Figures
Abstract
Variant studies on ancient DNA have attempted to reveal individual origin. Here, based on cloning sequencing and polymerase chain reaction-restriction fragment length polymorphisms, we analyzed polymorphisms in the first hypervariable region and coding regions of mitochondrial DNA of 19 human bone remains which were excavated from a tomb near the Terra Cotta Warriors and dated some 2,200 years before present. With the aim of shedding light on origins of these samples who were supposed to be workers building the mausoleum for the First Emperor of China, we compared them with 2,164 mtDNA profiles from 32 contemporary Chinese populations at both population and individual levels. Our results showed that mausoleum-building workers may be derived from very diverse sources of origin.
Citation: Xu Z, Zhang F, Xu B, Tan J, Li S, Li C, et al. (2008) Mitochondrial DNA Evidence for a Diversified Origin of Workers Building Mausoleum for First Emperor of China. PLoS ONE 3(10): e3275. https://doi.org/10.1371/journal.pone.0003275
Editor: Vincent Macaulay, University of Glasgow, United Kingdom
Received: June 23, 2008; Accepted: September 4, 2008; Published: October 1, 2008
Copyright: © 2008 Xu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the National Natural Science Foundation of China (30571013), the Science and Technology Commission of Shanghai Municipality (05pj14023) and Outstanding Young Scientist Award (A category), Chinese National Natural Science Foundation (30625016).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Ancient DNA methodology has made it possible for retrieving genetic information from historic and prehistoric material [1]. Variant studies on ancient DNA have attempted to uncover population history [2], [3], [4], [5], [6], [7] or identify specimens [8], [9], [10], [11]. As one of the preferred markers for ancient DNA analysis [12], [13], mitochondria DNA (mtDNA) shows great advantage over nuclear DNA when dealing with fragmented, chemically modified, and trace amount of DNA from both historical and prehistorical specimens [14], [15], owing largely to its high copy number, rapid mutation rate, absence of recombination, and maternal inheritance.
Ying Zheng was the First Emperor of China, who ended the Warring States Period, established the first empire of China (Qin Dynasty) in 221 BC and died in 210 BC. According to historical records, it took 39 years and 720,000 workers to build an amazingly magnificent mausoleum (about 220,000 square meters, much larger than the pyramid of Khufu) for him. Since the population size of Qin Dynasty was twenty-two millions and it controlled a vast territory, the origin of these workers became an intriguing mystery. Between February and March 2003, 121 human skeletons were excavated by a team from Archaeology Institute of Shannxi when cleaning up a Qin-Dynasty kiln 500 meters away from the site where Terra Cotta Warriors were found. According to morphological observation, some bones were thickset with different extent of arthritis, and others bore fractures or obvious adaptation structures caused by intense pull from muscle, suggesting that these people were engaged in heavy work before death. Furthermore, given their casual and layer-on-layer burial accompanied by potsherds, iron tools, and several instruments of torture in a 10-meter deep tomb, they would have been of very low social status and logically supposed to be mausoleum-building workers (MBW) for the First Emperor of China. Clarification of their origins is imperative to further understanding of the Terra Cotta Warriors and the history of Qin Dynasty. Owing to poor conservation (e.g. eroding by flood), however, it was regrettably difficult to measure crania, leading to inability to identify their origins from physical morphology.
Aiming at uncovering MBWs' origin from genetic information, we investigated mitochondrial lineages of these bone specimens under the hypothesis that MBSs were brought in from various geographic areas.
Materials and Methods
Overall 121 human thighbone specimens were taken from Archaeology Institute of Shannxi (China), and they were of different individuals according to physical examination. Since the quality of the samples is similar by visual inspection, 50 specimens were randomly chosen for the following analysis.
Extraction, DNA amplification and sequencing (Fudan University, Shanghai, China)
To eliminate contamination from prior handling, the outer layer of bone was removed, then soaked in bleach (∼5% sodium hypochlorite solution) for 15 min [16], [17], rinsed in ethanol (70%), and followed by 30 min UV-irradiation for each face. Then each bone was cut into small fragments and ground into a fine power in SPEX SamplePrep Freezer/Mills 6750. Subsequently, about 500 mg bone powder was used for a silica-base DNA extraction as described [18]. At least two independent samplings and extractions were obtained from each remain.
Thermal cycler conditions consisted of initial 15 min incubation at 94°C followed by 45 cycles of 30 s at 94°C, 30 s at 52°C, and 30 s at 72°C, with a final extension step at 72°C for 7 min using three pairs of overlapping primers L16053 (5′-GGGAAGCAGATTTGGGTAC-3′), H16158 (5′-GATGTGGATTGGGTTTTTATG-3′); L16154 (5′-TACCATAAATACTTGACCACCTG-3′), H16265 (5′-GTTTGTTGGTATCCTAGTGGG-3′); L16263 (5′-AACTCCAAAGCCACCCC-3′), H16366 (5′-TGAGGGGGGTCATCCAT-3′); L16016 (5′- ATTCTCTGTTCTTTCATGGG-3′) and H16403 (5′- ATTGATTTCACGGAGGATGG -3′) (numbering according to the revised Cambridge reference sequence(rCRS)[19], Genbank accession number AC_000021). The 25 µl reaction mix contained 1U of rTaq polymerase (Takara), 200 µM of each dNTP, 1.5 mM Mg2+, 1 µM of each primer and 1 µg Bovine Serum Albumin (BSA, Takara) in order to eliminate some effects of the PCR inhibitors from both extraction and specimens [20].
Amplification products of the correct size were purified with AxyPrep PCR Clean-up Kit (Axygen) and subsequently sub-cloned using TA cloning kit (Takara) according to the manufacturer's instruction. Eight clones of each product, with inserts of the expected size identified by PCR using primers RV-M (5′-GAGCGGATAACAATTTCACACAGG-3′) and M13-47 (5′-CGCCAGGGTTTTCCCAGTCACGAC-3′), were purified by means of Shrimp Alkaline Phosphatase (SAP) and Exon I and afterwards sequenced with BigDye Terminator kit (Applied Biosystems) on an ABI 3130xl Genetic Analyzer (Applied Biosystems) using primers RV-M or M13-47.
MtDNA assignment
By searching for haplogroup specific HVR I motif and matching with available modern data sets, the ancient mtDNAs obtained were tentatively assigned to hgs. In addition, hg diagnostic coding region polymorphisms were typed using PCR-RFLP (restriction fragment length polymorphism) [21]. PCR protocol was the same as above with primers listed in Table S1.
Independent replication (Jilin University, Jilin, China)
The surface of each bone fragment was removed, soaked in bleach for 10 min, washed with 100% ethanol, UV-irritated for 30 min on each side and ground into powder with SPEX 5810. DNA was extracted from bone powder using GENECLEAN Kit® For Ancient DNA (Q-BIO gene) according to the manufacturer's instruction. HVR I fragment (16035-16398) of ancient mtDNA was amplified with two pairs of overlapping primers L16017 (5′-TTCTCTGTTCTTTCATGGGGA-3′), H16251 (5′-GGAGTTGCAGTTGATGTGTGA-3′), L16201 (5′-CAAGCAAGTACAGCAATCAAC-3′), and H16409 (5′-AGGATGGTGGTCAAGGGA-3′).
Thermal cycler conditions consisted of initial 4 min incubation at 94°C followed by 6 cycles of 1 min at 94°C, 55 s at 58°C, and 1 min at 72°C and 34 cycles of 1 min at 94°C, 55 s at 54°C, and 1 min at 72°C, with a final extension step at 72°C for 10 min. The 12.5 µl reaction mix contained 1 U of Taq polymerase, 200 µM of each dNTP, 2.5 mM MgCl2, 50 mM KCl, 2 µM of each primer and 2 mg/mL BSA. PCR products were directly sequenced with ABI 310 Terminator sequencing Kit (Applied Biosystems, Foster, USA) using the same primers as PCR.
Authentication
Standard precaution and measures for ancient DNA analysis with object to demonstrate authenticity of the obtained data were strictly followed [1], [22], [23], [24]. All samples were excavated recently and had been kept in room temperature storage with minimal handling. This is important as previous studies found a high proportion of contaminants on museum materials [25] although the contamination level varies [26] presumably as a consequence of the extent of handling. All pre-PCR work was performed in a laboratory exclusively dedicated to ancient DNA manipulation and physically separated from the laboratory in which PCR cycling and post-PCR analysis was conducted. Additionally, a one-way (pre-PCR→PCR→post-PCR) procedure was always followed to avoid the imperceptible carrying of DNA aerosols on clothes or skin into the ancient laboratory [27]. Disposable tools, masks, gloves, laboratory coats, and filter-plugged tips were used and changed frequently to avoid cross-contamination. To detect possible contamination, negative controls were implemented for each sample for extraction and PCR. To trace possible contamination, mtDNA sequences from the authors and other laboratory members who had manipulated the bones were obtained. Only independent extractions and amplifications yielding identical sequences with all controls being negative were included in the subsequent analyses. Primers covering three overlapping fragments were used for reducing the likelihood that a nuclear insertion rather than the organelle mtDNA was amplified [23], [28], [29]. Since lesions in the ancient DNA template would be expected to be non-reproducible from different extracts [30] and artifacts at a given site caused by low fidelity of polymerase and sequencing error, as well as jumping PCR [31], [32], were detectable across clones, two independent extractions and cloning sequencing were conducted. Sequences were aligned and compared across clones. Hgs were validated by both HVR I motifs and hg specific coding region SNPs. Moreover, to identify potential laboratory-based contamination, independent replication was conducted at a separate laboratory (Ancient DNA Laboratory, Research Center for Chinese Frontier Archaeology, Jilin University) exclusively dedicated to ancient DNA manipulation. Nevertheless, for the confirmation that DNA was present in the sample, we relied on replicated extraction and amplification both within and between laboratories as done in various other studies [30], [33], [34] rather than amino acid racemization. To detect ‘long’ range amplification of ancient DNA [15], [22], [35], an alternative 408-bp PCR fragment using primers L16016 (5′- ATTCTCTGTTCTTTCATGGG-3′) and H16403 (5′- ATTGATTTCACGGAGGATGG-3′) were amplified.
Sequence analysis
Overall 2,164 mtDNA profiles from previous published mtDNA data of 32 Chinese populations (Table S2, Figure S1) were taken as representatives of contemporary Chinese and used for comparison with MBWs. The 32 contemporary Chinese populations were grouped as Northern Han (NH), Southern Han (SH), Northern Minorities (NM) and Southern Minorities (SM) according to their geographic locations and ethnic affiliation and knowledge on significant differentiation between Northern and Southern Hans [36], [37]. Gene diversity and nucleotide diversity were calculated using ARLEQUIN version 3.1 [38]. Principal component (PC) plot were obtained using SPSS for Windows Release 11.0.1 (15th Nov 2001). Median-joining networks of hgs were constructed using Network 4.5.0.0 (www.fluxus-engineering.com).
Results
Among 50 bone specimens for which DNA was extracted, 19 yielded replicable profiles within laboratory, two (M54, M57) of which were sent for independent replication at Jilin University and yielded consistent results. These 19 authenticated samples (Table 1) were included in the subsequent analysis. The other 31 specimens include 22 with no amplifiable DNA and 9 failed to be replicated within laboratory.
All the 19 authenticated specimens showed appropriate ancient DNA molecular behaviors including chimeric sequences [39], [40] observed as difference among clones (Figure 1), and failure to amplify a 408-bp PCR fragment. No sequences showed obvious conflict with hg-defining segregating sites except for 16102 T->C in M60, which was a rare substitution found only in one published study [41]. A total of 314 nucleotides, corresponding to 16053–16366 in rCRS [19] were sequenced. The total alignment included 45 substitutions, of which 38 were affected by transitions and 7 by transversions, but no deletion and insertion were observed.
rCRS, revised Cambridge reference sequence [19]; A dot indicates identity with respect to rCRS; a, b and c are clones from the fragment between nucleotides (nt) 16053–16158, 16154–16265, and 16263–16366. The transition at nt 16223, 16239, 16298, 16327 and 16357 were observed in most of clones, and are presumed to be true transition in the authentic DNA. The diverging sequences (c7 and c8) are considered to represent exogenous DNA, but they do not match any of staffs (Table 3). The substitutions at nt 16079, 16089, 16107, 16109, 16148, 16172, 16211, 16227, 16259, 16306, 16313, are presumed to be the result of scattered miscoding lesions, which is a characteristic finding for ancient DNA [30].
Variations out of the range 16053–16366 in the modern data set were excluded for analysis. The gene diversity and nucleotide diversity of mtDNA HVR I of MBWs was 1.000 (S.E. 0.017) and 0.019 (S.E. 0.010), respectively, which were both slightly higher than 32 extant populations (Table S3), despite non-significant differences (p>0.05).
To generate a PC plot (Figure 2), estimated percentage of hgs shared between MBWs and 32 modern populations were calculated (Table S3) and hgs absent in MBWs were excluded. The MBWs is an obvious outlier without showing any close affiliation with any of the extant populations.
The 32 Chinese populations were divided into four groups (see Table S2).
The 19 specimens could be classified into 15 hgs, none of which that seem to be specific in the extant west Eurasian populations. The MP (Maximum parsimony) trees of median-joining networks of 13 hgs were constructed and shown in Figure S2 where MBWs were marked as solid circles. The network for hg M7a and B5 were not constructed due to data scarcity in the 2,164 mtDNA profiles. The clustering of each MBW profile with those observed in the extant populations may reveal the possible sources although cautions should be taken considering the fact that more recent migrations may have affected the hg frequencies in the extant populations. Nevertheless, the MBWs might be derived from very diverse sources. In particular, M86 (hg A) shared HVR1 variation with a NH from Qinghai Province. M98 (hg B4a) clustered with SM, indicating this worker might come from a minority of southern China. It should be noted that the frequency of hg B4a is high in SM [42]. M17 (hg B5b) was likely a SH on account of its position, and M60 (hg G2a) seemed likely to come from Han. M61 (hg D5) closely resembled with some SMs, and M21 (hg F*) clustered together with some NHs. Given high frequency of hg F1a1 in Southeast Asia [43], M57 and M71 (both with hg F1a1) might be originated from the south. Since hg D* was present with high frequency in both NM [44], [45] and SM [42] and rare in Han [46], M53 (hg D*) could be excluded from Han. However, MP trees are uninformative in revealing the sources of M37 (hg F1b), M39 (hg F1b), M41 (hg N9a), M43 (hg N9a), M47 (hg N9a), M31 (hg N*), M54 (hg C) and M7 (hg M8a). The network for hg M7a and B5 were not constructed due to the lack of sufficient data in our current database on Chinese, thus the affiliation of M91 (hg B5) and M50 (hg M7a) could not be inferred.
Discussion
In the present study, we successfully extracted and analyzed maternal genetic information from 19 MBWs, the low amplification success (38%) as well as the difference of amplification between two sets of primers was in agreement with the poor conservation. However, the independent replication in Jilin University was carried out using primers targeting fragments longer than 200 bp and yielded consistent results, indicating that these 19 MBWs were in better conservation. Based on the high diversity of aDNAs (Table S3), the likelihood that they were from contaminants of several persons or cross-contamination was very low. Moreover, the failure of amplifying the 408-bp PCR fragment provided indirect evidence that longer templates were not present in large numbers. Miscoding lesions observed within clones of PCR products (Table 2, Figure 1) showed that Type 2 (cytosine->thymine/guanine->adenine) miscoding lesions represent the majority of damage-derived miscoding lesions in most of MBWs. This was consistent with previous studies [47], [48], though there were several transversions and more Type 1 (thymine->cytosine/adenine->guanine) miscoding lesions than Type 2 in some specimens, due to Taq polymerase error. Concerning the elaborate precaution we adopted and phylogenetic analysis, as well as the typical characteristic of ancient DNA, we believed that these 19 mtDNA HVR I sequences were authentic.
It is likely that MBWs was an admixture of East Asians. First, this 19-individual population was surprisingly more diverse than any of the 32 populations. In parallel, PC plot (Figure 2) of estimated percentage of shared hgs strongly supported that MBWs was obviously distinct from all 32 compared populations on first and second principal component. According to phylogeny of mtDNA lineages [46], [49], [50], these 19 specimens of MBWs could be assigned to 15 east-Eurasia specific hgs.
In particular, four specimens (M86, M60, M21 and M17), accounting for 21%, could be Han in origin, while three specimens (M98, M61 and M53, 16%) were likely from SM. Overall seven specimens (M17, M60, M21, M98, M61, M57 and M71, 37%) were likely originated from the south, while only one (M86, 5%) was from the north. According to a previous study of frequency distribution of dominating mtDNA hgs [51], M7 (hg M8a), M53 (hg D*), M54 (hg C), M60 (hg G2a), M61 (hg D5) and M86 (hg A), accounting for 32%, might come from the north, while M17 (hg B5b), M21 (hg F*), M31 (hg N*), M37 (hg F1b), M39 (hg F1b), M50 (hg M7a), M71 (hg F1a1), M57 (hg F1a1), M91 (hg B5) and M98 (B4a), accounting for 53%, were likely from the south. We therefore postulated that both Hans and minorities were recruited for building mausoleum, but many were from South China. This might, if not impossible, reflect the origin of 720,000 workers, provided that these 19 MBWs might be representative of them. Additionally, no specimen was distinctively from NM, and it did not come as a surprise because of geographic locations of NM, which are a little far away from the territory of Qin Dynasty as shown in Figure S1.
Interestingly, the specimen M50 (HVR I motif 16209–16223) belonging to hg M7a, had the same variation with a Japanese [52] and several Ryukyuans [53], [54]. Given that M7a has a much higher frequency in Ryukyuans [43] with the greatest Asian diversity (83%) than in Chinese [54], it seemed likely that this worker had a relatively closer genetic affinity with the ancestors of modern Japanese.
In conclusion, we showed that MBWs was an admixture and bore genetic continuity with contemporary Chinese populations. Its origin was much diversified, which seems to be compatible with historical accounts that the sources of slaved workers at Qin Dynasty tend to be extremely diverse. Furthermore, we showed that a strong presence of the workers of southern origins although the results of analysis should be taken with caution in the context of more recent migrations after Qin Dynasty. Further studies are important to provide a more definitive understanding on the origin of these samples using the whole genome of mtDNA and Y chromosomal variations.
Electronic-Database Information
Accession numbers and the URL for data in this article are as follows: GenBank Overview, http://www.ncbi.nlm.nih.gov/Genbank/GenbankOverview.html (for mtDNA control region data; accession numbers EU700062-EU700080).
Supporting Information
Table S1.
Primers for mtDNA coding region SNPs assay with PCR-RFLP
https://doi.org/10.1371/journal.pone.0003275.s001
(0.03 MB DOC)
Table S2.
Overall 32 populations used for comparison
https://doi.org/10.1371/journal.pone.0003275.s002
(0.13 MB DOC)
Table S3.
Estimated percentages of haplogroups shared among MBWs and modern Chinese populations, as well as gene diversity of each population.
https://doi.org/10.1371/journal.pone.0003275.s003
(0.11 MB DOC)
Figure S1.
Geographic locations of the populations considered in this study.
https://doi.org/10.1371/journal.pone.0003275.s004
(6.74 MB TIF)
Figure S2.
Maximum Parsimony (MP) trees of median-joining networks
https://doi.org/10.1371/journal.pone.0003275.s005
(9.69 MB TIF)
Author Contributions
Conceived and designed the experiments: ZX FZ. Performed the experiments: ZX FZ BX CL. Analyzed the data: ZX LJ. Contributed reagents/materials/analysis tools: JT SL HZ HZ JZ QD. Wrote the paper: ZX LJ.
References
- 1. Pääbo S, Poinar H, Serre D, Jaenicke-Despres V, Hebler J, et al. (2004) Genetic analyses from ancient DNA. Annu Rev Genet 38: 645–679.
- 2. Gao SZ, Yang YD, Xu Y, Zhang QC, Zhu H, et al. (2007) Tracing the genetic history of the Chinese people: Mitochondrial DNA analysis of aneolithic population from the Lajia site. Am J Phys Anthropol 133: 1128–1136.
- 3. Tömöry G, Csányi B, Bogácsi-Szabó E, Kalmár T, Czibula A, et al. (2007) Comparison of maternal lineage and biogeographic analyses of ancient and modern Hungarian populations. Am J Phys Anthropol 134: 354–368.
- 4. Sato T, Amano T, Ono H, Ishida H, Kodera H, et al. (2007) Origins and genetic features of the Okhotsk people, revealed by ancient mitochondrial DNA analysis. J Hum Genet 52: 618–627.
- 5. Kemp BM, Malhi RS, McDonough J, Bolnick DA, Eshleman JA, et al. (2007) Genetic analysis of early holocene skeletal remains from Alaska and its implications for the settlement of the Americas. Am J Phys Anthropol 132: 605–621.
- 6. Caramelli D, Vernesi C, Sanna S, Sampietro L, Lari M, et al. (2007) Genetic variation in prehistoric Sardinia. Hum Genet 122: 327–336.
- 7. Endicott P, Gilbert MT, Stringer C, Lalueza-Fox C, Willerslev E, et al. (2003) The genetic origins of the Andaman Islanders. Am J Hum Genet 72: 178–184.
- 8. Kurosaki K, Matsushita T, Ueda S (1993) Individual DNA identification from ancient human remains. Am J Hum Genet 53: 638–643.
- 9. Oota H, Saitou N, Matsushita T, Ueda S (1999) Molecular genetic analysis of remains of a 2,000-year-old human population in China-and its relevance for the origin of the modern Japanese population. Am J Hum Genet 64: 250–258.
- 10. Xie CZ, Li CX, Cui YQ, Zhang QC, Fu YQ, et al. (2007) Evidence of ancient DNA reveals the first European lineage in Iron Age Central China. Proc Biol Sci 274: 1597–1601.
- 11. Dissing J, Binladen J, Hansen A, Sejrsen B, Willerslev E, et al. (2007) The last Viking King: a royal maternity case solved by ancient DNA analysis. Forensic Sci Int 166: 21–27.
- 12. Cavalli-Sforza LL, Feldman MW (2003) The application of molecular genetic approaches to the study of human evolution. Nat Genet 33: Suppl266–275.
- 13. Wallace DC, Brown MD, Lott MT (1999) Mitochondrial DNA variation in human evolution and disease. Gene 238: 211–230.
- 14. Höss M, Jaruga P, Zastawny TH, Dizdaroglu M, Pääbo S (1996) DNA damage and DNA sequence retrieval from ancient tissues. Nucleic Acids Res 24: 1304–1307.
- 15. Hofreiter M, Serre D, Poinar HN, Kuch M, Pääbo S (2001) Ancient DNA. Nat Rev Genet 2: 353–359.
- 16. Kemp BM, Smith DG (2005) Use of bleach to eliminate contaminating DNA from the surface of bones and teeth. Forensic Sci Int 154: 53–61.
- 17. Malmström H, Svensson EM, Gilbert MT, Willerslev E, Götherström A, et al. (2007) More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA. Mol Biol Evol 24: 998–1004.
- 18. Rohland N, Hofreiter M (2007) Ancient DNA extraction from bones and teeth. Nat Protoc 2: 1756–1762.
- 19. Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, et al. (1999) Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23: 147.
- 20. Rohland N, Hofreiter M (2007) Comparison and optimization of ancient DNA extraction. Biotechniques 42: 343–352.
- 21. Yao YG, Kong QP, Man XY, Bandelt HJ, Zhang YP (2003) Reconstructing the evolutionary history of China: a caveat about inferences drawn from ancient DNA. Mol Biol Evol 20: 214–219.
- 22. Cooper A, Poinar HN (2000) Ancient DNA: do it right or not at all. Science 289: 1139.
- 23. Willerslev E, Cooper A (2005) Ancient DNA. Proc Biol Sci 272: 3–16.
- 24. Gilbert MT, Bandelt HJ, Hofreiter M, Barnes I (2005) Assessing ancient DNA studies. Trends Ecol Evol 20: 541–544.
- 25. Malmström H, Storå J, Dalén L, Holmlund G, Götherström A (2005) Extensive human DNA contamination in extracts from ancient dog bones and teeth. Mol Biol Evol 22: 2040–2047.
- 26. Noonan JP, Hofreiter M, Smith D, Priest JR, Rohland N, et al. (2005) Genomic sequencing of Pleistocene cave bears. Science 309: 597–599.
- 27. MacHugh DE, Edwards CJ, Bailey JF, Bancroft DR, Bradley D (2000) The extraction and analyses of ancient DNA from bone and teeth: a survey of current methodologies. Anc Biomol 3: 81–102.
- 28. Wallace DC, Stugard C, Murdock D, Schurr T, Brown MD (1997) Ancient mtDNA sequences in the human nuclear genome: a potential source of errors in identifying pathogenic mutations. Proc Natl Acad Sci U S A 94: 14900–14905.
- 29. Caramelli D, Lalueza-Fox C, Capelli C, Lari M, Sampietro ML, et al. (2007) Genetic analysis of the skeletal remains attributed to Francesco Petrarca. Forensic Sci Int 173: 36–40.
- 30. Töpf AL, Gilbert MT, Dumbacher JP, Hoelzel AR (2006) Tracing the phylogeography of human populations in Britain based on 4th–11th century mtDNA genotypes. Mol Biol Evol 23: 152–161.
- 31. Gilbert MT, Hansen AJ, Willerslev E, Rudbeck L, Barnes I, et al. (2003) Characterization of genetic miscoding lesions caused by postmortem damage. Am J Hum Genet 72: 48–61.
- 32. Pääbo S, Irwin DM, Wilson AC (1990) DNA damage promotes jumping between templates during enzymatic amplification. J Biol Chem 265: 4718–4721.
- 33. Lalueza-Fox C, Sampietro ML, Gilbert MT, Castri L, Facchini F, et al. (2004) Unravelling migrations in the steppe: mitochondrial DNA sequences from ancient central Asians. Proc Biol Sci 271: 941–947.
- 34. Ricaut FX, Fedoseeva A, Keyser-Tracqui C, Crubézy E, Ludes B (2005) Ancient DNA analysis of human neolithic remains found in northeastern Siberia. Am J Phys Anthropol 126: 458–462.
- 35. Pääbo S (1989) Ancient DNA: extraction, characterization, molecular cloning, and enzymatic amplification. Proc Natl Acad Sci U S A 86: 1939–1943.
- 36. Zhao TM, Lee TD (1989) Gm and Km allotypes in 74 Chinese populations: a hypothesis of the origin of the Chinese nation. Hum Genet 83: 101–110.
- 37. Wen B, Li H, Lu D, Song X, Zhang F, et al. (2004) Genetic evidence supports demic diffusion of Han culture. Nature 431: 302–305.
- 38. Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics 1: 47–50.
- 39. Hebsgaard MB, Wiuf C, Gilbert MT, Glenner H, Willerslev E (2007) Evaluating Neanderthal genetics and phylogeny. J Mol Evol 64: 50–60.
- 40. DeSalle R, Barcia M, Wray C (1993) PCR jumping in clones of 30-million-year-old DNA fragments from amber preserved termites (Mastotermes electrodominicus). Experientia 49: 906–909.
- 41. Horai S, Hayasaka K (1990) Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA. Am J Hum Genet 46: 828–842.
- 42. Wen B, Xie X, Gao S, Li H, Shi H, et al. (2004) Analyses of genetic structure of Tibeto-Burman populations reveals sex-biased admixture in southern Tibeto-Burmans. Am J Hum Genet 74: 856–865.
- 43. Trejaut JA, Kivisild T, Loo JH, Lee CL, He CL, et al. (2005) Traces of archaic mitochondrial lineages persist in Austronesian-speaking Formosan populations. PLoS Biol 3: e247.
- 44. Kong QP, Yao YG, Liu M, Shen SP, Chen C, et al. (2003) Mitochondrial DNA sequence polymorphisms of five ethnic populations from northern China. Hum Genet 113: 391–405.
- 45. Yao YG, Kong QP, Wang CY, Zhu CL, Zhang YP (2004) Different matrilineal contributions to genetic structure of ethnic groups in the silk road region in china. Mol Biol Evol 21: 2265–2280.
- 46. Yao YG, Kong QP, Bandelt HJ, Kivisild T, Zhang YP (2002) Phylogeographic differentiation of mitochondrial DNA in Han Chinese. Am J Hum Genet 70: 635–651.
- 47. Gilbert MT, Binladen J, Miller W, Wiuf C, Willerslev E, et al. (2007) Recharacterization of ancient DNA miscoding lesions: insights in the era of sequencing-by-synthesis. Nucleic Acids Res 35: 1–10.
- 48. Brotherton P, Endicott P, Sanchez JJ, Beaumont M, Barnett R, et al. (2007) Novel high-resolution characterization of ancient DNA reveals C>U-type base modification events as the sole cause of post mortem miscoding lesions. Nucleic Acids Res.
- 49. Kivisild T, Tolk HV, Parik J, Wang Y, Papiha SS, et al. (2002) The emerging limbs and twigs of the East Asian mtDNA tree. Mol Biol Evol 19: 1737–1751.
- 50. Kong QP, Yao YG, Sun C, Bandelt HJ, Zhu CL, et al. (2003) Phylogeny of east Asian mitochondrial DNA lineages inferred from complete sequences. Am J Hum Genet 73: 671–676.
- 51. Xue F, Wang Y, Xu S, Zhang F, Wen B, et al. (2008) A spatial analysis of genetic structure of human populations in China reveals distinct difference between maternal and paternal lineages. Eur J Hum Genet.
- 52. Oota H, Kitano T, Jin F, Yuasa I, Wang L, et al. (2002) Extreme mtDNA homogeneity in continental Asian populations. Am J Phys Anthropol 118: 146–153.
- 53. Horai S, Murayama K, Hayasaka K, Matsubayashi S, Hattori Y, et al. (1996) mtDNA polymorphism in East Asian Populations, with special reference to the peopling of Japan. Am J Hum Genet 59: 579–590.
- 54. Tanaka M, Cabrera VM, Gonzalez AM, Larruga JM, Takeyasu T, et al. (2004) Mitochondrial genome variation in eastern Asia and the peopling of Japan. Genome Res 14: 1832–1850.