- Download: PDF | Citation | XML
- Print article
- EzReprint New & improved!
Open Access
Research Article
Variable Incidence of Spiroplasma Infections in Natural Populations of Drosophila Species
- To add a note, highlight some text. Hide notes
- Make a general comment
Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, Arizona, United States of America
Abstract Top
Spiroplasma is widespread as a heritable bacterial symbiont in insects and some other invertebrates, in which it sometimes acts as a male-killer and causes female-biased sex ratios in hosts. Besides Wolbachia, it is the only heritable bacterium known from Drosophila, having been found in 16 of over 200 Drosophila species screened, based on samples of one or few individuals per species. To assess the extent to which Spiroplasma infection varies within and among species of Drosophila, intensive sampling consisting of 50–281 individuals per species was conducted for natural populations of 19 Drosophila species. Infection rates varied among species and among populations of the same species, and 12 of 19 species tested negative for all individuals. Spiroplasma infection never was fixed, and the highest infection rates were 60% in certain populations of D. hydei and 85% in certain populations of D. mojavensis. In infected species, infection rates were similar for males and females, indicating that these Spiroplasma infections do not confer a strong male-killing effect. These findings suggest that Spiroplasma has other effects on hosts that allow it to persist, and that environmental or host variation affects transmission or persistence leading to differences among populations in infection frequencies.
Citation: Watts T, Haselkorn TS, Moran NA, Markow TA (2009) Variable Incidence of Spiroplasma Infections in Natural Populations of Drosophila Species. PLoS ONE 4(5): e5703. doi:10.1371/journal.pone.0005703
Editor: Trine Bilde, Aarhus University, Denmark
Received: February 26, 2009; Accepted: April 22, 2009; Published: May 28, 2009
Copyright: © 2009 Watts et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was supported by NSF award DEB-0315815 to N.A.M. and T.A.M. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
* E-mail: tmarkow@ucsd.edu
¤ Current address: Division of Biological Sciences, University of California San Diego, La Jolla, California, United States of America.
Introduction Top
Based on recent molecular surveys, heritable bacterial symbionts are widespread in arthropods, but, in most cases, their effects on hosts are unknown (e.g., [1], [2]. Drosophila species harbor only two types of heritable bacterial endosymbionts [3], [4]. The most widely studied, and the most common, is Wolbachia [5], [3]. The other heritable bacterial endosymbiont in Drosophila is Spiroplasma, now reported in a total of 16 species [6], [7], [8], [9], [3], [10] and, curiously, rarely found to coinfect with Wolbachia. In some Drosophila species, Spiroplasma causes male-killing [11], [12], [13], [8], while in others it does not [14], [3], [11]. Spiroplasma has been studied far less than Wolbachia, and factors underlying its distribution among and within Drosophila species are unknown.
Factors potentially affecting endosymbiont infection prevalence include the transmission fidelity of the bacteria and its effects on host fitness. Vertical transmission can exhibit high fidelity as evidenced by the decades-long persistence of Spiroplasma-positive strains of D. hydei and D. aldrichi in the Drosophila Species Stock Center [3]. Experimental studies show that temperature affects fidelity of maternal inheritance of Spiroplasma in Drosophila hosts, suggesting that infections may be influenced by climate or microhabitat [15], [16], [17]. Condition-dependent effects on host fitness or reproduction also can influence infection frequencies. Male-killing endosymbionts can be favored in conditions where female offspring benefit from reduced competition from their male siblings [18]. In other insects, heritable symbionts often provide defenses against temperature stress or natural enemies, leading to fitness advantages of infected lineages [19].
Field surveys from wild populations of D. hydei revealed infection rates of 23–66% of females, the highest levels yet reported for any Drosophila [14]. In contrast, infection of wild D. willistoni and D. nebulosa by male-killing Spiroplasma ranged from 1–6%, varying seasonally [6]. These earlier studies suggest interspecific differences in infection rates, but limitations in sampling design or extent prevent inference regarding infection patterns or dynamics. Rates of infection by male-killing compared to non-male-killing Spiroplasma within and among different Drosophila species need to be examined before the basis for infection and its persistence can be understood.
Drosophila species vary widely in their geographic distributions and ecologies [20]. The natural abundance of multiple Drosophila species at any given locality provides an opportunity to perform larger-scale screening in wild populations and to address questions about the ecological and evolutionary dynamics of Spiroplasma infections. We examined infection status in wild-caught females and males of 19 Drosophila species from localities (Figure 1) in the southwestern United States and northwestern Mexico in order to (1) ask how the incidence of infected flies varies in nature and (2) assess the sex ratio of infected flies in order to detect evidence of male killing infections. Our screen employed PCR primers universal for Spiroplasma, rather than those used to target male-killing strains, resulting in as complete detection as possible. Furthermore, a greater depth of sampling within each species allowed us to detect Spiroplasma infections at low frequencies.
Figure 1. Collection localities for Drosophila.
BK = Berkeley, CA, CI = Catalina Island, CA, OP = Organ Pipe Cactus Nat'l Mon, AZ, TU = Tucson, AZ, SC = Santa Catalina Mts, AZ, WI = Willcox, AZ, NS = Northwestern Sonora, MX.
doi:10.1371/journal.pone.0005703.g001Materials and Methods Top
Flies were collected at the localities shown in Figure 1 either directly from cactus (D. mojavensis), cave walls (D. macroptera, D. grisea), or from mushroom (D. tenebrosa) and banana baits (other species) (Table 1). Live flies were keyed to species and sex, maintained on species-appropriate culture medium for several days, and then frozen.
Table 1. Drosophila species screened, dates and locations of collection.
doi:10.1371/journal.pone.0005703.t001DNA extraction from individual flies was carried out as previously described [3]. Briefly, whole flies were extracted with the single-fly squish prep protocol [21]. PCR screens for Spiroplasma were based on amplification of an approximately 410 base pair fragment of bacterial 16S rDNA using the spiroplasma-diagnostic primers 23f (5′-CTCAGGATGAACGCTGGCGGCAT-3′) and TKSSsp (TAGCCGTGGCTTTCTGGTAA [22]) and a touchdown thermal cycler program [3]. The initial screening PCR volume was 10 ul. These primers are expected to amplify almost all Spiroplasma strains and would amplify male-killing and non-male killing strains known from insects, based on comparison to sequence databases. The primers also have the potential to amplify some other groups of Bacteria.
To verify the identify of positive samples as Spiroplasma, each was re-amplified at larger volume (50 μl), and both strands were sequenced with an ABI 3700 at the University of Arizona's Genomics Analysis & Technology Core facility. As a check for DNA quality, all samples were screened for a fragment of mitochondrial cytochrome c oxidase I gene (COI) using primers HCO and LCO with an annealing temperature of 45°C [3]. Only samples that gave positive amplifications for COI were included in the survey. Sequences were edited and aligned using Mega 3.1 [23] and identified using Blastn [24] to query the nr database at GenBank.
Results Top
Of 19 Drosophila species screened, Spiroplasma was found in seven (Figure 2). Infection incidence ranged from under 1% in D. simulans and D. melanogaster to an average of 37% in D. mojavensis. Some species are relatively rare in nature, such that fewer individuals were collected and screened. Sex differences in infection were not significant, although in the case of D. aldrichi the excess of infected females approached significance (X2 = 3.20, 0.10>p>0.05). In D. hydei, more than one Spiroplasma strain was distinguishable based upon 16S rDNA sequence, although no co-infections with distinct symbionts were observed within the same host [10], [3].
Figure 2. Frequency of Spiroplasma infection in wild-caught Drosophila.
The phylogenetic relationships of Drosophila are represented as a cladogram based on Markow & O'Grady [20] Spiroplasma-infected species are colored in red.
doi:10.1371/journal.pone.0005703.g002For two species, sampling permitted comparisons between localities (Table 2). For D. hydei, the proportion of infected flies was several times higher for samples from Willcox, Arizona than for samples from Sonora. For D. mojavensis, infection rate was higher at Santa Catalina Island than at Organ Pipe National Monument.
Table 2. Frequency of infection in populations of D hydei and of D mojavensis
doi:10.1371/journal.pone.0005703.t002Discussion Top
Our results represent the largest number of wild-caught insects screened to date for Spiroplasma. Over a third of the species screened showed Spiroplasma infection, though none of these species appeared to harbor a previously identified male-killing Spiroplasma strain. All of our positive samples were verified with sequencing. Although false negatives are possible (if our primers failed to amplify a novel strain), our screen would have detected known insect Spiroplasma strains, including male-killers and non-male-killers. A multi-locus sequence phylogenetic analysis of 69 of these Drosophila spiroplasmas revealed a large genetic diversity among Spiroplasma haplotypes. Based on this Bayesian phylogenetic analysis, the Drosophila spiroplasmas fall into four distinct, well-supported clades of the Spiroplasma phylogeny, with the most distantly related strain from the male-killing spiroplasmas having 14% sequence divergence at the 16S rDNA locus [10]. Furthermore, estimates of infection prevalence are likely to be conservative, as the sensitivity of our PCR screen may miss Drosophila with low Spiroplasma titer. Two infected species were in the subgenus Sophophora and five were in the subgenus Drosophila. Infection rates were considerably higher among infected species in the Drosophila subgenus compared to infected Sophophoran species. There was no pattern of infection related to geographic area.
By screening both sexes for each species, we obtained indications as to whether Spiroplasma is acting as a male-killer, as known for some Drosophila [8]. In addition, each screening reaction had a positive control, the male-killing Spiroplasma infecting D. melanogaster [11]. Our primers were able to detect spiroplasmas up to 14% sequence divergent from the male-killing strain at the 16S rDNA locus. Other than for D. simulans and D. melanogaster, in which the infection frequency was under 1%, both sexes of infected species were found to be Spiroplasma-positive, indicating the absence of a strong male-killing phenotypes. Nor was the Spiroplasma found in the D. melanogaster female a male-killer, as the strain was established in culture and yielded infected flies of both sexes. Thus the male-killing effect does not appear to be a general explanation for the presence of Spiroplasma in these insects. Furthermore, as the number of Drosophila species found to be infected with Spiroplasma grows, the male-killing phenotype continues to be restricted to particular lineages, primarily the subgenus Sophophora and in the tripunctata radiation in the subgenus Drosophila (Figure 3).
Figure 3. Distribution of male-killing and non-male-killing Spiroplasma in natural populations of Drosophila species surveyed to date.
The phylogenetic relationships of Drosophila are represented as a cladogram based on Markow & O'Grady [20] Non-male-killing Spiroplasma-infected species are colored in red and male-killing Spiroplasma-infected species are in blue.
doi:10.1371/journal.pone.0005703.g003Host genotype clearly influences the distribution of Spiroplasma within as well as among Drosophila species. For example, D. willistoni shows intraspecific variation affecting Spiroplasma transmission [13], [25], [6]. Infection rates for natural populations of D. hydei in our study are similar to those reported by Kageyama et al. [14] reflecting a consistent pattern for this species from different global regions. Drosophila aldrichi, in which fewer than 10% of individuals were spiroplasma-positive, clearly shows a lower frequency of infected individuals of both sexes relative to D. hydei. In D. simulans, and D. melanogaster the infection level is even lower (Figure 2.) In contrast to the Wolbachia infections in D. innubila [26], infections with non-male-killing Spiroplasma appear to be more, as opposed to less, frequent than infections with male-killing types.
Though multiple factors likely affect spiroplasma prevalence, the fidelity of vertical transmission may play a role. Temperature affects maternal transmission of Spiroplasma in D. melanogaster and D. nebulosa [15], [17] and in D. hydei [16]. Similarly, field conditions including temperature influence maternal transmission efficiency of Wolbachia in Drosophila hosts [27], [28], [29], [30]. In our study, both D. mojavensis and D. hydei were collected from two locations and each showed a lower infection rate at the hotter site (Table 2). Transmission efficiency may be decreased at low temperatures, as shown experimentally for D. hydei [16], and also at the extreme high temperatures that occur at some desert localities sampled in our survey.
The variation in natural infection rates reported here, both among and within species, indicates a dynamic system in which infection, fitness effects and persistence of spiroplasmas in Drosophila are dependent upon the interplay of symbiont and host genotype and local environmental conditions. Given the ease of rearing and manipulating a range of evolutionarily, ecologically and genetically defined Drosophila species, our opportunities to disentangle and understand the roles of these factors are unparalleled.
Acknowledgments Top
We thank L. Matzkin, J. Bono, S. Castrezana, D. Gutilla, V. Corby-Harris, and the Catalina Island Conservancy for assistance in collecting flies, Steven Wasserman for comments on the manuscript and Becky Nankivell for assistance with Flyendo. Flies from México were obtained under permit FLOR 0030 from the Secretaría de Medio Ambiente y Recursos Naturales (SEMARNAT).
Author Contributions Top
Conceived and designed the experiments: NAM TAM. Performed the experiments: TW. Analyzed the data: TW. Contributed reagents/materials/analysis tools: TH. Wrote the paper: NAM TAM.
References Top
- (2008) The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol 6: 27. Find this article online
- (2007) Are we underestimating the diversity and incidence of insect bacterial symbionts? A case study in ladybird beetles. Biol Lett 22: 678–681. Find this article online
- (2006) Heritable endosymbionts of Drosophila. Genetics 174: 363–376. Find this article online
- Flyendo: Drosophila endosymbiont database. Retrieved August 2008 from http://flyendoarlarizonaedu/.
- (1996) Wolbachia infection and cytoplasmic incompatibility in Drosophila species. Genetics 144: 1063–1073. Find this article online
- (1979) Sex ratio organisms (Spiroplasmas) of Drosophila. In: Whitcomb RF, Tully JG, editors. The Mycoplasmas. New York: Academic Press. pp. 175–208.
- (1979) Non-male-killing spiroplasmas in Drosophila hydei. J Hered 70: 211–213. Find this article online
- (2005) Male-killing Spiroplasma naturally infecting Drosophila melanogaster. Insect Mol Biol 14: 281–287. Find this article online
- (2006) Male-killing in three species of the tripuncata radiation of Drosophila (Diptera: Drosophilidae). Journal of Zoological Systematics and Evolutionary Research 44: 130–135. Find this article online
- (2009) Multiple introductions of the Spiroplasma bacterial endosymbiont into Drosophila. Molecular Ecology 18: 1294–1305. Find this article online
- (2006) Finding of male-killing Spiroplasma infecting Drosophila melanogaster in Africa implies transatlantic migration of this endosymbiont. Heredity 97: 27–32. Find this article online
- (2003) Population dynamics of male-killing and non-male-killing spiroplasmas in Drosophila melanogaster. Appl Environ Microbiol 69: 1428–1434. Find this article online
- (1991) The interaction phenotype in the Drosophila willistoni spiroplasma symbiosis. Evolution 45: 971–988. Find this article online
- (2006) Prevalence of a non-male-killing Spiroplasma in natural populations of Drosophila hydei. Appl Environ Microbiol 72: 6667–6673. Find this article online
- (2004) Low temperature cure of a male-killing agent in Drosophila melanogaster. J Invert Pathology 86: 50–51. Find this article online
- (2008) Negative effects of low temperatures on the vertical transmission and infection density of a Spiroplasma endosymbiont in Drosophila hydei. Curr Microbiol 57: 335–339. Find this article online
- (2008) High and low temperatures differently affect infection density and vertical transmission of male-killing Spiroplasma symbionts in Drosophila hosts. Appl Environ Microbiol 74: 6053–6059. Find this article online
- (2000) Male-killing bacteria in insects: mechanisms, incidence and implications. Emerg Infect Dis 6: 329–336. Find this article online
- (2008) Evolution and genomics of heritable bacterial symbionts. Annu Rev Genet 42: 165–190. Find this article online
- (2005) Drosophila: A Guide to Species Identification and Use. London: Academic Press.
- (1992) Single-fly DNA preps for PCR. Drosophila Information Service 71: 148–149. Find this article online
- (2001) Spiroplasma symbiont of the pea aphid, Acyrthosiphon pisum (Insecta: Homoptera). Applied and Environmental Microbiology 67: 1284–1291. Find this article online
- (2004) MEGA3, Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5: 150–163. Find this article online
- (1990) Basic local alignment search tool. J Mol Biol 215: 403–410. Find this article online
- (1959) Experimental transfer of maternally inherited abnormal sex ratio in Drosophila willistoni. Genetics 44: 59–74. Find this article online
- (2004) Evolutionarily stable infection by a male-killing endosymbiont in Drosophila innubila: molecular evidence from the host and parasite genomes. Genetics 168: 1443–1445. Find this article online
- (2001) A field cage test of the effects of the endosymbiont Wolbachia on Drosophila melanogaster. Heredity 86: 731–737. Find this article online
- (1998) Population dynamics of the Wolbachia infection causing cytoplasmic incompatibility in Drosophila melanogaster. Genetics 148: 221–231. Find this article online
- (2001) Male-killing Wolbachia in Drosophila: a temperature-sensitive trait with a threshold bacterial density. Genetics 156: 699–709. Find this article online
- (1998) Environmental effects on cytoplasmic incompatibility and bacterial load in Wolbachia-infected Drosophila simulans. Entomol Exp Appl 86: 13–24. Find this article online

Add a note to this text.
Post Your Note (For Public Viewing)