Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

DNA Barcode Identification of Freshwater Snails in the Family Bithyniidae from Thailand

  • Jutharat Kulsantiwong,

    Affiliation Food-Borne Parasite Research Group, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

    ⨯
  • Sattrachai Prasopdee,

    Affiliation Food-Borne Parasite Research Group, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

    ⨯
  • Jiraporn Ruangsittichai,

    Affiliation Department of Medical Entomology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand

    ⨯
  • Wipaporn Ruangjirachuporn,

    Affiliation Food-Borne Parasite Research Group, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

    ⨯
  • Thidarut Boonmars,

    Affiliation Food-Borne Parasite Research Group, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

    ⨯
  • Vithoon Viyanant,

    Affiliation Center of Excellence for Research in Biomedical Sciences, and Thailand Center of Excellence on Drug Discovery and Development, Thammasat University, Klongluang, Pathumthani, Thailand

    ⨯
  • Paola Pierossi,

    Affiliation Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada

    ⨯
  • Paul D. N. Hebert,

    Affiliation Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada

    ⨯
  • Smarn Tesana

    smarn_te@kku.ac.th

    Affiliation Food-Borne Parasite Research Group, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

    ⨯

Abstract

Freshwater snails in the family Bithyniidae are the first intermediate host for Southeast Asian liver fluke (Opisthorchis viverrini), the causative agent of opisthorchiasis. Unfortunately, the subtle morphological characters that differentiate species in this group are not easily discerned by non-specialists. This is a serious matter because the identification of bithyniid species is a fundamental prerequisite for better understanding of the epidemiology of this disease. Because DNA barcoding, the analysis of sequence diversity in the 5’ region of the mitochondrial COI gene, has shown strong performance in other taxonomic groups, we decided to test its capacity to resolve 10 species/ subspecies of bithyniids from Thailand. Our analysis of 217 specimens indicated that COI sequences delivered species-level identification for 9 of 10 currently recognized species. The mean intraspecific divergence of COI was 2.3% (range 0-9.2 %), whereas sequence divergences between congeneric species averaged 8.7% (range 0-22.2 %). Although our results indicate that DNA barcoding can differentiate species of these medically-important snails, we also detected evidence for the presence of one overlooked species and one possible case of synonymy.

Citation: Kulsantiwong J, Prasopdee S, Ruangsittichai J, Ruangjirachuporn W, Boonmars T, Viyanant V, et al. (2013) DNA Barcode Identification of Freshwater Snails in the Family Bithyniidae from Thailand. PLoS ONE 8(11): e79144. https://doi.org/10.1371/journal.pone.0079144

Editor: Donald James Colgan, Australian Museum, Australia

Received: December 3, 2012; Accepted: September 19, 2013; Published: November 4, 2013

Copyright: © 2013 Kulsantiwong et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: The study was supported by the Higher Education Research Promotion and National Research University Project (NRU) of Thailand, and the Office of the Higher Education Commission, Ministry of Education of Thailand and through the Health Cluster (SHeP-GMS), Khon Kaen University, Thailand. Jutharat Kulsantiwong thanks the Office of the Higher Education Commission for supporting her PhD program (CHE) in the Department of Parasitology, Faculty of Medicine, Khon Kaen University, Thammasat University, and UdonThani Rajabhat University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Molecular taxonomic methods have been used extensively to complement morphological approaches for species identification, and for establishing phylogenetic relationships [1-10]. Particularly, species identification through DNA barcoding has seen rapid adoption over the past decade. Prior DNA barcode studies have clearly established their effectiveness in the delimitation of animal species, and also contributed several advantages [11-13]. The ability of DNA barcoding to identify all life stages has particular importance in medical parasitology, where it is not only important to identify the parasite and its final host, but also all its life stages and its intermediate hosts. Thus, a multidisciplinary method of classification that includes morphological, molecular and distributional data is an essential prerequisite for understanding the epidemiology of any parasite-induced disease [7].

Freshwater snails of the family Bithyniidae serve as intermediate hosts for the liver fluke, Opisthorchis viverrini, and related species common in the Greater Mekong subregion (Cambodia, Lao People’s Democratic Republic, Vietnam, and Thailand). The infection of this parasite has been associated with several hepatobiliary diseases, including opisthorchiasis, cholangitis, obstructive jaundice, hepatomegaly, cholecystitis, and biliary lithiasis [14-18]. Furthermore, both experimental and epidemiological evidence suggest that liver fluke infections can be an etiological factor of cholangiocarcinoma [19-25]. Three taxa of Bithynia are involved in the transmission of this parasite [26-28] with different species reported as intermediate hosts in different parts of Thailand. B. siamensis goniomphalos is a dominant host in the northeast, while B. funiculata and B. siamensis siamensis serve as hosts in the north and B. siamensis siamensis in the central region [26,29]. Taxonomic keys for differentiation to species in the family Bithyniidae utilized size, shape, color, and sculpture on the shell surface, operculum structure, and shape and arrangement patterns of radular teeth. Because these characters often demonstrate both geographic variation and phenotypic plasticity, morphological characters used to separate species are difficult to score and identifications require expert malacologists [30]. DNA barcoding has effectively identified snail species in other settings [31-34], therefore we decided to test its effectiveness on Bithyniidae.

The present study is the first to explore the application of DNA barcoding in species identification in the family Bithyniidae. We analyzed variation of the COI barcode region within 10 species/subspecies of Bithyniidae using pairwise sequence comparisons. We then examined the effectiveness of DNA barcoding in differentiating among these species.

Materials and Methods

Snail collections and preparation

Adult snails of the family Bithyniidae (superfamily Rissoacea) were collected with wire-mesh scoops or by hand in 2009 and 2010 from four regions of Thailand: north, northeast, south, and central (Figure 1, Table 1). These regions were selected based on results from previous studies [26,28,35]. Each collection site was recorded and its GPS coordinates were determined using a Garmin®nuvi 203 (Garmin (Asia) Co.,Taiwan). The specimens for this study were collected mostly from public water reservoirs where no permits were required. Owners of the private localities (a rice paddy and a waterfall) were asked for their permission. The owners gave their verbal consent for samples to be collected. All species of those snails are not endangered or protected. The snails were sorted and identified following the protocols in Brandt [26], Chitramvong [36], and Upatham et al. [37]. In addition two subspecies (B. s. siamensis and B. s. goniomphalos) were categorized by geographic distribution.

thumbnail
Download:
Figure 1. Schematic map of Thailand showing collection localities.

https://doi.org/10.1371/journal.pone.0079144.g001

SpeciesCollection DateCountryState/ProvinceRegion*LatitudeLongitude
Bithynia funiculata09-May-2009ThailandChiang MaiMae Rim118.6828002998.97660065
(Walker, 1927)09-May-2009ThailandChiang MaiMae Rim218.9176998198.97409821
09-May-2009ThailandChiang MaiSaraphi318.6888999998.9536972
09-May-2009ThailandChiang MaiMae Rim418.9113998498.96800232
Bithynia siamensis13-Oct-2010ThailandNong KhaiSangkhom518.09830093102.2419968
goniomphalos13-Oct-2010ThailandNong KhaiTha Bo617.78840065102.6009979
(Morelet, 1866)04-Jun-2010ThailandRoi EtMuang Roi Et715.90060043103.7320023
03-May-2008ThailandMaha SarakhamBarabue816.03829956103.1190033
11-May-2008ThailandKhon KaenChum Phae916.54809952102.0940018
04-Apr-2008ThailandKhon KaenUbolratana1016.75279999102.6330032
10-May-2008ThailandNong Bua LamphuNon Sang1116.86380005102.5680008
04-Apr-2008ThailandKhon KaenBan Phai1216.16609955102.6829987
04-Apr-2008ThailandKhon KaenWaeng Noi1315.80589962102.4110031
09-Dec-2008ThailandKhon KaenUbolratana1416.75300026102.6330032
04-Apr-2008ThailandKhon KaenBan Phai1516.16609955102.6829987
10-May-2010ThailandBuriramNong Ki1614.66600037102.5439987
12-May-2008ThailandKhon KaenMuang Khon Kaen1716.44829941102.8499985
Bithynia siamensis siamensis26-Feb-2011ThailandSongkhlaHat Yai187.013070107100.4520035
(Morelet, 1866)10-Oct-2009ThailandKhon KaenMuang Khon Kaen1916.44799995102.8499985
10-May-2009ThailandBangkokKasertsat University2013.85270023100.5699997
10-May-2009ThailandBangkokKasertsat University2113.8494997100.5680008
08-May-2009ThailandPhitsanulokBang Rakam2216.67480087100.1600037
08-May-2009ThailandPhichitBueng Na Rang2316.17670059100.1279984
09-May-2009ThailandChiang MaiMuang Chiang Mai2418.8052997698.95020294
09-May-2009ThailandChiang MaiMuang Chiang Mai2518.7917995598.94629669
10-May-2009ThailandSuphan BuriSi Pranchan2614.6697998100.1159973
10-Jun-2010ThailandLop BuriChai Badan2715.20429993101.137001
26-Feb-2011ThailandSongkhlaHat Yai287.013070107100.4520035
10-May-2009ThailandSing BuriMuang Sing Buri2914.8604002100.3939972
SpeciesCollection DateCountryState/ProvinceRegion*LatitudeLongitude
Bithynia siamensis siamensis10-Jun-2010ThailandLop BuriPatthana Nikhom3014.85579967100.9899979
(Morelet, 1866)
Filopaludina10-Aug-2010ThailandKhon KaenKhon Kaen16.46800041102.8310013
martensi martensiUniversity31
Gabbia erawanensis11-May-2009ThailandKanchanaburiErawan3214.3678998999.14369965
(Prayoonhong, Chitramvong&17-May-2009ThailandKanchanaburiErawan3314.3680000399.14399719
Upatham 1990)11-May-2009ThailandKanchanaburiErawan3414.368900399.145401
Gabbia pygmaea09-May-2009ThailandChiang MaiMae Rim3518.9113998498.96800232
(Preston, 1908)
Gabbia wykoffi09-May-2009ThailandChiang MaiSaraphi3618.6856002899.04979706
(Brandt 1968)04-Apr-2010ThailandLoeiChiang Khan3717.90600014101.6880035
04-Apr-2010ThailandLoeiChiang Khan3817.89599991101.6699982
04-Apr-2010ThailandLoeiChiang Khan3917.89489937101.6709976
12-Oct-2009ThailandSaraburiMuang Saraburi4014.53129959100.9260025
10-May-2009ThailandSuphan BuriMuang Sing Buri4114.85379982100.3779984
09-May-2009ThailandChiang MaiSaraphi4218.6856002899.04979706
09-May-2009ThailandChiang MaiHang Dong4318.6888999998.9536972
09-May-2009ThailandChiang MaiHang Dong4418.6828002998.97660065
09-May-2009ThailandBangkokKasertsat University4513.8494997100.5680008
20-Oct-2009ThailandKhon KaenUbolratana4616.75279999102.6330032
20-Oct-2009ThailandKhon KaenMuang Khon Kaen4716.45019913103.0270004
10-Aug-2009ThailandChaiyaphumChatturat4815.56820011101.8430023
10-May-2009ThailandBangkokKasertsat University4913.8494997100.5680008
11-May-2009ThailandKanchanaburiErawan5014.3678998999.14369965
20-Oct-2009ThailandKhon KaenMuang Khon Kaen5116.45019913103.0270004
10-May-2010ThailandLoeiChiang Khan5217.90600014101.6880035
10-May-2010ThailandLoeiChiang Khan5317.8946991101.6699982
11-May-2008ThailandKhon KaenUbolratana5416.75279999102.6330032
SpeciesCollection DateCountryState/ProvinceRegion*LatitudeLongitude
Hydrobioides nassa18-Jan-2009ThailandSing BuriMuang Sing Buri5514.86400032100.3960037
(Theobald, 1865)09-May-2009ThailandLamphunMuang Lamphun5618.6298999899.04989624
08-May-2009ThailandPhichitBueng Na Rang5716.17670059100.1279984
09-May-2009ThailandChiang MaiSan Kamphaeng5818.9113998498.96800232
10-May-2009ThailandSing BuriKhai Bang Rachan5914.80000019100.3089981
10-May-2009ThailandSing BuriMuang Sing Buri6014.91609955100.3850021
09-May-2009ThailandChiang MaiSan Kamphaeng6118.7602996899.07859802
Wattebledia baschi10-Oct-2010ThailandSurat ThaniPhunphin629.1140003299.23000336
(Brandt 1968)10-Oct-2009ThailandSurat ThaniPhunphin639.11378002299.229599
Wattebledia crosseana04-Apr-2010ThailandLoeiChiang Khan6417.89599991101.6699982
(Wattebled 1886)04-Apr-2010ThailandLoeiChiang Khan6517.89100075101.6439972
04-Apr-2010ThailandLoeiPak Chom6618.02479935101.9000015
10-May-2010ThailandLoeiChiang Khan6718.08709908101.9520035
25-Dec-2008ThailandLoeiChiang Khan6818.08699989101.9520035
11-May-2008ThailandKhon KaenUbolratana6916.75279999102.6330032
11-May-2008ThailandNong Bua LamphuMuang Nong Bua Lum17.24449921102.5169983
Phu70
12-Feb-2009LaosVientianePakse7115.12049961105.8130035
04-Apr-2010ThailandLoeiChiang Khan7217.89599991101.6699982
25-Dec-2008ThailandKhon KaenUbolratana7316.75279999102.6330032
10-May-2010ThailandNong KhaiTha Bo7417.78800011102.6009979
Wattebledia siamensis20-Jan-2008ThailandKhon KaenMuang Khon16.4484005102.8499985
(Moellendorff, 1902)Kaen75
20-Jan-2008ThailandKhon KaenUbolratana7616.75279999102.6330032
20-Jan-2008ThailandKhon KaenMuang Khon16.45319939102.4530029
Kaen77

Table 1. Collection sites for each species from Thailand.

*represent the collection sites in the map
CSV
Download CSV

Each snail was subsequently examined for trematode infections by testing for cercarial shedding twice within a week. Prior to cercarial shedding, the snails were cleaned with dechlorinated tap-water. Shedding was induced under 25 W electric light bulbs for 2 hours at room temperature during the day. For species that shed cercaria at night, black covers were used to achieve total darkness and snails were allowed to shed overnight. Uninfected snails were soaked in phosphate buffered saline (PBS) containing antibiotics (200 unit/ml of penicillin and 100 µg/ml of streptomycin) for 3 to 4 hours before extraction of DNA to ensure that bacterial contamination was minimized.

Each snail was dissected to remove its soft body parts, and kept at -20 °C until further analysis. Each specimen was labeled, databased and imaged. All specimen records are in the project ‘JUT- Mitochondrial DNA barcodes identification for snail in family Bithyniidae in Thailand’ on BOLD, the Barcode of Life Data Systems [38].

DNA extraction

Total genomic DNA was extracted from whole snail tissue using methods similar to those in Winnepenninckx et al. [39]. Snail tissue was first homogenized in lysis buffer (2% w/v Cetyltri-ammonium bromide; CTAB, 1.4 M NaCl, 0.2% v/v β-mercaptoethanol, 20 mM EDTA, 100 mM TrisHCl pH 8, 0.2 mg/ml proteinase K), and then incubated at 55 °C for 6 hours. Subsequently, proteins were precipitated using phenol/chloroform (1:1) once, followed by phenol/ chloroform/ isoamylalcohol (25:24:1), centrifuged at 13,000 g for 10 min (4 °C) twice, and finally washed with chloroform (1:1). The upper aqueous layer was removed, and DNA was precipitated in isopropanol (2:3 v/v), mixed gently by inverting the tube a few times, put on ice for 15 min, and then spun in a microcentrifuge at 13,000 g for 5 min. After centrifugation, the supernatant was discarded; the DNA pellets were washed in 75% absolute ethanol, and centrifuged at 13,000 g for 5 min. After air-drying, the DNA pellet was re-suspended in TE buffer (10 mM Tris, 1mM EDTA, pH 8.0) and stored at -20 °C until analysis. The DNA concentration and purity were estimated by spectrophotometer (NanoVue, GE Healthcare UK limited, Buckinghamshire, UK) at an absorbance of 260 and 280 nm wavelengths. The extracted genomic DNA was then diluted to a working concentration of 10 ng/µl.

Amplification and sequencing

PCR protocols followed those used by the Canadian Centre for DNA Barcoding [40], with slight modifications. The PCR reaction was performed on a GeneAmp® PCR System 9700 Thermo Cycler (Applied Biosystem, Foster City, CA). The partial mitochondrial COI gene was amplified using the primers shown in Table 2 [41,42] in a total reaction volume of 50 µl. The amplification reaction consisted of 10xPCR buffer for 5 µl, 10 mM dNTP for 0.25 µl, 50 mM MgCl2 for 2.5 µl, forward primer for 0.5 µl, reverse primer for 0.5 µl, Platinum Taq polymerase for 0.24 µl, H2O for 36.01 µl and template for 5 µl. Standard conditions for COI gene amplification included initial denaturation at 94 °C for 1 min, five cycles of 94 °C for 30 sec, annealing at 45-50 °C for 40 sec, and extension at 72 °C for 1 min, following by 30 to 35 cycles of 94 °C for 30 sec, 51 to 54 °C for 40 sec, and 72 °C for 1 min, with a final extension at 72 °C for 10 min, followed by an indefinite hold at 4 °C [43-45]. PCR products were visualized on a 1.5% agarose gel and the specific band was cut and its DNA purified and then sequenced in the Biochemistry Department, Faculty of Medicine, Khon Kaen University; Pacific Science Co. LTD (Bangkok, Thailand) and at the Biodiversity Institute of Ontario, Canada.

Primer nameSequenceForward or Reverse
LCO14905′ GGTCAACAAATCATAAAGATATTGG 3′Forward
HCO21985′ TAAACTTCAGGGTGACCAAAAAATCA 3′Reverse
GasF1_t15′ TGTAAAACGACGGCCAGTTTTCAACAAACCATAARGATATTGG 3′Forward
GasF2_t15′ TGTAAAACGACGGCCAGTATTCTACAAACCACAAAGACATCGG 3′Forward
GasF3_t15′ TGTAAAACGACGGCCAGTTTTCWACWAATCATAAAGATATTGG 3′Forward
GasR1_t15′ CAGGAAACAGCTATGACACTTCWGGRTGHCCRAARAATCARAA 3′Reverse
MGasF1_t15′ TGTAAAACGACGGCCAGTATAAGATTTCCTCGWWTRAATAATA 3′Forward
MGasR1_t15′ CAGGAAACAGCTATGACTCCTGTWCCWRCWCCWCCTTC 3′Reverse

Table 2. Primers used for PCR amplification and sequencing [41,42].

Remark Degenerate base; R = A or G, W = A or T, H = C or A or T
CSV
Download CSV

Data analysis

Forward and reverse DNA sequences were assembled, and edited using Chromas version 2.23 [46], BioEdit v. 5.0.6 [47] and CodonCode v.3.01 (CodonCode Corporation, Dedham, MA). Alignment and homology analysis were performed using CLUSTAL X v. 1.8 [48] and MEGA 4 [49] with pairwise nucleotide sequence divergences calculated using the Kimura 2-parameter (K2P) model [50]. Base composition and distance summaries were obtained using the tools provided on the BOLD workbench (www.boldsystems.org) [38], but only sequences ≥ 350 bp were included in the analysis. A neighbour-joining (NJ) tree was also created using BOLD to provide a preliminary display of the sequence divergences.

Results and Discussion

Ten species/subspecies of Bithyniidae were collected from sites across Thailand (Figure 1 and Figure 2). A total of 217 individuals of these species/subspecies were analyzed for COI, and Neotricula aperta gamma strain (family Hydrobiidae, superfamily Rissoacea) from GenBank (Accession: AF AF188222.1 GI: 11493624 and AF188220.1 GI: 11493620) was used as outgroup. All 217 specimens were identified using morphological characteristics of the adult shells, radular patterns, geographic distribution [35-37], and confirmed by a malacologist. From 1-6 individuals of each species/subspecies from each of the five regions were analyzed, as shown in the neighbour-joining tree (Figure S1). The sequences, and trace files, are available on BOLD (project: JUT).

thumbnail
Download:
Figure 2. The shell morphology of bithyniid snails (A) B. funiculata; (B) B. siamensis goniomphalos; (C) B. siamensis siamensis; (D) H. nassa ; (E) W. crosseana; (F) W. siamensis; (G) W. baschi; (H) G. wykoffi; (I) G. pygmaea; (J) G. erawanensis.

Scale bars: A-J = 1 mm.

https://doi.org/10.1371/journal.pone.0079144.g002

The pairwise sequence divergences were different among species/subspecies (Table S1). Intraspecific K2P distances averaged 2.3±0.001% (range 0-9.2 %), 4-fold less than the mean congeneric sequence divergence of 8.7±0.002% (range 0-22.2 %). The highest mean intraspecific sequence divergence for an individual species was 4.93±0.22% (range 0-9.2%) for Wattebledia crosseana reflecting the fact that members of this species fell into two distinct sequence clusters (Table 3). The mean sequence divergence across the family was also high, averaging 17.1% (range 13.0-21.3%).The distributions of intraspecific and interspecific divergences showed limited overlap (Figure 3), because most (65.4%) intraspecific sequences showed less than 2% divergence while 83.4% of the interspecific sequences possessed more than 3% divergence. As a result, sequence divergences for these snails are similar to those in previous barcoding reports on other organisms [2,12]. Hebert et al. [12] reported that COI sequence divergences among animal species from interspecific COI divergences within the phylum Mollusca averaged 11.1±5.1%.

SpeciesNearest Neighbor (NN)IntraspecificIntraspecific
(Number of specimens)
Nearest NeighborDistance toCountMeanSEMaxMinCountMeanSEMaxMin
NN%ComparisonsComparisons
Bithynia funiculata (13)B. siamensis siamensis7.11781.080.102.170
B. siamensis goniomphalos (30)B. siamensis siamensis1.494352.390.043.950
B. siamensis siamensis (40)B. siamensis goniomphalos1.497800.620.501.81021102.270.1310.770
Wattebledia crosseana (26)W. baschi6.003304.930.229.110
W. siamensis (8)W. baschi11.39280.320.440.820
W. baschi (7)W. crosseana6.00280.050.350.3504466.020.3214.196.33
Gabbia wykoffi (59)G. pygmaea017613.140.056.690
G. pygmaea (3)G. wykoffi030.000.000.000
G. erawanensis (8)B. siamensis goniomphalos15.73280.300.070.8206736.620.2922.160
Hydrobioides nassa (23)W. crosseana14.132530.470.032.20000000
Total (217)63.34372413.301.8127.910322914.910.7447.120

Table 3. Species with nearest neighbour and intraspecific and interspecific divergence.

CSV
Download CSV
thumbnail
Download:
Figure 3. Pairwise distances (K2P) for COI sequences from snail species in the family Bithyniidae separated into two categories: (a) intraspecific; (b) interspecific.

https://doi.org/10.1371/journal.pone.0079144.g003

The high intraspecific divergences in W. crosseana and G. wykoffi could indicate the presence of previously unrecognized cryptic species. DNA barcoding has proven invaluable at detecting cryptic species, which in many cases, are subsequently corroborated by life history, morphological or other character sets [51-54]. For these two snail species, the clusters represent allopatric populations with no apparent morphological differences, so it is currently unclear if they represent merely isolated populations or separate entities with differences yet to be revealed. Conversely, the sharing of identical barcode sequence in G. pygmaea and one northern Thailand population of G. wykoffi may be indicative of introgressive hybridization, incomplete lineage sorting, misidentification, or a previously unrecognized synonymy. Further investigations into these groups are necessary to untangle and confirm these predictions and the use of more holistic approaches to delimit species boundaries will be beneficial.

An important finding in the present study is that the three first intermediate hosts (B. s. siamensis, B. s. goniomphalos and B. funiculata) of Southeast Asian liver fluke can all be distinguished by COI barcodes. All three taxa of Bithynia sp. form monophyletic clusters, with 1.5% divergence between the two subspecies of B. siamensis and both subspecies had 7.1% divergence from B. funiculata (Table 3). Because the two subspecies of B. siamensis are morphologically indistinguishable, the capacity of DNA barcoding to discriminate them is significant. Moreover, morphological similarity has created taxonomic confusion and difficulties in the accurate identification of B. s. siamensis and B. s. goniomphalos which are currently believed to be distributed in the north, central, south and northeast of Thailand [26,29,36-38]. As well, the capacity to rapidly diagnose all stages of the host’s life cycle is essential for better understanding of the epidemiology of this parasite-induced disease.

The barcoding success for the Bithyniid species examined in this project was 80%, with nearly all taxa forming discrete monophyletic clusters (Figure 4). The two exceptions are G. pygmaea and one population of G. wykoffi, which share an identical COI sequence (see above). These two taxa might possibly be cryptic species. However, the adult size of G. wykoffi is double that of G. pygmaea. Distinct paraphyly was found in W. crosseana. The results indicated that W. crosseana samples from different localities may well represent cryptic species because they are morphologically similar but genetically distinct. Cryptic species of W. crosseana might be resulted from some factors such as different localities which would develop to different genotype. G. wykoffi was separated into more than one geographically-restricted cluster respectively comprising collection localities from the central, north or northeast regions of Thailand. These clusters might be cryptic species according to this analysis as same as W. crosseana. However, more comprehensive analyses of the systematics of these taxa using more specimens, representing their known geographic distribution, as well as more evidence from independent biological investigations, are required before this hypothesis can be verified.

thumbnail
Download:
Figure 4. Neighbour- joining tree (K2P) for 10 species/subspecies of snails in the family Bithyniidae.

The number of individuals for each branch is given in parentheses. A detailed version of this tree, including locality information, is provided in Figure S1.

https://doi.org/10.1371/journal.pone.0079144.g004

Similar studies which have also been reported in other organisms [52-59], yet over all DNA barcoding has proven reliable in identifying species in more than 90% of the organisms investigated [60]. The neighbour-joining tree and ME analysis also revealed that in general, individuals tended to cluster in accordance with collection localities (Supporting Information, Figure S1, S2). The results from ME analysis were very similar to the neighbor-joining analysis so the latter was used to generate diagrams.

The genera Wattebledia and Bithynia formed monophyletic clusters as well, but Gabbia did not. The selection of Neotricula aperta gamma strain (in the same superfamily) from GenBank as the outgroup appeared legitimate as it clustered separately from other snails in family Bithyniidae. Increased taxon, geographic, and gene sampling would be worthwhile to further explore the two ‘barcode outliers’ and the ability of COI to infer geographic provenance and phylogenetic affinities in this group.

In summary, the present study has studied genetic-variation in ten species/subspecies of Bithyniidae from Thailand using COI. Sequence divergences were lower for intraspecific than congeneric comparison. Using COI, 80% of the studied snail taxa could accurately identified. In comparison with other methods for identifying snails in this family, DNA barcoding is quicker, easier and more applicable, it is suitable for young snail identification which will be beneficial for understanding the epidemiology of opisthorchiasis transmission.

Supporting Information

Table S1.

Genetic distances for all specimens in family Bithyniidae.

https://doi.org/10.1371/journal.pone.0079144.s001

(XLS)

Figure S1.

Neighbour-joining tree (Distance model: Kimura-2-Parameter) of profile and test taxa; includes a list of BOLD with Process ID, taxa names, length of sequence and locality.

https://doi.org/10.1371/journal.pone.0079144.s002

(JPG)

Figure S2.

Minimum Evolution tree (ME) of 218 COI sequences of 10 species/subspecies of snails in the family Bithyniidae. The number of individuals for each branch is given in parentheses.

https://doi.org/10.1371/journal.pone.0079144.s003

(TIF)

Acknowledgments

We thank the staffs of the Biodiversity Institute of Ontario, University of Guelph, Ontario, Canada, especially Mr. Sean Prosser for providing technical advice. Dr. Jeff Webb aided with data analysis, while Dr. Jeremy R. deWaard provided valuable comments on the manuscript. We also thank Assistant Professor Dr. Pairat Tarbsripair, the Malacologist who confirmed our identification species of the specimens. Fieldwork that provided the basis for this work would not have been completed without the gracious support from Dr. Pairat Tarbsripair, Dr. Supawadee Piratae, Dr. Panita Khampoosa, Chalermlap Donthaisong, Patpicha Arunsan, Dr. Apiporn Suwannatrai, and Kulwadee Suwannatrai.

Author Contributions

Conceived and designed the experiments: JK ST WR TB VV JR. Performed the experiments: JK. Analyzed the data: JK SP JR TB PP. Contributed reagents/materials/analysis tools: JK SP PP PDNH. Wrote the manuscript: JK ST VV PP PDNH. Collected specimens: SP. Commentation: WR TB.

References

  1. 1. Thomas W, Davis GM, Chen CE, Zhou XN, Zeng PX et al. (2000) Oncomelania hupensis (Gastropoda: Rissooidea) in eastern China: molecular phylogeny, population structure, and ecology. Acta Trop 77: 215-227. doi:https://doi.org/10.1016/S0001-706X(00)00143-1. PubMed: 11080513.
  2. 2. Carvalho OS, Caldeira RL, Simpson AJG, THDA Vidigal (2001) Genetic variability and molecular identification of Brazilian Biomphalaria species (Mollusca: Planorbidae). Parasitology 123: S197-S209. PubMed: 11769284.
  3. 3. Jones CS, Rollinson D, Mimpfoundi R, Ouma J, Kariuki HC et al. (2001) Molecular evolution of freshwater snail intermediate hosts within the Bulinus forskalii group. Parasitology 7: 277-292. PubMed: 11769290.
  4. 4. Davis GM, Wilke T, Spolsky CM, Qiu CP, Qiu DC et al. (1998) Cytochrome oxidase I-based phylogenetic relationships among the Pomatiopsidae, Hydrobiidae, Rissoidae and Truncatellidae (Gastropoda: Caenogastropoda: Rissoacea). Malacologia 40: 251-266.
  5. 5. Delicado D, Ramos MA (2012) Morphological and molecular evidence for cryptic species of springsnails [genus Pseudamnicola ( Corrosella) (Mollusca, Caenogastropoda, Hydrobiidae)]. Zookeys 190: 55-79. PubMed: 22639531.
  6. 6. Kodcharin P (2006) Genetic variation of Bithynia siamensis goniomphalos, first intermediate host of Opisthorchis viverrini in the basin of Mun and Chi River, Thailand by RAPD. M.Sc. Thesis: The Graduate School, Khon Kaen University, Khon Kaen, Thailand..
    • 7. Duangprompo W (2007) Genetic variation of snails in the family Bithyniidae in Thailand and identification of Bithynia siamensis goniomphalos by PCR. M.Sc. Thesis: The Graduate School, Khon Kaen University, Khon Kaen, Thailand..
      • 8. Jorgensen A, Kristensen TK, Stothard JR (2007) Phylogeny and biogeography of African Biomphalaria (Gastropoda: Planorbidae), with emphasis on endemic species of the Great East African lakes. Zool J Linn Soc 151: 337-349. doi:https://doi.org/10.1111/j.1096-3642.2007.00330.x.
      • 9. Caldeira RL, Jannotti-Passos LK, Carvalho OS (2009) Molecular epidemiology of Brazilian Biomphalaria: A review of the identification of species and the detection of infected snails. Acta_Trop 111: 1-6. PubMed: 19426656.
      • 10. Kiatsopit N, Sithithaworn P, Boonmars T, Tesana S, Chanawong A et al. (2011) Genetic markers for studies on the systematics and population genetics of snails, Bithynia spp., the first intermediate hosts of Opisthorchis viverrini in Thailand. Acta Trop 118: 136-141. doi:https://doi.org/10.1016/j.actatropica.2011.02.002. PubMed: 21352793.
      • 11. Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA barcodes. Proc R Soc Lond B 270: 313-321. doi:https://doi.org/10.1098/rspb.2002.2218.
      • 12. Hebert PDN, Ratnasingham S, deWaard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B 270: 96-99. doi:https://doi.org/10.1098/rsbl.2003.0025. PubMed: 12952648.
      • 13. Ferri E, Barbuto M, Bain O, Galimberti A, Uni S et al. (2009) Integrated taxonomy: traditional approach and DNA barcoding for the identification of filarioid worms and related parasites (Nematoda). Front Zool 6: 1-12. doi:https://doi.org/10.1186/1742-9994-6-1. PubMed: 19128479.
      • 14. Harinasuta T, Riganti M, Bunnag D (1984) Opisthorchis viverrini infection: pathogenesis and clinical features. Arzneimittel Forschung 34: 1167-1169. PubMed: 6542384.
      • 15. Osman M, Lausten SB, El-Sefi T, Boghdadi I, Rashed MY et al. (1998) Biliary parasites. Dig Surg 15: 287-296. doi:https://doi.org/10.1159/000018640. PubMed: 9845601.
      • 16. Mairiang E, Mairiang P (2003) Clinical manifestation of opisthorchiasis and treatment. Acta Trop 88: 221-227. doi:https://doi.org/10.1016/j.actatropica.2003.03.001. PubMed: 14611876.
      • 17. Sripa B, Leungwattanawanit S, Nitta T, Wongkham C, Bhudhisawasdi V et al. (2005) Establishment and characterization of an opisthorchiasis-associated cholangiocarcinoma cell line (KKU-100). World J Gastroenterol 11: 3392-3397. PubMed: 15948244.
      • 18. Sripa B, Kaewkes S, Sithithaworn P, Mairiang E, Laha T et al. (2007) Liver fluke induces cholangiocarcinoma. PLOS Med 7: 1148-1155. PubMed: 17622191.
      • 19. Thamavit W, Bhamarapravati N, Sahaphong S, Vajrasthira S, Angsubhakom S (1978) Effects of dimethylnitrosamine on induction of cholangiocarcinoma in Opisthorchis viverrini infected Syrian golden hamsters. Cancer Res 38: 4634-4639. PubMed: 214229.
      • 20. Haswell-Elkins MR, Sithithaworn P, Elkins D (1992) Opisthorchis viverrini and cholangiocarcinoma in Northeast Thailand. Parasitol Today 8: 86-89. doi:https://doi.org/10.1016/0169-4758(92)90241-S. PubMed: 15463578.
      • 21. IARC (1994) Infection with liver flukes (Opisthorchis viverrini, Opisthorchis felineus and Clonorchis sinensis). IARC Monogr Eval Carcinog Risks Hum 61: 121-175. PubMed: 7715069.
      • 22. Sithithaworn P, Haswell-Elkins MR, Mairiang P, Satarug S, Mairiang E et al. (1994) Parasite-associated morbidity: liver fluke infection and bile duct cancer in northeast Thailand. Int J Parasitol 24: 833-843. doi:https://doi.org/10.1016/0020-7519(94)90009-4. PubMed: 7982745.
      • 23. Vatanasapt V, Parkin DM, Sriamporn S (2000) Epidemiology of liver cancer in Thailand. In: V. VatanasaptB. Sripa. Liver cancer in Thailand: Epidemiology, diagnosis and control. Khon Kaen, Thailand: Siriphan Press. pp. 3-6.
        • 24. Watanapa P, Watanapa WB (2002) Liver fluke-associated cholangiocarcinoma. Br J Surg 89: 962-970. doi:https://doi.org/10.1046/j.1365-2168.2002.02143.x. PubMed: 12153620.
        • 25. Honjo S, Srivatanakul P, Sriplung H, Kikukawa H, Hanai S et al. (2005) Genetic and environmental determinants of risk for cholangiocarcinoma via Opisthorchis viverrini in a densely infested area in Nakhon Phanom, northeast Thailand. Int J Cancer 117: 854-860. doi:https://doi.org/10.1002/ijc.21146. PubMed: 15957169.
        • 26. Brandt RAM (1974) The non-marine aquatic Mollusca of Thailand. Archiv Mollusken 105: 1-423.
        • 27. TROPMED Technical Group (1986) Snails of medical importance in Southeast Asia. Southeast Asian J Trop Med Public Health 17: 282-322. PubMed: 3787310.
        • 28. Sri-Aroon P, Butraporn P, Limsomboon J, Kerdpuech Y, Kaewpoolsri M et al. (2005) Freshwater mollusks of medical importance in Kalasin Province, Northeast Thailand. Southeast Asian J Trop Med Public Health 36: 653-657. PubMed: 16124433.
        • 29. Wykoff DE, Harinasuta C, Juttijudata P, Winn MM (1965) Opisthorchis viverrini in Thailand- the life cycle and comparison with O. felineus. J Parasitol 51: 207-214. doi:https://doi.org/10.2307/3276083. PubMed: 14275209.
        • 30. Rollinson D, Stothard JR, Jones CS, Lockyer AE, de Souza CP et al. (1998) Molecular characterization of intermediate snail hosts and the search for resistance genes. Mem Inst Oswaldo Cruz 93: 111-116. doi:https://doi.org/10.1590/S0074-02761998000100020.
        • 31. Miller KB, Alarie Y, Wolfe GW, Whiting MF (2005) Association of insect life stages using DNA sequences: the larvae of Philodyte sumbrinus (Motschulsky) (Coleoptera: Dytiscidae). Syst Entomol 30: 499-509. doi:https://doi.org/10.1111/j.1365-3113.2005.00320.x.
        • 32. Rojo S, Stahls G, Perez-Banon C (2006) Testing molecular barcodes: invariant mitochondrial DNA sequences vs. the larval and adult morphology of West Palaearctic Pandasyopthalmus species (Diptera: Syrphidae: Paragini). Eur J Entomol 103: 443-458.
        • 33. Puillandre N, Strong EE, Bouchet P, Boisselier MC, Couloux A et al. (2009) Identifying gastropod spawn from DNA barcodes: possible but not yet practicable. Mol Ecol Resour 9: 1311-1321. doi:https://doi.org/10.1111/j.1755-0998.2009.02576.x. PubMed: 21564902.
        • 34. Shufran KA, Puterka GJ (2011) DNA barcoding to identify all life stages of holocycliccereal aphids (Hemiptera: Aphididae) on wheat and other Poaceae. Ann Entomol Soc Am 104: 39-42. doi:https://doi.org/10.1603/AN10129.
        • 35. Chitramvong YP, Upatham ES (1989) A new species of freshwater snail for Thailand (Prosobranchia: Bithyniidae). Walkerana 3: 179-186.
        • 36. Chitramvong YP (1991) The Bithyniidae (Gastropoda: Prosobanchia) of Thailand: comparative internal anatomy. Walkerana 5: 161-206.
        • 37. Chitramvong YP (1992) The Bithyniidae (Gastropoda: Prosobranchia) of Thailand: comparative external morphology. Malacol Rev 25: 21-38.
        • 38. Sri-Aroon P, Butraporn P, Limsoomboon J, Kaewpoolsri M, Chusongsang Y et al. (2007) Freshwater mollusks at designated areas in eleven provinces of Thailand according to the water resource development projects. Southeast Asian J Trop Med Public Health 38: 294-301. PubMed: 17539279.
        • 39. Upatham ES, Sornmani S, Kitikoon V, Lohachit C, Burch JB (1983) Identification key for the fresh-and brackish-water snails of Thailand. Malacol Rev 16: 107-132.
        • 40. Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life Data System. Retrieved onpublished at whilst December year 1111 from . www.barcodinglife.org. Mol Ecol Notes 7: 355-364.
          • 41. Winnepenninckx B, Backeljau T, De Wachter R (1993) Extraction of high molecular weight DNA from mollusks. Trends Genet 9: 407. doi:https://doi.org/10.1016/0168-9525(93)90102-N. PubMed: 8122306.
          • 42. Canadian Centre for DNA Barcoding (CCDB) (2008) Advancing species identification and discovery. Available: http://www.ccdb.ca/. Accessed 12 October 2008.
            • 43. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3: 294-299. PubMed: 7881515.
            • 44. Ivanova NV, Zemlak TS, Hanner RH, Hebert PDN (2007) Universal primer cocktails for fish DNA barcoding. Mol Ecol Notes 7: 544–548. doi:https://doi.org/10.1111/j.1471-8286.2007.01748.x.
            • 45. Ivanova NV, deWaard JR, Hajibabaei M, Hebert PDN (2005) Protocols for high volume DNA barcoding. Available: http://www.dnabarcoding.ca/. Accessed 5 November 2008.
              • 46. Ivanova N, Grainger C (2006) Pre-made frozen PCR and sequencing plates. CCDB Advances, Methods Release No. 4. Available: . http://www.ccdb.ca/pa/ge/research/protocols/ccdb-advances. Accessed 30 Nov 2008.
                • 47. Ivanova N, Grainger C, Hajibabaei M (2006) Increased DNA barcode recovery using Platinum ®Taq. CCDB Advances, Methods Release. Retrieved onpublished at whilst December year 1111 from . No.2Available:http//www.ccdb.ca. Retrieved on. published at whilst December year 1111 from /pa/ge/research/protocols/ccdb-advances. Accessed 30 Nov 2008.
                  • 48. McCarthy C (2008) Chromas. Available: http://technelysium.com.au/. Accessed 3 November 2009.
                    • 49. Hall T (2008) BioEdit Sequence Alignment Editor for Windows 95/98/NT/XP. Available: . http://www.mbio.ncsu.edu/bioedit/bioedit.html. Accessed 3 Oct 2009.
                      • 50. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948. doi:https://doi.org/10.1093/bioinformatics/btm404. PubMed: 17846036.
                      • 51. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599. Available: http://www.megasoftware.net/. Accessed 3 November 2009. doi:https://doi.org/10.1093/molbev/msm092. PubMed: 17488738.
                        • 52. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111-120. doi:https://doi.org/10.1007/BF01731581. PubMed: 7463489.
                        • 53. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci U S A 101: 14812-14817. doi:https://doi.org/10.1073/pnas.0406166101. PubMed: 15465915.
                        • 54. Smith MA, Rodriguez JJ, Whitfield JB, Deans AR, Janzen DH et al. (2008) Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proc Natl Acad Sci U S A 105: 12359-12364. doi:https://doi.org/10.1073/pnas.0805319105. PubMed: 18716001.
                        • 55. Gibbs J (2009) Integrative taxonomy identifies new (and old) species in the Lasioglossum (Dialictus) tegulare (Robertson) species group (Hymenoptera, Halictidae). Zootaxa 2032: 1-38.
                        • 56. Locke SA, McLaughlin JD, Dayanandan S, Marcogliese DJ (2010) Diversity and specificity in Diplostomum spp. metacercariae in freshwater fishes revealed by cytochrome c oxidase I and internal transcriber spacer sequences. Int J Parasitol 40: 333-343. doi:https://doi.org/10.1016/j.ijpara.2009.08.012. PubMed: 19737570.
                        • 57. Meyer CP, Paulay G (2005) DNA barcoding: error rates based on comprehensive sampling. PLOS Biol 3: e422. doi:https://doi.org/10.1371/journal.pbio.0030422. PubMed: 16336051.
                        • 58. Meier R, Shiyang K, Vaidya G, Ng PKL (2006) DNA barcoding and taxonomy in Diptera: a tale of high intraspecific variability and low identification success. Syst Biol 55: 715-728. doi:https://doi.org/10.1080/10635150600969864. PubMed: 17060194.
                        • 59. Whitworth TL, Dawson RD, Magalon H, Baudry E (2007) DNA barcoding cannot reliably identify species of the blowfly genus Protocalliphora (Diptera : Calliphoridae). Proc R Soc Lond B 274: 1731-1739. doi:https://doi.org/10.1098/rspb.2007.0062.
                        • 60. Linares MC, Soto-Calderón ID, Lees DC, Anthony NM (2009) High mitochondrial diversity in geographically widespread butterflies of Madagascar: A test of the DNA barcoding approach. Mol Phylogenet Evol 50: 485-495. doi:https://doi.org/10.1016/j.ympev.2008.11.008. PubMed: 19056502.