Search
Advanced Search
Metrics info
Average Rating (3 User Ratings)
    • Currently 4.5/5 Stars.
    See all categories
      • Currently 4.7/5 Stars.
      • Currently 4.3/5 Stars.
      • Currently 4/5 Stars.
    Rate This Article
Share this Article info
  • Bookmark: StumbleUpon Facebook Connotea CiteULike Bibliography

Open Access

Research Article

Wnt and TGF-β Expression in the Sponge Amphimedon queenslandica and the Origin of Metazoan Embryonic Patterning

Background

The origin of metazoan development and differentiation was contingent upon the evolution of cell adhesion, communication and cooperation mechanisms. While components of many of the major cell signalling pathways have been identified in a range of sponges (phylum Porifera), their roles in development have not been investigated and remain largely unknown. Here, we take the first steps toward reconstructing the developmental signalling systems used in the last common ancestor to living sponges and eumetazoans by studying the expression of genes encoding Wnt and TGF-β signalling ligands during the embryonic development of a sponge.

Methodology/Principal Findings

Using resources generated in the recent sponge Amphimedon queenslandica (Demospongiae) genome project, we have recovered genes encoding Wnt and TGF-β signalling ligands that are critical in patterning metazoan embryos. Both genes are expressed from the earliest stages of Amphimedon embryonic development in highly dynamic patterns. At the time when the Amphimedon embryos begin to display anterior-posterior polarity, Wnt expression becomes localised to the posterior pole and this expression continues until the swimming larva stage. In contrast, TGF-β expression is highest at the anterior pole. As in complex animals, sponge Wnt and TGF-β expression patterns intersect later in development during the patterning of a sub-community of cells that form a simple tissue-like structure, the pigment ring. Throughout development, Wnt and TGF-β are expressed radially along the anterior-posterior axis.

Conclusions/Significance

We infer from the expression of Wnt and TGF-β in Amphimedon that the ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues. The radially symmetrical expression patterns of Wnt and TGF-β along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.

Maja Adamska, Sandie M. Degnan, Kathryn M. Green, Marcin Adamski, Alina Craigie, Claire Larroux, Bernard M. Degnan*

School of Integrative Biology, The University of Queensland, Brisbane, Queensland, Australia

Abstract Top

Background

The origin of metazoan development and differentiation was contingent upon the evolution of cell adhesion, communication and cooperation mechanisms. While components of many of the major cell signalling pathways have been identified in a range of sponges (phylum Porifera), their roles in development have not been investigated and remain largely unknown. Here, we take the first steps toward reconstructing the developmental signalling systems used in the last common ancestor to living sponges and eumetazoans by studying the expression of genes encoding Wnt and TGF-β signalling ligands during the embryonic development of a sponge.

Methodology/Principal Findings

Using resources generated in the recent sponge Amphimedon queenslandica (Demospongiae) genome project, we have recovered genes encoding Wnt and TGF-β signalling ligands that are critical in patterning metazoan embryos. Both genes are expressed from the earliest stages of Amphimedon embryonic development in highly dynamic patterns. At the time when the Amphimedon embryos begin to display anterior-posterior polarity, Wnt expression becomes localised to the posterior pole and this expression continues until the swimming larva stage. In contrast, TGF-β expression is highest at the anterior pole. As in complex animals, sponge Wnt and TGF-β expression patterns intersect later in development during the patterning of a sub-community of cells that form a simple tissue-like structure, the pigment ring. Throughout development, Wnt and TGF-β are expressed radially along the anterior-posterior axis.

Conclusions/Significance

We infer from the expression of Wnt and TGF-β in Amphimedon that the ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues. The radially symmetrical expression patterns of Wnt and TGF-β along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.

Introduction Top

Little is known about the morphogenetic complexity of the last common ancestor of modern multicellular animals, but it is generally thought to be an extremely simple organism without a body axis, multiple cell layers and tissues [reviewed in 1]. We can reconstruct this hypothetical animal–the Urmetazoa–by identifying common features in embryonic development of distantly related extant clades, specifically bilaterians, cnidarians, ctenophores and sponges. Among these groups, bilaterians are represented by long-favourite developmental model systems and several hypotheses have been proposed regarding morphogenetic complexity of their last common ancestor–the so-called Urbilateria or protostome-deuterostome ancestor [reviewed in 2]. Recent studies demonstrate surprising similarity between cnidarian and bilaterian gene content and development [3][7]. For example, the expression of Wnt genes is associated with blastopore and site of gastrulation in cnidarian and chordate embryos [3], [5], [8], [9]. Even more surprisingly, TGF-β ligands that are involved in determination of the dorsal-ventral axis in bilaterians are also asymmetrically expressed during cnidarian development [6], [7], [10]. Without attempting to homologize the embryonic axes between cnidarians and bilaterians, the existence of two perpendicular embryonic axes, one directed by a Wnt gradient, and the other by a TGF-β gradient in the last common ancestor of living cnidarians and bilaterians appears plausible.

Until recently, developmental genetic data have not been available from sponges, whose adult body plan has not changed since before the Cambrian explosion [11], [12]. Molecular phylogenies agree that the sponge lineage(s) diverged from the main (eu)metazoan lineage before all other major extant phyla [13][19]. Unlike the morphologically more complex eumetazoans, sponges are considered to lack true tissue-level organization and metazoan-specific cell types such as neurons and muscles. Historically, these fundamental differences in the body plans have led to a prevailing view that sponges are living representatives of an evolutionary intermediary between unicellular choanoflagellate protists and the eumetazoans [20]. Indeed, many adult sponges, such as the adult demosponge Amphimedon queenslandica (formerly known as Reniera sp.; Fig. 1A), have highly plastic body shapes and lack an apparent anterior-posterior (AP) axis of symmetry (Fig. 1A). However, most sponge embryos and larvae have an obvious AP axis with radial symmetry. This similarity to other metazoans is lost at metamorphosis when the growing sponge assumes its sessile body form (Fig 1B–F). Importantly, the formation of a patterned larva with a range of cell types distributed along the AP axis and allocated into different cell layers indicates that sponge embryos must have a requirement for localised signals [21], [22].

thumbnail

Figure 1. Amphimedon queenslandica life cycle and embryonic development.

Top panels, live specimens. (A) Adult animal. (B) Swimming larva. (C) Larva undergoing settlement with anterior part flattened on substrate. (D) Postlarva 24 hours post settlement (ps). (E) A three week old juvenile. (F) Sliced brood chamber showing developing embryos of different stages. Bottom panel, benzyl alcohol/benzyl benzoate cleared whole mount developmental stages. (G) After a series of chaotic and asymmetric cell divisions there is a population of unevenly-sized and irregular macromeres and a population of tiny micromeres that are located on the surface and between the macromeres. Micromeres are too small to be seen in this micrograph. (H) A solid blastula is formed. (I) Gastrulation results in a bilayered embryo with the outer layer thicker at the future posterior pole (top); darker pigment cells are distributed throughout the outer layer. (J) Pigment cells migrate through the outer layer towards the posterior pole and coalesce to form a pigment spot. (K–L) The cells of the pigment spot reverse direction and migrate outwards to form a ring. (L, M) Swimming larva with a posterior pigment ring, inner cell mass, ciliated epithelial layer and a subepithelial middle layer. See 21 and 22 for a more detailed description of development and larval cell types. Scale bar is 100 µm on all images except (A) where it is 1 cm. ap–anterior pole, pp–posterior pole.

doi:10.1371/journal.pone.0001031.g001

The recent sequencing of the genome of the demosponge Amphimedon queenslandica by the Joint Genome Institute greatly facilitates reconstruction of the genetic repertoire that was present in the last common ancestor to all contemporary metazoans and reveals the innovations that lead to evolution of the first branches in the animal tree of life [23][28]. Amongst these innovations must have been a suite of signalling pathways that allow for communication in a range of multicellular contexts, including cell specification and patterning [22]. The highly conserved Wnt and TGF-β signalling pathways are fundamental to a plethora of developmental processes in bilaterian animals. In addition to specification of the first embryonic axes, these pathways interact to specify cells and to pattern tissues in many morphogenetic contexts, ranging from the formation of embryonic organizers [29][32], vertebrate skeleton [33] and the development of limbs in Drosophila and other bilaterians [34][36]. The primacy of Wnt and TGF-β pathways in intercellular communication and cell fate diversification suggests that their evolution may have been concomitant with the origin of multicellularity [22], [37]. Here we address this issue by investigating the expression of Wnt and TGF-β genes during embryonic development in Amphimedon queenslandica. The asymmetrical expression of both genes in Amphimedon embryos indicates that sponges, and hence also the last common ancestor to living metazoans, utilized these two signalling pathways in embryonic patterning.

Results Top

Amphimedon embryogenesis

Amphimedon queenslandica embryos develop in brood chambers, with different developmental stages found together in one chamber (Fig. 1F). Early cleavage stages are milky-white and are found mainly at the edges of the brood chamber (Fig. 1F–G). At this time, cell divisions appear highly asymmetric and asynchronous, and the embryos are composed of irregularly shaped macromeres of various sizes with small micromeres interspersed between them (Fig. 1G). A solid blastula, with more uniformly sized cells is formed at the end of this process, and it does not display any morphological asymmetry (Fig. 1H). Different cell populations present in the blastula sort themselves into layers in a process that we consider to be gastrulation [21]. At the end of gastrulation, the outer layer is composed of smaller micromeres including pigment cells that give embryos a beige colour; bigger macromeres are present in the inner cell mass (Fig. 1I). While no asymmetry can be observed in live embryos, cleared beige coloured embryos reveal striking anterior-posterior asymmetry, with the outer layer significantly thicker at the posterior pole (Fig. 1I). Pigment cells initially distributed throughout the outer layer soon begin migration towards the posterior pole (Fig. 1J), where they coalesce into a spot, and then begin outwards migration resulting in formation of a narrow pigment ring (Fig. 1 J–L). At the same time, multiple cell types migrate along the anterior-posterior axis to yield a highly patterned larva that consists of multiple cell layers, each of which contains a number of distinct cell types [21, Fig. 1L–M].

Wnt and TGF-β ligands are present in Amphimedon

We isolated Wnt and TGF-β genes from Amphimedon using a combination of EST and genome trace searches and RACE cloning. The deduced Amphimedon Wnt protein contains a signal peptide and 24 conserved cysteines characteristic for this family [38], [39] (Fig. S1), although phylogenetic analyses can not confidently assign this sponge Wnt into a recognised eumetazoan sub-family (Fig. S2) [39].

Phylogenetic analysis of the predicted Amphimedon TGF-β signalling domain places it close to the GDNF subfamily of TGF-β molecules (Fig. S3). Of the 7 cysteines that are conserved in the signalling domain of TGF-β superfamily, 6 are present in the Amphimedon sequence (Fig. S4). Cysteine 4 is missing, as it is the case in mouse GDF3, GDF9 and BMP15 proteins [40]. Since this particular cysteine is responsible for intermolecular disulfide bond formation in a mature dimer, it appears that the Amphimedon TGF-β can act as a monomer or forms a non-covalent dimer [40]. The preprotein contains a signal peptide and a conserved proteolytic cleavage site RTRRS, lending further support to its assignment to this signalling protein family (Fig. S5) [41].

Expression of Wnt and TGF-β genes during Amphimedon development

We studied the expression of the identified genes using whole mount in situ hybridization on Amphimedon embryos and larvae. Amphimedon Wnt gene is expressed from the early stages of development (Fig. 2). There is no evidence that Wnt transcripts are maternally deposited in oocytes or eggs. During cleavage, the Amphimedon embryo consists of large macromeres of varying size and shape surrounded by many tiny micromeres [Fig. 1G; 21]. Wnt transcripts first can be detected in very small micromeres that are uniformly distributed throughout the embryo and interspersed between the macromeres (Fig. 2A). At the next recognizable stage of development, the blastula stage, the embryo consists of more evenly sized cells [Fig. 1H; 21]. At this stage, Wnt-expressing cells are enriched in the inner part of the embryo (Fig 2B). Before any morphological asymmetry in the embryo can be detected by cytological indicators [21], [22, unpublished], Wnt-expressing cells become restricted to the inner cell mass on one side of the embryo (Fig. 2C, D). We have called this stage early gastrulation based on these localized Wnt expression patterns. As gastrulation progresses and separation of outer and inner layer becomes apparent, the Wnt-expressing cells become confined to the outer layer at the posterior pole (Fig 2E, F). The posterior pole is relative to larval swimming direction and where the pigment cells will eventually coalesce and form a ring [Fig. 1J][M, 21, 22]. The Wnt expression domain overlaps with the pigment spot and ring (Fig. 2G–I) and this expression continues within the pigment ring in the free swimming larva (Fig. 2J).

thumbnail

Figure 2. Expression of Wnt in Amphimedon embryos.

Top panel, whole mount in situ hybridizations; bottom panel, sectioned in situ hybridisations. (A) During cleavage, Wnt is expressed in micromeres distributed throughout the early embryo. (B) At the blastula stage, Wnt-expressing cells are predominantly localised interiorly. (C, D) Asymmetric localisation of Wnt-expressing cells occurs early in gastrulation, initially inside of the embryo. (E, F) As the gastrulation progresses, Wnt-positive cells are evident in the outer layer in the posterior pole. (G, H) At the spot stage, Wnt expression overlaps with the pigment spot and extends beyond it. (I) This expression pattern is maintained during ring formation. (J) Expression of Wnt continues in the posterior pole in swimming larvae. Scale bar is 100 µm. ap, anterior pole; pp, posterior pole.

doi:10.1371/journal.pone.0001031.g002

Similar to Wnt expression, TGF-β expression is first detectable during cleavage stage in small micromeres, which do not appear cytologically different from the Wnt expressing cells (Fig. 3A). However, at the blastula stage TGF-β-expressing cells are more prominent in the outer region (Fig. 3B), while Wnt expressing cells are enriched in the inner region (Fig. 2A), indicating that these are largely different populations of cells. During gastrulation, TGF-β expression becomes restricted to the outer layer, with stronger domains of expression at anterior and posterior poles of the embryo (Fig 3C, D). Thus, at the gastrula stage, the posterior domain of TGF-β-expression overlaps with Wnt-expression at the posterior pole. At the pigment spot stage (Fig. 1J, 3E–F), TGF-β expression is maintained in the centre of the spot and throughout the outer layer, except in pigment cells making the outer portion of the spot and the region immediately adjacent to the spot (Fig. 3E, F). The anterior pole domain of TGF-β expression is particularly prominent at the spot stage (Fig 3F, G). The anterior region of the larva consists of a different cell type than the majority of the outer layer [21]. As the pigment cells begin to move concentrically away from the posterior pole to form the pigment ring [Fig. 1K], [21, 22], TGF-β is expressed inside of the ring (Fig. 3H). As pigment ring formation progresses, TGF-β expression is not longer detected in the centre of the ring, but delineates the inner rim of the ring (Fig. 3I, J). During the ring formation stages, TGF-β expression continues throughout the outer layer except of the narrow band of cells just outside of the ring (Fig. 3I, J). TGF-β expression in the embryo gradually decreases, and the transcripts are not detected in the swimming larvae (not shown).

thumbnail

Figure 3. Expression of TGF-β in Amphimedon embryos.

(A) TGF-β expressing micromeres are distributed uniformly during cleavage. (B) At the blastula stage, TGF-β-positive cells are more prominent in the outer layer. (C, D) During gastrulation, TGF-β expression is restricted to the outer layer, with two stronger domains at the anterior and posterior poles. (E, F) As the pigment cells migrate to the posterior pole, TGF-β expression disappears from the posterior pole leaving the area just outside the pigment spot clearly devoid of TGF-β transcripts. A weak TGF-β expression domain persists in the very center of the spot. (F, G) The anterior pole expression remains strong at the spot and ring stages. (H) As the pigment cells begin their outward migration, TGF-β expression is strong inside of the forming ring and in the outer layer except of the pigment ring itself and area just outside of it. (I, J) In the later ring, TGF-β expression clears from the center of the ring, but persists in the inner rim of the ring. (J) The embryonic expression gradually fades at late ring stages, and expression in some cells of the follicle layer on the surface of the embryo becomes more apparent. Scale bar, 100 µm.

doi:10.1371/journal.pone.0001031.g003

Discussion Top

We have identified a Wnt and a TGF-β gene from the Amphimedon genome, extending the origin of these important gene families to before the divergence of sponge and eumetazoan lineages. While other studies on sponges have detected components of Wnt and TGF-β signalling pathways in sponges [37], [42][44], this is the first to show that these pathways are expressed during sponge embryogenesis. Significantly, we demonstrate that Wnt and TGF-β ligands are expressed during Amphimedon embryogenesis in complex and localized patterns.

The early expression of Wnt and TGF-β in Amphimedon embryos is compatible with a role in establishing axial polarity. The localization of Wnt-expressing cells to the future posterior pole is the earliest morphogenetic asymmetry detected in Amphimedon (Fig. 2C, D), occurring prior to the initial cell sorting event that creates the embryonic cell layers. We can not discern if the initial localized expression of Wnt is in the same cells that express Wnt later in development because of a lack of cell lineage data. Regardless, it is evident that Wnt-expressing cells are restricted early to the posterior pole and Wnt transcripts localize to this pole continuously through to the larval stage. The migration of pigment cells towards Wnt-expressing cells at the posterior pole is indicative of the existence of differential signals along the AP axis and is compatible with Wnt and/or TGF-β contributing to the establishment of this axis. Also migrating with the pigment cells along the outside of the embryo are sclerocytes-cells responsible for the synthesis of siliceous spicules [21], [23]. Upon reaching the posterior end of the larva, the sclerocytes appear to ingress into the inner cell mass [21]. The movements of pigment cells and sclerocytes are consistent with a role for these metazoan-specific ligands interacting to establish axial polarity in sponge embryos in a manner akin to that observed in other metazoans [1], [30], [45], [46]. For example, the vertebrate organizer is localized by interactions between Wnt and TGF-β signalling pathways [29][31], with TCF and SMAD, as respective effectors of these pathways, cooperating to regulate gene expression [31]. In both Amphimedon and the cnidarian Nematostella, Wnt expression is restricted to the posterior ends of the larva [3], [5], although mechanisms of gastrulation are different and there is limited evidence for these poles being homologous.

The intersecting expression of Wnt and TGF-β at the posterior end of the larva later in development also is compatible with these signalling pathways regulating the formation of the pigment ring [i.e. tissue morphogenesis, 22]. A zone of intersecting Wnt and TGF-β expression occurs anterior of the leading edge of the concentric front of migrating pigment cells (compare Fig. 2I and 3 H–J), and may be providing positional information [47] in manner similar to that observed during the formation of limbs in Drosophila [34] and the head organizer in cnidarians [48].

Our results suggest that sponge embryos are patterned by signalling mechanisms strikingly similar to those controlling cell specification and patterning in bilaterians and cnidarians. These signalling systems evolved and interacted early in metazoan evolution prior to the first cladogenic events that predate the Cambrian explosion (Fig. 4). Wnt and TGF-β signalling pathways appear to have acted combinatorially to specify and pattern cells in the last common ancestor to all extant metazoans (Fig. 4). In addition, a hedgehog-like cell surface signal–Hedgling–is expressed in overlapping patterns with Wnt and TGF-β during ring formation [25]. The developmental expression of these signalling systems, along with that of many metazoan-specific transcription factor families [23], indicates that the last common ancestor to all living metazoans already possessed the regulatory capacity to form complex body plans, using the same molecular components as animals living over 550 million years later [49]. The evolution of this canonical zootypic network may have been the necessary precursor for the diversification of all contemporary metazoan body plans. The differential expansion and elaboration of this network in the eumetazoan lineage, compared to the sponge lineage, provided the foundation for the extensive body plan diversification seen in this clade, including possibly the origin of a second body axis. Along with the diversification signalling pathways in eumetazoans was the origination of Hox genes [24] and expansion of a range of developmental transcription factor gene families [23], [28, unpublished], which enabled further elaboration of ancestral gene regulatory networks.

thumbnail

Figure 4. Evolution of Wnt and TGF-β gradients in early metazoans.

Metazoan tree of life showing relationships between sponges, cnidarians and bilaterians, and a closely-related sister taxon (choanoflagellates). Major evolutionary transitions in Wnt (blue) and TGF-β (red) gradients during embryonic development. Wnt and TGF-β genes arose early in metazoan evolution, after the choanoflagellate lineage diverged from the metazoan ancestor. These genes encoded ligands that originally formed gradients along one embryonic axis, as observed in modern sponges. The TGF-β gradient shifted to a perpendicular position in relation to the Wnt gradient in the lineage leading to the last common ancestor of contemporary eumetazoans, contribution to evolution of a second body axis.

doi:10.1371/journal.pone.0001031.g004

Materials and Methods Top

Isolation of Amphimedon Wnt and TGF-β cDNAs

Genomic traces and ESTs were generated as part a collaborative genome project with the Joint Genome Institute and are publicly available (http://www.ncbi.nlm.nih.gov/Traces). The 3′ end of Wnt and TGF−β genes were identified in EST and genome trace archives, respectively, based on similarity to vertebrate sequences. The 5′ part of these genes was cloned by means of 5′ RACE using BD Smart Kit (ClonTech) and gene specific primers (TGF−β: TCTAATCCGAGTAAGAGTATACACAGCTGC; Wnt: TCGCAAAGTTCTGCTGGCAG) and embryonic RNA as template. In case of TGF−β, the RACE primer encompassed the stop codon and several independent clones constituted the entire ORF. In case of Wnt, the complete coding sequence was confirmed by RT-PCR of embryonic RNA (using primers: CATTGACGTACAGCTACAAAG and CATGTTCTTGTGAATAGACTC).

Whole mount in situ hybridization

Whole mount in situ hybridizations were performed as described in [36] using complete coding sequences cloned into pGEMT vector (Promega) as templates for probe synthesis. Embryos were photographed whole mount and then subsequently processed for sections. Samples were dehydrated in ethanol and infiltrated with Epon 812 resin in a BioWave microwave oven (Pelco) before polymerisation overnight at 60C in a conventional oven. Sections were cut at 5 um on an Ultracut T ultramicrotome (Leica) and mounted in Histomount.

Phylogenetic analyses

Phylogenetic analyses of Wnt and TGF-β sequences were performed for the purpose of assigning orthology. Detailed description of the methods used is included in Supplement S1.

Supporting Information Top

Supplement S1.

(0.04 MB DOC)

Figure S1.

(0.13 MB DOC)

Figure S2.

(0.04 MB DOC)

Figure S3.

(0.03 MB DOC)

Figure S4.

(0.04 MB DOC)

Figure S5.

(0.04 MB DOC)

Acknowledgments Top

We gratefully acknowledge the significant contribution and support of The US Department of Energy Joint Genome Institute in the production of Amphimedon (Reniera) genomic and EST sequences used in this study through the Community Sequencing Program (http://www.jgi.doe.gov/sequencing/why/CS​P2005/reniera.html ).

Author Contributions Top

Conceived and designed the experiments: BD MA. Performed the experiments: MA CL KG. Analyzed the data: BD MA MA CL SD. Contributed reagents/materials/analysis tools: BD MA MA CL SD KG AC. Wrote the paper: BD MA CL SD.

References Top

  1. Martindale MQ (2005) The evolution of metazoan axial properties. Nat Rev Genet 6: 917–27. Find this article online
  2. Erwin DH, Davidson EH (2002) The last common bilaterian ancestor. Development 129: 3021–32. Find this article online
  3. Lee PN, Pang K, Matus DQ, Martindale MQ (2006) A WNT of things to come: evolution of Wnt signaling and polarity in cnidarians. Semin Cell Dev Biol 17: 157–67. Find this article online
  4. Miller DJ, Ball EE, Technau U (2005) Cnidarians and ancestral genetic complexity in the animal kingdom. Trends Genet 21: 536–9. Find this article online
  5. Kusserow A, Pang K, Sturm C, Hrouda M, Lentfer J, et al. (2005) Unexpected complexity of the Wnt gene family in a sea anemone. Nature 433: 156–60. Find this article online
  6. Hayward DC, Samuel G, Pontynen PC, Catmull J, Saint R, et al. (2002) Localized expression of a dpp/BMP2/4 ortholog in a coral embryo. Proc Natl Acad Sci U S A 99: 8106–11. Find this article online
  7. Matus DQ, Pang K, Marlow H, Dunn CW, Thomsen GH, et al. (2006) Molecular evidence for deep evolutionary roots of bilaterality in animal development. Proc Natl Acad Sci U S A 103: 11195–200. Find this article online
  8. Holland LZ, Holland NN, Schubert M (2000) Developmental expression of AmphiWnt1, an amphioxus gene in the Wnt1/wingless subfamily. Dev Genes Evol 210: 522–4. Find this article online
  9. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, et al. (1999) Requirement for Wnt3 in vertebrate axis formation. Nat Genet 22: 361–5. Find this article online
  10. Rentzsch F, Anton R, Saina M, Hammerschmidt M, Holstein TW, et al. (2006) Asymmetric expression of the BMP antagonists chordin and gremlin in the sea anemone Nematostella vectensis: implications for the evolution of axial patterning. Dev Biol 296: 375–87. Find this article online
  11. Li CW, Chen JY, Hua TE (1998) Precambrian sponges with cellular structures. Science 279: 879–82. Find this article online
  12. Botting JP, Butterfield NJ (2005) Reconstructing early sponge relationships by using the Burgess Shale fossil Eiffelia globosa, Walcott. Proc Natl Acad Sci U S A 102: 1554–9. Find this article online
  13. Cavalier-Smith T, Chao EE (2003) Phylogeny of choanozoa, apusozoa, and other protozoa and early eukaryote megaevolution. J Mol Evol 56: 540–63. Find this article online
  14. Medina M, Collins AG, Silberman JD, Sogin ML (2001) Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proc Natl Acad Sci U S A 98: 9707–12. Find this article online
  15. Peterson KJ, Butterfield NJ (2005) Origin of the Eumetazoa: testing ecological predictions of molecular clocks against the Proterozoic fossil record. Proc Natl Acad Sci U S A 102: 9547–52. Find this article online
  16. Borchiellini C, Manuel M, Alivon E, Boury-Esnault N, Vacelet J, et al. (2001) Sponge paraphyly and the origin of Metazoa. J Evol Biol 14: 171–9. Find this article online
  17. Manuel M, Borchiellini C, Alivon E, Le Parco Y, Vacelet J, et al. (2003) Phylogeny and evolution of calcareous sponges: monophyly of calcinea and calcaronea, high level of morphological homoplasy, and the primitive nature of axial symmetry. Syst Biol 52: 311–33. Find this article online
  18. Cavalier-Smith T, Allsopp MTEP, Chao EE, Boury-Esnault N, Vacelet J (1996) Sponge phylogeny, animal monophyly, and the origin of the nervous system: 18S rRNA evidence. Can J Zool 74: 2031–2045. Find this article online
  19. Halanych KM (2004) The new view of animal phylogeny. Ann Rev Ecol Evol Syst 35: 229–256. Find this article online
  20. Brusca RC, Brusca GJ (2003) The Invertebrates. Sunderland: Sinauer Associates.
  21. Leys SP, Degnan BM (2002) Embryogenesis and metamorphosis in a haplosclerid demosponge: Gastrulation and transdifferentiation of larval ciliated cells to choanocytes. Invertebr Biol 121: 171–189. Find this article online
  22. Degnan BM, Leys SP, Larroux C (2005) Sponge development and antiquity of animal pattern formation. Integr Comp Biol 45: 335–341. Find this article online
  23. Larroux C, Fahey B, Liubicich D, Hinman VF, Gauthier M, et al. (2006) Developmental expression of transcription factor genes in a demosponge: insights into the origin of metazoan multicellularity. Evol Dev 8: 150–73. Find this article online
  24. Larroux C, Fahey B, Degnan SM, Adamski M, Rokhsar DS, et al. (2007) The NK homeobox gene cluster predates the origin of Hox genes. Curr Biol 17: 706–710. Find this article online
  25. Adamska M, Matus DQ, Adamski M, Green K, Rokhsar DS, et al. (2007) The evolutionary origin of hedgehog proteins. Curr Biol in press. Find this article online
  26. Jackson DJ, Macis L, Reitner J, Degnan BM, Worheide G (2007) Sponge paleogenomics reveals an ancient role for carbonic anhydrase in skeletogenesis. Science 316: 1893–5. Find this article online
  27. Sakarya O, Armstrong KA, Adamska M, Adamski M, Wang IF, et al. (2007) A post-synaptic scaffold at the origin of the animal kingdom. PLoS ONE. 2: e506. Find this article online
  28. Simionato E, Ledent V, Richards G, Thomas-Chollier M, Kerner P, et al. (2007) Origin and diversification of the basic helix-loop-helix gene family in metazoans: insights from comparative genomics. BMC Evol Biol 7: 33. Find this article online
  29. De Robertis EM, Larrain J, Oelgeschlager M, Wessely O (2000) The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat Rev Genet 1: 171–81. Find this article online
  30. Green J (2002) Morphogen gradients, positional information, and Xenopus: interplay of theory and experiment. Dev Dyn 225: 392–408. Find this article online
  31. Nishita M, Hashimoto MK, Ogata S, Laurent MN, Ueno N, et al. (2000) Interaction between Wnt and TGF-β signaling pathways during formation of Spemann's organizer. Nature 403: 781–5. Find this article online
  32. Watabe T, Kim S, Candia A, Rothbacher U, Hashimoto C, et al. (1995) Molecular mechanisms of Spemann's organizer formation: conserved growth factor synergy between Xenopus and mouse. Genes Dev 9: 3038–50. Find this article online
  33. Zhou S, Eid K, Glowacki J (2004) Cooperation between TGF- β and Wnt pathways during chondrocyte and adipocyte differentiation of human marrow stromal cells. J Bone Miner Res 19: 463–70. Find this article online
  34. Cohen B, Simcox AA, Cohen SM (1993) Allocation of the thoracic imaginal primordia in the Drosophila embryo. Development 117: 597–608. Find this article online
  35. Maves L, Schubiger G (1998) A molecular basis for transdetermination in Drosophila imaginal discs: interactions between wingless and decapentaplegic signaling. Development 125: 115–24. Find this article online
  36. Soshnikova N, Zechner D, Huelsken J, Mishina Y, Behringer RR, et al. (2003) Genetic interaction between Wnt/beta-catenin and BMP receptor signaling during formation of the AER and the dorsal-ventral axis in the limb. Genes Dev17: 1963–8. Find this article online
  37. Nichols SA, Dirks W, Pearse JS, King N (2006) Early evolution of animal cell signaling and adhesion genes. Proc Natl Acad Sci USA 103: 12451–6. Find this article online
  38. Nusse R, Varmus HE (1992) Wnt genes. Cell 69: 1073–87. Find this article online
  39. The Wnt Homepage HTTP://WWW.STANFORD.EDU/~RNUSSE/WNTWINDO​W.HTML (2007)
  40. McPherron AC, Lee SJ (1993) GDF-3 and GDF-9: two new members of the transforming growth factor- β superfamily containing a novel pattern of cysteines. J Biol Chem 268: 3444–9. Find this article online
  41. Ozkaynak E, Schnegelsberg PN, Jin DF, Clifford GM, Warren FD, et al. (1992) Osteogenic protein-2. A new member of the transforming growth factor- β superfamily expressed early in embryogenesis. J Biol Chem 267: 25220–7. Find this article online
  42. Suga H, Ono K, Miyata T (1999) Multiple TGF- β receptor related genes in sponge and ancient gene duplications before the parazoan-eumetazoan split. FEBS Lett 453: 346–50. Find this article online
  43. Adell T, Nefkens I, Muller WE (2003) Polarity factor ‘Frizzled’ in the demosponge Suberites domuncula: identification, expression and localization of the receptor in the epithelium/pinacoderm. FEBS Lett 554: 363–8. Find this article online
  44. Adell T, Thakur AN, Muller WE (2007) Isolation and characterization of Wnt pathway-related genes from Porifera. Cell Biol Int 31: 939–49. Find this article online
  45. Reinhardt B, Broun M, Blitz IL, Bode HR (2004) HyBMP5-8b, a BMP5-8 orthologue, acts during axial patterning and tentacle formation in hydra. Dev Biol 267: 43–59. Find this article online
  46. Flowers VL, Courteau GR, Poustka AJ, Weng W, Venuti JM (2004) Nodal/activin signalling establishes oral-aboral polarity in the early sea urchin embryo. Dev Dyn 231: 727–40. Find this article online
  47. Wolpert L (1996) One hundred years of positional information. Trends Genet 12: 359–64. Find this article online
  48. Broun M, Gee L, Reinhardt B, Bode HR (2005) Formation of the head organizer in hydra involves the canonical Wnt pathway. Development 132: 2907–16. Find this article online
  49. Davidson EH (2006) The Regulatory Genome: Gene Regulatory Networks In Development And Evolution. Academic Press.
Add Your Note (For Private Viewing)Post Your Note (For Public Viewing)
Compose Your Note
 
Declare any competing interests.
Add a note to this text.
Please follow our guidelines for notes and comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  • Remarks that could be interpreted as allegations of misconduct
  • Unsupported assertions or statements
  • Inflammatory or insulting language
Add a note to this text.
You must be logged in to add a note to an article. You may log in by clicking here or cancel this note.
Add a note to this text.
You cannot annotate this area of the document. Close
Add a note to this text.
You cannot create an annotation that spans different sections of the document; please adjust your selection.
Close
Rate This Article
Please follow our guidelines for rating and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
  1. Remarks that could be interpreted as allegations of misconduct
  2. Unsupported assertions or statements
  3. Inflammatory or insulting language
Compose Your Annotation
 
Declare any competing interests.

All site content, except where otherwise noted, is licensed under a Creative Commons Attribution License.