results in chromosomal aberrations [14]. However, we do not observe an increase in chromosomal breakage rates in cells of Mcph1^gt/gt mice. Induced chromosomal breakage rates of Mcph1^gt/gt-cells following ionizing irradiation (2 Gy) were not different from those of wild type cells treated with the same dose (Figure 6D). Three gt/gt cell lines were compared to three wt cell lines. Chromosomes were prepared 3 h and 6 h after irradiation. The number of breaks was scored for 25 metaphases of each cell line at each data point. Unirradiated cell cultures were treated in exactly the same way as their irradiated counterparts. Combined breakage rates for all gt/gt-cultures were 3.36 breaks/cell ±0.66 (3 h after irradiation with 2 Gy) and 1.45 breaks/cell ±0.16 (6 h after irradiation with 2 Gy). The corresponding breakage rates for the wt-cultures were 3.03 breaks/cell ±0.76 and 1.40 breaks/cell ±0.53, respectively.

Effects on Gene Expression

It was repeatedly reported that MCPH1 would regulate protein and transcript levels of other genes such as hTERT, BRCA1 and CHK1 [11], [12], [31], [32]. Therefore, it was speculated that microcephalin/BRIT1 may function in transcriptional regulation [33]. Very recently an interaction of microcephalin/BRIT1 with the transcription factor E2F1 was described [34]. In this study, the C-terminal BRCT-domains were identified to be crucial for E2F1 binding and activation. Therefore, we investigated the effects of the gene trap mutation on gene expression in different tissues on RNA and protein level. We performed expression analyses using Sentrix^® Mouse-6 Expression BeadChip (Illumina, San Diego, CA, USA) comparing gene expression in brain, liver, and spleen of 3 Mcph1^gt/gt and 3 wildtype animals. (All information including the raw data can be downloaded from http://ws.molgen.mpg.de/ws/311013/MIAME.rar.) These analyses revealed no specific patterns of differentially regulated genes in the animal bearing the gene trap. In particular, in none of the three analyzed tissues did we find an enrichment of regulated genes in any of the pathways microcephalin/BRIT1 is known to be involved. (See Tables S1 and S2 (A-C) for the whole lists of genes differentially expressed at a significance level of P≤0.05, comparing tissues from Mcph1^gt/gt and wild type animals). Combining the data of all three tissues resulted in 39 genes commonly upregulated and 23 genes commonly downregulated with a P-value ≤0.05 in all three tissues of the Mcph1^gt/gt animals investigated (Figure S4 and Tables S1 and S2 (D-G)). We were unable to assign a specific function to these groups of genes. Interestingly, in all tissues we found more genes up- than downregulated. This was somewhat surprising given the reported role of microcephalin/BRIT1 in transcriptional activation [34]. More specifically, there was no significant reduction in the expression levels of Chk1, Brca1, Topbp1, Rad51, Ddb2, p73, Apaf1, or caspases which were all described to show reduced expression following MCPH1 knockdowns [34] (Tables S3, S4, S5).

In our proteomic investigation of Mcph1^gt/gt-brains we detected 4,006 protein isoforms. A total of 63 protein isoform alterations were found when comparing Mcph1^gt/gt to control brains. In contrast to the expression profiling, in this assay more protein isoforms (52) appeared to be downregulated than upregulated (11) (Table S6). Comparing the Mcph1^gt/gt data to proteomics studies of three neurodegenerative disorders (ND) it became obvious that the number of changes occurring in the brain of gt/gt mice, however, are a lot less numerous than in ND. We investigated mouse models of Huntington's- (HD) [28], Alzheimer's- (AD) [24] and Parkinson's disease (PD) [27]. In the brains of these model organisms a maximum of 240, 82 and 153 protein isoforms were altered compared to wild type animals, respectively. 4,283, 1,769 and 3,293 protein isoforms were studied for each ND, respectively. Correcting for the difference we obtained 5.6%, 4.6% and 4.6% of isoforms altered for HD, AD and PD. In Mcph1^gt/gt-brains, however, only 1.6% of all protein isoforms were altered. This is about 2.5 fold lower when compared to the neurodegenerative diseases described above. The lower number of changes correlates with a very mild phenotype found in MCPH1^gt/gt mice.