Search
Advanced Search
Metrics info
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article
Share this Article info
  • StumbleUpon Facebook Connotea CiteULike Bibliography
Public Library of Science

Open Access

Research Article

Intracellular Bacteria Encode Inhibitory SNARE-Like Proteins

Pathogens use diverse molecular machines to penetrate host cells and manipulate intracellular vesicular trafficking. Viruses employ glycoproteins, functionally and structurally similar to the SNARE proteins, to induce eukaryotic membrane fusion. Intracellular pathogens, on the other hand, need to block fusion of their infectious phagosomes with various endocytic compartments to escape from the degradative pathway. The molecular details concerning the mechanisms underlying this process are lacking. Using both an in vitro liposome fusion assay and a cellular assay, we showed that SNARE-like bacterial proteins block membrane fusion in eukaryotic cells by directly inhibiting SNARE-mediated membrane fusion. More specifically, we showed that IncA and IcmG/DotF, two SNARE-like proteins respectively expressed by Chlamydia and Legionella, inhibit the endocytic SNARE machinery. Furthermore, we identified that the SNARE-like motif present in these bacterial proteins encodes the inhibitory function. This finding suggests that SNARE-like motifs are capable of specifically manipulating membrane fusion in a wide variety of biological environments. Ultimately, this motif may have been selected during evolution because it is an efficient structural motif for modifying eukaryotic membrane fusion and thus contribute to pathogen survival.

Fabienne Paumet1*, Jordan Wesolowski1, Alejandro Garcia-Diaz2, Cedric Delevoye3, Nathalie Aulner4, Howard A. Shuman5, Agathe Subtil6, James E. Rothman2

1 Thomas Jefferson University, Department of Microbiology and Immunology, Philadelphia, Pennsylvania, United States of America, 2 Department of Cell Biology, Yale University, New Haven, Connecticut, United States of America, 3 Institut Curie, Structure et Compartiments Membranaires, CNRS-UMR144, Paris, France, 4 Institut Pasteur, Imagopole, Batiment Monod, Paris, France, 5 Department of Microbiology, Columbia University Medical Center, New York, New York, United States of America, 6 Institut Pasteur, Unité de Biologie des Interactions Cellulaires, CNRS-URA 2582, Paris, France

Abstract Top

Pathogens use diverse molecular machines to penetrate host cells and manipulate intracellular vesicular trafficking. Viruses employ glycoproteins, functionally and structurally similar to the SNARE proteins, to induce eukaryotic membrane fusion. Intracellular pathogens, on the other hand, need to block fusion of their infectious phagosomes with various endocytic compartments to escape from the degradative pathway. The molecular details concerning the mechanisms underlying this process are lacking. Using both an in vitro liposome fusion assay and a cellular assay, we showed that SNARE-like bacterial proteins block membrane fusion in eukaryotic cells by directly inhibiting SNARE-mediated membrane fusion. More specifically, we showed that IncA and IcmG/DotF, two SNARE-like proteins respectively expressed by Chlamydia and Legionella, inhibit the endocytic SNARE machinery. Furthermore, we identified that the SNARE-like motif present in these bacterial proteins encodes the inhibitory function. This finding suggests that SNARE-like motifs are capable of specifically manipulating membrane fusion in a wide variety of biological environments. Ultimately, this motif may have been selected during evolution because it is an efficient structural motif for modifying eukaryotic membrane fusion and thus contribute to pathogen survival.

Introduction Top

In eukaryotic cells, intracellular membrane fusion events are mediated by members of the SNARE protein family. SNAREs are conserved in all eukaryotes and are present on the surface of all secretory compartments [1], [2], [3]. During membrane fusion, t-SNAREs present on target organelles assemble into a four-helix bundle with the v-SNAREs present on vesicles. This event brings the membranes in which they are embedded into close apposition and drives bilayer fusion [4], [5], [6], [7]. The SNARE residues indispensable for membrane fusion form the “SNARE motif” [6], a 60 amino-acid sequence composed of coiled-coil heptad repeats [Table 1 and [8]]. Similar structural motifs are used for the same purpose by viruses, highlighting the general role of coiled coil sequences in manipulating membrane fusion [9], [10]. Here we investigated whether this particular motif is also utilized by bacteria to influence eukaryotic membrane fusion.

thumbnail

Table 1. SNARE motifs alignment.

doi:10.1371/journal.pone.0007375.t001

Intracellular bacteria such as Salmonella, Mycobacterium, Legionella or Chlamydia must manipulate membrane fusion of the host cells they inhabit in order to escape lysosomal fusion [11], [12]. While intracellular, these bacteria modify their infectious phagosomes, also called inclusions or vacuoles, by expressing their own proteins to the surface [13]. As a result, the infectious phagosomes become protected against fusion with endocytic compartments [14], [15]. Although the precise mechanism is unclear, it is likely that the bacterial proteins expressed on the surface of these infectious phagosomes are responsible for blocking fusion with the endocytic compartments [16], [17]. Interestingly, over the past few years a growing number of SNARE-like proteins have been identified notably in Chlamydia and Legionella [18], [19], [20], two intracellular bacteria responsible for human diseases. For instance, IncA, a protein expressed by Chlamydia on the surface of the infectious vacuole displays two SNARE-like motifs [19], [21]. IncA interacts directly with mammalian SNAREs [21] and IncA expressed by Chlamydia trachomatis, CtrIncA, has been implicated in homotypic membrane fusion [22], [23]. Formation of Chlamydia inclusions by homotypic fusion is an event specifically occurring during C. trachomatis infection. Interestingly, most Chlamydia strains express IncA, yet not all strains have the capacity to undergo homotypic fusion, suggesting that IncA likely plays additional roles.

Expressed by Legionella pneumophila, IcmG/DotF only displays one SNARE-like motif. The precise function of IcmG/DotF is still unclear, although mutants are rapidly trafficked to, and degraded within lysosomal compartments [24]. Using these bacterial SNARE-like proteins as our models, we tested their function on SNARE-mediated membrane fusion. We discovered a novel inhibitory function of these proteins and characterized the molecular mechanism they use to block host membrane fusion.

Results and Discussion Top

Intracellular bacteria primarily protect their vacuoles against endocytic fusion [12], [25], which is mediated by the association of the v-SNARE VAMP8 with the endocytic t-SNARE composed of Syntaxin 7, Syntaxin 8 and Vti1b [26], [27].

Two distinct complementary mechanisms have been suggested concerning chlamydial avoidance of lysosomal fusion: 1) during the first ~8 hours of infection, the protection of the vacuole appears to be independent of Chlamydia protein synthesis [28]. Rather, structural components of the Chlamydia cell wall seems to be involved in this activity [29]. 2) Later however, at a time that coincides with IncA expression [30], an active modification of the inclusion membrane takes place to sustain the protection of the inclusion. In light of these evidences, we started to investigate the role of IncA in the protection of the Chlamydia inclusion.

Previously, IncA has been shown to co-precipitate with the endocytic SNAREs when expressed in cells [21]. Using an in vitro liposome fusion assay [4], [6], we now tested both CtrIncA and CcaIncA expressed respectively by C. trachomatis and C. caviae, for their functional effect on endocytic SNARE-mediated membrane fusion (see Table 2 for a description of all the SNARE proteins studied here). To do so, we reconstituted the t-SNARE [Syntaxin7/Syntaxin8/Vti1b] and the v-SNARE [VAMP8] with or without IncA into acceptor and donor liposomes, respectively. Donor liposomes contain the FRET pair Rhodamine-PE [N- (lissamine rhodamine B sulfonyl) phosphatidyl ethanolamine] and NBD-PE [N- (7-nitro-2,1,3-benzoxadiazole-4-yl) phosphatidyl ethanolamine]. Liposome fusion results in lipid mixing of donor and acceptor liposomes. As the distance between NBD and rhodamine increases, the resonance energy transfer and the quenching of NBD are reduced. Fusion becomes detectable as an increased NBD fluorescence at 538nm [4], [6]. After mixing different combinations of t- and v- liposomes+/−IncA, liposome fusion was allowed to proceed at 37°C for two hours. As shown in Fig. 1, CtrIncA strongly inhibits endocytic SNARE-mediated fusion. CtrIncA blocks membrane fusion whether present in v-SNARE (~70% inhibition) or in t-SNARE (~37% inhibition) liposomes (Fig. 1B and 1C). We observed that the inhibitory effect of CtrIncA correlates with its concentration in the liposomes (Fig. 1C and 1D). Similarly, CcaIncA inhibits endocytic SNARE-mediated fusion whether present on t-SNARE (~40% inhibition) or v-SNARE liposomes (~50% inhibition) (Fig. 1G and 1F), confirming the inhibitory role of IncA proteins. When we compared both the effects of IncA and IcmG/DotF, a SNARE-like protein (Fig. 1H) expressed by Legionella pneumophila [Table 1 and [18]], we also observed inhibition of SNARE-mediated membrane fusion (Fig. 1). Interestingly, IcmG/DotF has no effect when present on the t-SNARE side (Fig. 1J), but only interferes with the v-SNARE (Fig. 1I). Although both IncA and IcmG/DotF have a common inhibitory function on membrane fusion, it appears that bacterial SNARE-like proteins display different levels of efficiency. Most likely, other SNARE-like proteins, such as LegC3, play a major role in protecting Legionella's vacuole [31].

thumbnail

Figure 1. SNARE-like bacterial proteins inhibit endocytic SNARE-mediated membrane fusion.

A- CtrIncA encodes a transmembrane domain (aa34–82), a N-terminal (N-ter: aa107–145) and a C-terminal (C-ter: aa210–272) SNARE-like motif. B- VAMP8 was reconstituted with and without CtrIncA into donor liposomes (coomassie gel), and incubated with t-SNARE liposomes containing [Syn7/Syn8/Vti1b]. Fusion decreases in presence of CtrIncA (70% inhibition). C- t-[Syn7/Syn8/Vti1b] was reconstituted with different concentration of CtrIncA into acceptor liposomes. Fusion shows a concentration dependency for CtrIncA inhibition. D- The percentage of inhibition with the standard deviation is plotted (n = 3). For each experiment, results were normalized based on the fusion rate obtained after 2 hrs with the endocytic complex w/o CtrIncA (0x). We observed 20% inhibition for a CtrIncA:Syn7 estimated ratio of 1:1 (1x). The inhibition rate increased to 35% for an estimated ratio of 2:1 (2x). E- CcaIncA encodes a transmembrane domain (aa60–118), a N-terminal (N-ter: aa140–178) and a C-terminal (C-ter: aa233–295) SNARE-like motif. F- We observed 50% inhibition when CcaIncA was reconstituted on the v-SNARE side with VAMP8. G- We observed 40% inhibition when CcaIncA was reconstituted with [Syn7/Syn8/Vti1b] into acceptor liposomes. H- IcmG/DotF displays two hydrophobic regions (aa52–75 and 206–227), and a SNARE-like motif (aa146-210). I- Endocytic fusion is reduced when IcmG/DotF is present in v-SNARE liposomes and the inhibition rate correlates with IcmG/DotF concentration, reaching 50% of inhibition for an estimated ratio IcmG:VAMP8 of 1:2. J- IcmG/DotF does not interfere with membrane fusion when present in t-SNARE liposomes. All graphs are representative of at least 3 independent experiments.

doi:10.1371/journal.pone.0007375.g001
thumbnail

Table 2. SNARE proteins description.

doi:10.1371/journal.pone.0007375.t002

Although CtrIncA has been previously implicated in homotypic membrane fusion [22], [23], we did not observe any fusion events between CtrIncA-containing liposomes (data not shown). Perhaps CtrIncA requires post-translational modifications such as phosphorylation, to become fusogenic [32]. Consistent with this possibility, IncA has multiple phosphorylation sites that become phosphorylated by host cells during infection [19], [32]. Alternatively, additional proteins from either Chlamydia or the host cell might be necessary in combination with CtrIncA to promote fusion. Interestingly, some non-fusogenic strains do express a normal IncA protein on the inclusion membrane, supporting the possibility that other elements of the fusion machinery are missing in these strains [33].

We propose that CtrIncA could function as a switch to regulate the maturation of the inclusion. During the infectious cycle of C. trachomatis, each newly synthesized CtrIncA would first bind every resident SNARE on the inclusion, until all are blocked. As a consequence, SNARE-mediated fusion of the inclusion would be totally inhibited. As CtrIncA continues to accumulate, excess CtrIncA would then be available for further modification by the host cell (phosphorylation) and/or for binding additional proteins. CtrIncA would become active for fusion and inclusions could then undergo homotypic fusion.

Next, we determined whether the inhibitory function was encoded into the SNARE-like motif. Since IcmG/DotF has a limited inhibitory effect, we concentrated our efforts on IncA. IncA possesses two SNARE-like motifs [21] (Table 1, Fig. 1A). We focused our attention on the N-terminal motif due to its presence next to the trans-membrane domain mimicking the eukaryotic SNARE configuration. This makes it ideally located to interact directly with eukaryotic SNARE motifs. Furthermore, this motif has previously been shown to be compatible with the formation of a stable complex with SNARE proteins [19]. To determine whether the N-terminal SNARE-like motif has an inhibitory activity, truncated forms of CtrIncA were generated and their effects on endocytic SNARE-mediated fusion were examined. CtrIncA mutant containing only the N-terminal SNARE-like motif (CtrIncA1–141) inhibited endocytic SNARE-mediated fusion in a dose-dependent manner similar to the full-length protein (Fig. 2A). Next, we delineated the minimal IncA sequence necessary to retain the inhibitory function. As shown on Fig. 2B and Fig. 2C, CtrIncA1–130 still displays a significant inhibitory effect (~15%, p = 0.028) when present on either t- or v-SNARE membrane. On the contrary, CtrIncA1–120, which contains only half of the SNARE-like motif, completely lost its ability to inhibit endocytic SNARE-mediated membrane fusion (Fig. 2D, 2E, p = 0.42). The outcome was similar regardless of whether this truncated form of IncA was reconstituted into t-SNARE or v-SNARE liposomes. This suggests that the CtrIncA N-terminal SNARE-like motif requires a SNARE-like motif of at least ~23 amino acids in order to exert an effective inhibitory activity and confirm the role of this motif in blocking membrane fusion. Although the function of the C-terminal domain remains to be determined, we cannot exclude its role in reinforcing the inhibitory effect of IncA.

thumbnail

Figure 2. The SNARE-like motif encodes the inhibitory function.

A- Increasing concentrations of CtrIncA1–141 were reconstituted into endocytic t-SNARE liposomes, and fusion proceeded in presence of VAMP8-liposomes. Fusion is significantly inhibited by the presence of CtrIncA1–141 and is dependent upon its concentration, reaching 55% of inhibition after 2 hrs with an estimated CtrIncA1–141:SNARE ratio of 2:1. This experiment is representative of n = 3. B–E- Two different concentrations of truncated CtrIncA (see representative coomassie gels inserted in each graph) were reconstituted into t-SNARE (B,D), and v-SNARE liposomes (C,E). As shown on graphs B and C, CtrIncA1–130 still displays a significant inhibitory effect on the endocytic SNARE-mediated membrane fusion (average of 15% inhibition after 2 hrs, p = 0.022). On the contrary, CtrIncA1–120 (D,E) completely fails to inhibit endocytic fusion (p>0.05). The mean from n = 5 independent experiments was determined at 30 min, 60 min and 120 min. The standard deviation is shown. One asterisk denotes statistically significant differences (p<0.05). For the purpose of comparison, maximal values of fusion obtained for the SNARE complex without IncA at 120 min were arbitrarily defined as 100%.

doi:10.1371/journal.pone.0007375.g002

Since Chlamydia inclusion membrane is derived from the plasma membrane, we then decided to test the effect of both CtrIncA and CcaIncA on the plasma membrane resident exocytic t-SNAREs (Table 2). As shown in Fig. 3A, CtrIncA has no inhibitory effect on any of the exocytic complexes tested, regardless of its concentration, suggesting that CtrIncA is specific for the endocytic SNAREs. CcaIncA, on the other hand, exerts a significant inhibitory effect on [Syn2/SNAP23], [Syn3/SNAP23] and [Syn4/SNAP23] fusion (Fig. 3B), demonstrating that CcaIncA has a broader inhibitory effect. These results further show that bacterial SNARE-like proteins display different levels of specificity. One might imagine that the capacity to inhibit a large range of membrane fusion events could potentially increase the number of hosts that intracellular bacteria could infect. For example, C. caviae has been detected in a wide range of hosts [34]. Alternatively, blocking a multitude of vesicular trafficking in the cells could impact the long-term outcome of an infection. In particular it would be interesting to correlate the level of SNARE-like protein inhibition with the capacity of certain bacteria to induce chronic diseases.

thumbnail

Figure 3. Bacterial SNARE-like proteins display different level of specificity.

CtrIncA (A) and CcaIncA (B) were reconstituted with the exocytic t-SNARE complexes [Syn2/SNAP23], [Syn3/SNAP23] and [Syn4/SNAP23]. After mixing t-SNARE liposomes (with or without IncA) with VAMP2 liposomes, fusion proceeded. Bar graphs represent the mean from n = 5 independent experiments at 30min, 60 min and 120 min for each of the exocytic complex. For the purpose of comparison, maximal values of fusion obtained for the SNARE complex without IncA at 120 min were arbitrarily defined as 100%. The standard deviation is shown. A- As shown on the curves and bar graphs, CtrIncA does not affect exocytic fusion regardless of its concentration (p>0.05). B- After 2 hrs of fusion, CcaIncA significantly inhibits [Syn2/SNAP23]-mediated fusion by 35%, [Syn3/SNAP23]-mediated fusion by 25% and [Syn4/SNAP23]-mediated fusion by 20% (p = 0.0079). One and two asterisks denote statistically significant differences with p<0.05, and p<0.02 respectively.

doi:10.1371/journal.pone.0007375.g003

To confirm SNARE-like proteins inhibitory function in a more physiological environment, we tested IncA's role in vivo in mammalian cells that can potentially host infection. In order to obtain quantitative results, we chose the RBL-2H3 mast cell line as our model. Mast cells display a large number of endocytic compartments, including their secretory granules, which are secretory lysosomes [35]. During stimulation, the endocytic v-SNAREs VAMP8 present on the secretory lysosomes bind the exocytic t-SNAREs [Syntaxin 4/SNAP23] present on the plasma membrane to mediate exocytosis [36], [37]. If IncA interferes with SNAREs when present in RBL-2H3 mast cells, as it does in the liposomes, we should observe an inhibition of the secretory pathway. Because CcaIncA full-length protein was toxic for the cells, RBL-2H3 were transfected with myc-CcaIncA1–220, a truncated form of CcaIncA still containing its SNARE-like N-terminal domain [19], and therefore still inhibitory (see Fig. 2). Myc-CcaIncA1–220 was cloned together with GFP into an IRES vector to simultaneously express a transfection marker (40% average transfection efficiency). Using immunofluorescence, we observed that Myc-CcaIncA1–220 co-localized with lysotracker (Fig. 4A), a marker of the RBL-2H3 secretory lysosomes [38]. This suggests that Myc-CcaIncA1–220 is located on the secretory lysosomes where it can potentially interact with the lysosomal v-SNAREs VAMP8. This is physiologically relevant since VAMP8 is involved in the phagosomal fusion with lysosomes [39]. Therefore, interfering with VAMP8 would protect the phagosomal compartment against degradation. After stimulating transfected mast cells with both 10−7M Phorbol 12-Myristate 13-Acetate (PMA) and 10−6M ionomycin, we analyzed the release of β-hexosaminidase, a lysosomal enzyme stored inside mast cell secretory lysosomes. Kinetic analyses showed that after 30 min of stimulation, cells transfected with myc-CcaIncA1–220/GFP secrete significantly less β-hexosaminidase than the GFP control. The level of inhibition at 30 min (23% inhibition) and at 60 min (32% inhibition) is significant (p<0.05 and p<0.02 respectively) compared to GFP transfected cells (Fig. 4B). These data confirm the inhibitory effect of CcaIncA on t-[Syn4/SNAP23] and v-[VAMP8]-mediated fusion previously observed using the liposome fusion assay (Figs 3 and 1 respectively). Incidentally, this also indicates that the in vitro liposome fusion assay is able to accurately predict cellular data. Therefore, this assay represents a unique system by which more bacterial proteins could be screened for their effect on host vesicular trafficking.

thumbnail

Figure 4. SNARE-like proteins inhibit intracellular fusion in cells.

A- Resting transfected RBL-2H3 cells were co-labeled with anti-Myc Abs and lysotracker, and viewed by confocal microscopy. Myc-CcaIncA1–220/GFP is on the left, while GFP control is on the right. Co-localized Myc-CcaIncA1–220 and lysotracker compartments are indicated with a yellow box and arrows. B-RBL-2H3 cells were transiently transfected with Myc-CcaIncA1–220/GFP or with GFP alone. Total lysates were migrated on SDS-PAGE and probed with Abs directed against Myc. Equivalent amounts of protein in each lane was verified after reprobing the blots with the anti-SNAP23. After stimulation of the transfectants at different time points with 10−7M PMA/10−6M ionomycin, the kinetics of degranulation was analyzed using the β-hexosaminidase release assay. The mean of triplicates from five independent experiments was determined. Standard errors are shown. For the purpose of comparison, maximal values of degranulation obtained for GFP-transfected cells at 60 min were arbitrarily defined as 100%. Transfection of Myc-CcaIncA1–220 (Grey bars) reduces mast cells degranulation by 23% at 30 min and 31.8% at 60 min compared with GFP (Dark bars). The asterisks denote statistically significant difference (p<0.05) to GFP transfectants. Note that Myc-CcaIncA1–220/GFP and GFP are not statistically different at 15 min (p = 0.26).

doi:10.1371/journal.pone.0007375.g004

Conclusion

The key for survival of intracellular bacteria in host cells is their capacity to manipulate host cellular processes -in particular membrane fusion- to allow the establishment of an intracellular replicative niche. An obvious host machinery to target in order to block membrane fusion is the SNARE machinery. Using CtrIncA, CcaIncA and IcmG/DotF as our models, we demonstrated that SNARE-like bacterial proteins differentially block SNAREs-mediated membrane fusion. Furthermore, we showed that this inhibitory function is encoded into their SNARE-like motifs, validating the general function of such a motif for manipulating membrane fusion.

Interestingly, clinical isolates lacking IncA present defects in their infectious cycle, and the number of inclusions per cells is significantly decreased [40], [41]. This would suggests that the level of protection exerted by Chlamydia cell wall during the first 8 hrs [28] is sufficient for small inclusions to develop, but that IncA synthesis is necessary for the inclusions to maturate further. Alternatively, it could also suggest that additional protective systems, although not as efficient IncA, are in place to insure such an important function. Interestingly, Chlamydia was found to express additional SNARE-like bacterial proteins, including CT813, which also interacts with host SNARES [21]. Although their inhibitory function remains to be confirmed, the redundancy of the SNARE-like protein system would further support its importance. Overlapping layers of protection would insure the survival of Chlamydia in case one of the protective systems fails. The differential timing of expression for each of these proteins could also ensure the protection of the vacuole over time [30]. This redundancy would explain the presence of a limited number of Chlamydia inclusions during infections with strains naturally lacking IncA [41]. Each SNARE-like protein may also be specific for a different set of host SNAREs, which would increase the protection of the infectious vacuoles against a larger range of membrane fusion events.

It is intriguing to notice that the inhibitory mechanism displayed by bacterial SNARE-like proteins is very similar to the one employed by the eukaryotic inhibitory-SNAREs (i-SNAREs). SNARE-mediated fusion is triggered by four fusogenic subunits and is highly specific [42], [43], [44], [45]. It was shown that the presence of a fifth SNARE on the same compartment could result in an inhibition of fusion (therefore, such a SNARE has been called inhibitory-SNARE). An i-SNARE can substitute for one of the subunits of the functional tetramer leading to the formation of a non-functional tetramer (acting as a pseudo t-SNARE) [46]. In the Golgi, it has been demonstrated that a gradient of i-SNAREs across cisternae blocks SNARE-mediated membrane fusion and is likely used to fine-tune the specificity of membrane fusion [46]. Here we showed that bacterial SNARE-like proteins appear to function in a similar fashion. Similar to i-SNAREs, these bacterial proteins are capable to bind fusogenic SNAREs and inhibit membrane fusion. Altogether, this suggests that coiled-coil SNARE-like motifs may constitute one of the most effective motifs to manipulate membrane fusion and has been incorporated into intracellular bacteria genome as an adaptation to the pressures of survival [47]. Ultimately, one could take advantage of such a recurrence to develop a common therapeutic strategy for targeting a wide array of bacterial SNARE-like proteins and revert the fusion blockage.

Materials and Methods Top

DNA manipulation and plasmid construction

Standard genetic manipulations were performed throughout. All polymerase chain reaction (PCR) procedures were done with pfu turbo polymerase (Stratagene). All other DNA modifying enzymes were from New England Biolabs. The E. coli strain DH5α (Invitrogen) was used for standard cloning. Plasmid encoding CcaIncA1~22̃ was generated as described [19]. We added a myc tag and cloned CcaIncA1~22̃ into the pIRES2-EGFP vector (Clontech) using the oligonucleotides FO134 GGGAATTCCATATGACAGTATCCACAGACAACAC and FO135 CGGGATCCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCAAAGACTGA​GCTAATTTCT.

Plasmids encoding Syntaxin 2 (untagged), Syntaxin 3 (untagged), Syntaxin 4 (untagged) and His6-SNAP23 were kindly provided by Jingshi Shen (Columbia University, New York). Plasmids encoding Syntaxin 7-His6, Syntaxin 8-His6, Vti1-His6 and VAMP8-His6 were generated as described [45]. Plasmids encoding His6-CtrIncA and His6-CcaIncA were generated as described in [19]. Plasmid encoding His6-IcmG/DotF was generated by PCR using the oligonucleotides FO117 GCGAATTCTCAACTATCTTCTTGACTAAACT and FO118 GGGCATATCCATATGATGGCAGAGCACGATCA. PCR fragments were subsequently ligated into the EcoRI-NdeI sites of pET28a. Plasmids encoding His6-CtrIncA1–141, His6-CtrIncA1–130 and His6-CtrIncA1–120 were generated by PCR, respectively using the oligonucleotides FO160 GGGCATATCCATATGACAACGCCTACTCTAATCGTG and FO162 GATGGATCCCTAGTCTTTAGATGTCGTTGCAAAT; FO160 and FO163 GATGGATCCCTATAAATGAAGAAATTCTTTCTG. PCR fragments were subsequently ligated into the NdeI-BamH1 sites of pET28a.

Protein expression and purification

VAMP8-His6, Syntaxin8-His6, Syntaxin7-His6 and Vti1b-His6 were expressed as described [45]. Plasma membrane t-SNARE proteins Syntaxin3/His6-SNAP23, Syntaxin4/His6-SNAP23, Syntaxin 2/His6-SNAP23 were co-expressed in BL21 (DE3) star E. coli (Invitrogen) and co-purified using the His6 tag present on SNAP23.

All constructs derived from the bacterial proteins: CcaIncA-His6, CtrIncA-His6, His6-CtrIncA1–141, His6-CtrIncA1–130, His6-CtrIncA1–120 and IcmG/DotF-His6 were expressed in BL21 (DE3) star E. coli for 12 hrs at 16°C to allow a proper folding of the protein. All his-tagged proteins were purified using the procedure previously described [44], [45], [48].

Reconstitution into liposomes

SNARE proteins were reconstituted into proteoliposomes by detergent dilution and isolated on an Accudenz density gradient flotation as previously described [6], [49]. To insert bacterial proteins into liposomes, v-SNARE protein and preformed t-SNARE complexes were respectively preincubated with the bacterial protein at different concentration for 4 hrs at 4°C, before being mixed with the lipids, and dialysed for 16 hrs at 4°C.

Liposome fusion assay

Fusion reactions and data analysis were performed as previously described [6], [49]. For most fusion assays, the mean from at least 5 independent experiments was determined at 30 min, 60 min and 120 min. For the purpose of comparison, maximal values of fusion obtained for the SNARE complex without IncA at 120 min were arbitrarily defined as 100%. The Mann-Whitney U test was used to compare the mean values of maximal fusion at 120 min between SNARE-containing liposomes and SNARE/IncA-containing liposomes. Significance was assumed at p values<0.05.

Cell transfection

The rat mast cell line RBL-2H3 was cultured as described [37]. We used the AMAXA nucleofector technology (AMAXA, Germany) to transiently transfect the RBL-2H3 cells. Briefly, 2×106 cells were nucleofected in 100 µl solution V (AMAXA) using 1 µg of pIRES2-EGFP-CcaIncA1~22̃ vector or pIRES2-EGFP vector (control). The cells were nucleofected using the program T-030. Cells were then plated in complete medium in 96 well plates for subsequent secretory cell assays 12 hrs later. Using these conditions, the efficiency of transfection was routinely in the range of 30 to 40% as determined by immunofluorescence (GFP positive).

Confocal immunofluorescence microscopy

Lysotracker labeling was performed following the manufacturer's instruction. Briefly, cells grown on coverslips were incubated with lysotracker 1:20,000 for 20 min in complete medium and washed three times. The Myc tag labeling was performed as described [37]. We used the anti-myc antibody (9E10) from Santa Cruz Biotechnology. Cy5-conjugated anti-mouse antibody was from Jackson Laboratories. All data were analyzed using a Leica TCS SP confocal microscope, LEICA CONFOCAL 2.5 software, HCX PL APO 63X oil immersion objective.

Secretory cell assay

Transfectants were plated in 96 well plates in triplicates at ~5×105 cells in 100 µl of complete DMEM medium and incubated overnight at 37°C. After 12 hrs, adherent RBL cells were washed twice in prewarmed phenol red free DMEM and stimulated by Phorbol Myristate Acetate (10−7M)/ionomycin (10−6M). At different time points (0, 15 min, 30 min 1 hr), 25 µl of supernatant was collected and the granule secretion marker β-hexosaminidase was analyzed using test supernatants within the linear range of the assay [50]. Total cellular content of β-hexosaminidase was determined by lysis of the adherent cells in 0.5% Triton X-100. The absorbance was determined at 410 nm in a micro-titer plate reader. Results were calculated as a percentage of total β-hexosaminidase in cells after correction for spontaneous release in unstimulated cultures. For the purpose of comparison, all data were normalized to the maximal value of β-hexosaminidase release obtained in pIRES2-EGFP transfectants and arbitrarily taken as 100%. The Mann-Whitney U test was used to compare the mean values of maximal release between GFP and Myc-CcaIncA 1–220 transfectants. Significance was assumed at p values<0.05.

SDS-PAGE and Western blot analysis

Western blots were performed as described [51]. The anti-myc antibody (9E10) was from Santa Cruz Biotechnology, the anti-SNAP23 antibody from Synaptic System and both were used at 1:500. The secondary antibodies were from Biorad and were used at 1:20,000.

Acknowledgments Top

We thank Bertha Conyers for technical assistance, as well as Drs. James McNew, Thomas Melia and Peter Antinozzi for their critical comments of the manuscript and helpful discussions. We are also grateful to Gregory Lavieu for his constant interest and helpful comments during the course of this study.

Author Contributions Top

Conceived and designed the experiments: FP CD AS JER. Performed the experiments: FP JW AGD NA. Analyzed the data: FP JW AGD CD AS JER. Contributed reagents/materials/analysis tools: FP JW AGD CD NA HAS AS. Wrote the paper: FP.

References Top

  1. Fasshauer D, Sutton RB, Brunger AT, Jahn R (1998) Conserved structural features of the synaptic fusion complex: SNARE proteins reclassified as Q- and R-SNAREs. Proc Natl Acad Sci U S A 95: 15781–15786. Find this article online
  2. Low S, Chapin S, Wimmer C, Whiteheart S, Kömüves L, et al. (1998) The SNARE machinery is involved in apical plasma membrane trafficking in MDCK cells. J Cell Biol 141: 1503–1513. Find this article online
  3. Fasshauer D, Eliason W, Brünger A, Jahn R (1998) Identification of a minimal core of the synaptic SNARE complex sufficient for reversible assembly and disassembly. Biochemistry 37: 10354–10362. Find this article online
  4. Weber T, Zemelman B, McNew J, Westermann B, Gmachl M, et al. (1998) SNAREpins: Minimal machinery for membrane fusion. Cell 92: 759–772. Find this article online
  5. Nickel W, Weber T, McNew JA, Parlati F, Sollner TH, et al. (1999) Content mixing and membrane integrity during membrane fusion driven by pairing of isolated v-SNAREs and t-SNAREs. Proc Natl Acad Sci U S A 96: 12571–12576. Find this article online
  6. Parlati F, Weber T, McNew JA, Westermann B, Sollner TH, et al. (1999) Rapid and efficient fusion of phospholipid vesicles by the alpha- helical core of a SNARE complex in the absence of an N-terminal regulatory domain. Proc Natl Acad Sci U S A 96: 12565–12570. Find this article online
  7. Schuette CG, Hatsuzawa K, Margittai M, Stein A, Riedel D, et al. (2004) Determinants of liposome fusion mediated by synatic SNARE proteins. Proc Natl Acad Sci U S A 101: 2858–2863. Find this article online
  8. Weimbs T, Low SH, Chapin SJ, Mostov KE, Bucher P, et al. (1997) A conserved domain is present in different families of vesicular fusion proteins: a new superfamily. Proc Natl Acad Sci U S A 94: 3046–3051. Find this article online
  9. Skehel JJ, Wiley DC (1998) Coiled coils in both intracellular vesicle and viral membrane fusion. Cell 95: 871–874. Find this article online
  10. Sollner T (2004) Intracellular and viral membrane fusion: a uniting mechanism. Curr Opin Cell Biol 16: 429–435. Find this article online
  11. Fields KA, Hackstadt T (2002) The Chlamydial inclusion: Escape from the endocytic pathway. Annu Rev Cell Dev Biol 18: 221–245. Find this article online
  12. Meresse S, Steele-Mortimer O, Moreno E, Desjardins M, Finlay B, et al. (1999) Controlling the maturation of pathogen-containing vacuoles: a matter of life and death. Nat Cell Biol 1: E183–188. Find this article online
  13. Rockey DD, Scidmore MA, Bannantine JP, Brown WJ (2002) Proteins in the chlamydial inclusion membrane. Microbes and Infection 4: 333–340. Find this article online
  14. Duclos S, Desjardins M (2000) Subversion of a young phagosome: the survival strategies of intracellular pathogens. Cell Microbiol 2: 365–377. Find this article online
  15. Dautry-Varsat A, Balañá M, Wyplosz B (2004) Chlamydia-host cell interactions: recent advances on bacterial entry and intracellular development. Traffic 5: 561–570. Find this article online
  16. Hashim S, Mukherjee K, Raje M, Basu S, Mukhopadhyay A (2000) Live Salmonella modulate expression of Rab proteins to persist in a specialized compartment and escape transport to lysosomes. J Biol Chem 275: 16281–16288. Find this article online
  17. Oh Y, Straubinger R (1996) Intracellular fate of Mycobacterium avium: use of dual-label spectrofluorometry to investigate the influence of bacterial viability and opsonization on phagosomal pH and phagosome-lysosome interaction. Infect Immun 64: 319–325. Find this article online
  18. Morozova I, Qu X, Shi S, Asamani G, Greenberg J, et al. (2004) Comparative sequence analysis of the icm/dot genes in Legionella. Plasmid 51: 127–147. Find this article online
  19. Delevoye C, Nilges M, Dautry-Varsat A, Subtil A (2004) Conservation of the biochemical properties of IncA from Chlamydia trachomatis and C. caviae: oligomerization of IncA mediates interaction between facing membranes. J Biol Chem 279: 46896–46906. Find this article online
  20. Barocchi MA, Masignani V, Rappuoli R (2005) Cell entry machines: a common theme in nature? Nat Rev Microbiol 4: 349–358. Find this article online
  21. Delevoye C, Nilges M, Dehoux P, Paumet F, Perrinet S, et al. (2008) SNARE protein mimicry by an intracellular bacterium. PLOS Pathogens 4: e1000022. Find this article online
  22. Hackstadt T, Scidmore-Carlson MA, Shaw EI, Fischer ER (1999) The Chlamydia trachomatis IncA protein is required for homotypic vesicle fusion. Cellular Microbiology 1: 119–130. Find this article online
  23. Fields KA, Fisher E, Hackstadt T (2002) Inhibition of fusion of Chlamydia trachomatis inclusions at 32°C correlates with restricted export of IncA. Infection and Immunity 70: 3816–3823. Find this article online
  24. Roy CR, Berger KH, Isberg RR (1998) Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake. Mol Microbiol 28: 663–674. Find this article online
  25. Hackstadt T (2000) Redirection of host vesicle trafficking pathways by intracellular parasites. Traffic 1: 93–99. Find this article online
  26. Mullock BM, Smith CW, Ihrke G, Bright NA, Lindsay M, et al. (2000) Syntaxin 7 is localized to late endosome compartments, associates with vamp 8, and Is required for late endosome-lysosome fusion [In Process Citation]. Mol Biol Cell 11: 3137–3153. Find this article online
  27. Nakamura N, Yamamoto A, Wada Y, Futai M (2000) Syntaxin 7 mediates endocytic trafficking to late endosomes. J Biol Chem 275: 6523–6529. Find this article online
  28. Scidmore MA, Fischer ER, Hackstadt T (2003) Restricted Fusion of Chlamydia trachomatis vesicles with endocytic compartments during the initial stages of infection. Infection and Immunity 71: 973–984. Find this article online
  29. Eissenberg LG, Wyrick PB, Davis CH, Rumpp JW (1983) Chlamydia psittaci elementary body envelopes: ingestion and inhibition of phagolysosome fusion. Infect Immun 40: 741–751. Find this article online
  30. Belland RJ, Zhong G, Crane DD, Hogan D, Sturdevant D, et al. (2003) Genomic transcriptional profiling of the developmental cycle of Chlamydia trachomatis. PNAS 100: 8478–8483. Find this article online
  31. de Felipe K, Glove rR, Charpentier X, Anderson O, Reyes M, et al. (2008) Legionella eukaryotic-like type IV substrates interfere with organelle trafficking. PLoS Pathog 4: e1000117. Find this article online
  32. Rockey DD, Grosenbach D, Hruby D, Peacock M, Heinzen R, et al. (1997) Chlamydia psittaci IncA is phosphorylated by the host cell and is exposed on the cytoplasmic face of the developing inclusion. Mol Microbiol 24: 217–228. Find this article online
  33. Rockey DD, Viratyosin W, Bannantine JP, Suchland RJ, Stamm WE (2002) Diversity within inc genes of clinical Chlamydia trachomatis variant isolates that occupy non-fusogenic inclusions. Microbiology 148: 2497–2505. Find this article online
  34. Lutz-Wohlgroth L, Becker A, Brugnera E, Huat Z, Zimmermann D, et al. (2006) Chlamydiales in guinea-pigs and their zoonotic potential. J Vet Med A Physiol Pathol Clin Med 53: 185–193. Find this article online
  35. Sagi-Eisenberg R (2007) The mast cell: where endocytosis and regulated exocytosis meet. Immunol Rev 217: 292–303. Find this article online
  36. Puri N, Roche P (2008) Mast cells possess distinct secretory granule subsets whose exocytosis is regulated by different SNARE isoforms. PNAS 105: 2580–2585. Find this article online
  37. Paumet F, Le Mao J, Martin S, Galli T, David B, et al. (2000) Soluble NSF attachment protein receptors (SNAREs) in RBL-2H3 mast cells: functional role of syntaxin 4 in exocytosis and identification of a vesicle-associated membrane protein 8-containing secretory compartment. J Immunol 164: 5850–5857. Find this article online
  38. Wu M, Baumgart T, Hammond S, Holowka D, Baird B (2007) Differential targeting of secretory lysosomes and recycling endosomes in mast cells revealed by patterned antigen arrays. J Cell Sci 120: 3147–3154. Find this article online
  39. Pryor PR, Mullock BM, Bright NA, Lindsay M, Gray SR, et al. (2004) Combinatorial SNARE complexes with VAMP7 or VAMP8 define different late endocytic fusion events. EMBO Reports 5: 590–595. Find this article online
  40. Geisler W, Suchland R, Rockey D, Stamm W (2001) Epidemiology and clinical manifestations of unique Chlamydia trachomatis isolates that occupy nonfusogenic inclusions. J Inf Diseases 184: 879–884. Find this article online
  41. Xia M, Suchland R, Bumgarner R, Peng T, Rockey D, et al. (2005) Chlamydia trachomatis variant with nonfusing inclusions: Growth dynamic and host-cell transcriptional response. J Inf Diseases 192: 1229–1236. Find this article online
  42. McNew JA, Parlati F, Fukuda R, Johnston RJ, Paz K, et al. (2000) Compartmental specificity of cellular membrane fusion encoded in SNARE proteins. Nature 407: 153–159. Find this article online
  43. Parlati F, Varlamov O, Paz K, McNew JA, Hurtado D, et al. (2002) Distinct SNARE complexes mediating membrane fusion in Golgi transport based on combinatorial specificity. Proc Natl Acad Sci U S A 99: 5424–5429. Find this article online
  44. Paumet F, Brugger B, Parlati F, McNew JA, Sollner TH, et al. (2001) A t-SNARE of the endocytic pathway must be activated for fusion. J Cell Biol 155: 961–968. Find this article online
  45. Paumet F, Rahimian V, Di Liberto M, Rothman JE (2005) Concerted auto-regulation in yeast endosomal t-SNAREs. J Biol Chem 280: 21137–21143. Find this article online
  46. Varlamov O, Volchuk A, Rahimian V, Doege CA, Paumet F, et al. (2004) i-SNAREs: inhibitory SNAREs that fine-tune the specificity of membrane fusion. J Cell Biol 164: 79–88. Find this article online
  47. Stebbins C, Galán J (2001) Structural mimicry in bacterial virulence. Nature 412: 701–705. Find this article online
  48. Paumet F, Rahimian V, Rothman JE (2004) The specificity of SNARE-dependent fusion is encoded in the SNARE motif. Proc Natl Acad Sci U S A 101: 3376–3380. Find this article online
  49. Weber T, Parlati F, McNew JA, Johnston RJ, Westermann B, et al. (2000) SNAREpins are functionally resistant to disruption by NSF and alphaSNAP. J Cell Biol 149: 1063–1072. Find this article online
  50. Schwartz L, Austen K, Wasserman S (1979) Immunologic release of β-hexosaminidase and β-glucuronidase from purified rat serosal mast cells. J Immunol 123: 1445–1450. Find this article online
  51. Roa M, Paumet F, Le Mao J, David B, Blank U (1997) Involvement of the ras-like GTPase rab3d in RBL-2H3 mast cell exocytosis following stimulation via high affinity IgE receptors (Fc epsilonRI). J Immunol 159: 2815–2823. Find this article online
Post Your Note (For Public Viewing)
Compose Your Note
 
Declare any competing interests.

Notes and Corrections can include the following markup tags:

Emphasis: ''italic''  '''bold'''  '''''bold italic'''''

Other: ^^superscript^^  ~~subscript~~

Add a note to this text.
Please follow our guidelines for notes and comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  • Remarks that could be interpreted as allegations of misconduct
  • Unsupported assertions or statements
  • Inflammatory or insulting language
Add a note to this text.
You must be logged in to add a note to an article. You may log in by clicking here or cancel this note.
Add a note to this text.
You cannot annotate this area of the document. Close
Add a note to this text.
You cannot create an annotation that spans different sections of the document; please adjust your selection.
Close
Rate This Article
Please follow our guidelines for rating and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  1. Remarks that could be interpreted as allegations of misconduct
  2. Unsupported assertions or statements
  3. Inflammatory or insulting language
Compose Your Annotation
 
Declare any competing interests.

Ratings can include the following markup tags:

Emphasis: ''italic''  '''bold'''  '''''bold italic'''''

Other: ^^superscript^^  ~~subscript~~

All site content, except where otherwise noted, is licensed under a Creative Commons Attribution License.