Figures
Abstract
Background
Common single nucleotide polymorphisms (SNPs) in proprotein convertase subtilisin/kexin type 1 with modest effects on PC1/3 in vitro have been associated with obesity in five genome-wide association studies and with diabetes in one genome-wide association study. We here present a novel SNP and compare its biosynthesis, secretion and catalytic activity to wild-type enzyme and to SNPs that have been linked to obesity.
Methodology/Principal Findings
A novel PC1/3 variant introducing an Arg to Gln amino acid substitution at residue 80 (within the secondary cleavage site of the prodomain) (rs1799904) was studied. This novel variant was selected for analysis from the 1000 Genomes sequencing project based on its predicted deleterious effect on enzyme function and its comparatively more frequent allele frequency. The actual existence of the R80Q (rs1799904) variant was verified by Sanger sequencing. The effects of this novel variant on the biosynthesis, secretion, and catalytic activity were determined; the previously-described obesity risk SNPs N221D (rs6232), Q665E/S690T (rs6234/rs6235), and the Q665E and S690T SNPs (analyzed separately) were included for comparative purposes. The novel R80Q (rs1799904) variant described in this study resulted in significantly detrimental effects on both the maturation and in vitro catalytic activity of PC1/3.
Conclusion/Significance
Our findings that this novel R80Q (rs1799904) variant both exhibits adverse effects on PC1/3 activity and is prevalent in the population suggests that further biochemical and genetic analysis to assess its contribution to the risk of metabolic disease within the general population is warranted.
Citation: Pickett LA, Yourshaw M, Albornoz V, Chen Z, Solorzano-Vargas RS, Nelson SF, et al. (2013) Functional Consequences of a Novel Variant of PCSK1. PLoS ONE 8(1): e55065. https://doi.org/10.1371/journal.pone.0055065
Editor: Ludmila Prokunina-Olsson, National Cancer Institute, National Institutes of Health, United States of America
Received: May 29, 2012; Accepted: December 22, 2012; Published: January 28, 2013
Copyright: © 2013 Pickett et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants from the National Institute of Diabetes and Digestive and Kidney Diseases (#DK083762) and the California Institute of Regenerative Medicine (CIRM), RT2-01985 to MGM; and a grant from the National Institute of Drug Abuse (#DA05084) to IL. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Prohormone convertase 1/3 is a calcium-dependent serine endoprotease essential for the conversion of a variety of prohormones and neuropeptide precursors to their bioactive forms. Human prohormone convertase 1/3 (PC1/3) is encoded by the gene PCSK1, which is located on chromosome 5 and is comprised of 14 exons [1]. PC1/3 is expressed in a subset of endocrine and neuroendocrine tissues, cells equipped with a regulated secretory pathway. During transit through the secretory pathway, PC1/3 is first synthesized in the endoplasmic reticulum (ER) as an inactive 94 kDa zymogen composed of an N-terminal signal peptide, a prodomain which serves as an intramolecular chaperone and inhibitor; a catalytic domain which accomplishes substrate hydrolysis; a P (homo B) domain which contributes to enzymatic properties; and a carboxyl-terminal (CT) domain which, when removed by partial or complete in trans proteolytic processing, results in a much more active, but also less stable, enzymatic form (reviewed in [2] (Figure 1). PC1/3 is abundantly expressed in the arcuate and paraventricular nuclei of the hypothalamus [3], [4], tissues that are known to mediate satiety and hunger signals [5]. Substrates of PC1/3, such as proinsulin, proglucagon, proghrelin, agouti-related protein, pro-neuropeptide Y, provasopressin and proopiomelanocortin are responsible for the regulation of absorption, metabolism and acquisition (appetite) of nutrients [6], [7], [8], [9], [10], [11], [12], [13], [14].
The upward arrows indicate the cleavage sites required for PC1/3 maturation. The downward arrows indicate locations of previously described (black) and novel (purple) SNP. The dashed line between the pro and catalytic domains represents a primary cleavage site (occurring in the ER) that is required for activation. The dashed line in the middle of the prodomain indicates the secondary cleavage site (likely cleaved in the trans-Golgi network). The P or Homo B domain following the catalytic domain is important for the stabilization of the catalytic domain, as well as determining various enzymatic properties. The C-terminal domain plays a role in efficient routing of PC1/3 to the secretory granules, and contributes to substrate specificity as well as to specific activity and stability.
Deficiencies in PC1/3 frequently lead to imbalances in prohormone processing that result in an array of metabolic phenotypes, previously investigated both in mouse models and in humans. Three human subjects have been described with an autosomal recessive disorder (MIM:600955) associated with severe mutations of PC1/3 resulting in early-onset obesity, hyperphagia, hypoadrenalism, reactive hypoglycemia, malabsorptive diarrhea, and hypogonadism [15], [16], [17]. Interestingly, the PC1/3 null mouse model, unlike the PC1/3-deficient human, is not obese. Although of normal weight at birth, PC1/3 null mice have a high post-natal mortality rate, and those that do survive have a significant reduction in body mass as compared to wild-type animals by the age of 6 weeks. The stunted growth of PC1/3 null mice is believed to be due at least in part to reduced processing of growth hormone releasing hormone (GHRH) and thus reduced circulating levels of growth hormone (GH) [8]. In addition to a reduction in GHRH, the levels of several key neuroendocrine peptides such as ACTH, insulin and glucagon-like peptides-1 and -2 are reduced in these animals due to lack of precursor processing by PC1/3 [8].
While the PC1/3 null mouse is not obese, a mouse model of obesity has been generated via introduction of a missense mutation in PCSK1 at amino acid position 222, near the calcium-binding pocket in the catalytic domain. This hypomorph mutation resulted in obesity, hyperphagia and increased metabolic efficiency due to decreased autocatalytic maturation of the enzyme to smaller molecular weight forms [18]. Three common SNPs in PCSK1 have been identified and associated with obesity. All three SNPs (included in this study for comparison) exhibit moderate effects on catalytic activity in vitro and on natural substrate processing in rat pituitary tumor cells [19], [20]. Two of the three non-deleterious SNPs (S690T [rs6235] and Q665E [rs6234]) have been associated with diabetes-related traits [20], [21], [22].
In the work presented below, the novel variant NP_000430.3:p.Arg80Gln (R80Q; rs1799904), identified and functionally evaluated for the first time here, was compared with previously described SNPs associated with obesity and/or diabetes (N221D [rs6232], Q665E/S690T [rs6234/rs6235], Q665E [rs6234], and S690T [rs6235]) for potentially deleterious effects on the biosynthesis, secretion and catalytic activity of PC1/3. Our data suggest that this novel R80Q variant (rs1799904) deserves further analysis to assess its genetic association with metabolic diseases such as obesity and diabetes.
Materials and Methods
Databases used and protein structure/function analysis methods
Alleles that varied from the human reference genome build GRCh37 [23] were obtained from the dbSNP [24], 1000 Genomes [25], NHLBI [26], and NIEHS [27] datasets and were merged into a custom SQL database. dbSNP data were compiled from various sources, with allele frequencies available only for a subset of variants. The 1000 Genomes dataset was based on both low coverage whole genome and higher coverage exome sequencing of 1092 individuals. The NHLBI and NIEHS data were obtained from exome sequencing of 6500 and 95 individuals respectively. Population allele frequencies were calculated using the combined datasets wherever allele counts were present. Variations in PCSK1 (chr5:95726119-95769847) were identified and analyzed with the Ensembl Variant Effect Predictor version 2.6 [28] and Ensembl database homo_sapiens_variation_68_37 [29] to determine the effect of the variant on the transcript. Non-synonymous codon substitutions were analyzed using the SIFT [23], [30], [31], [32], [33], PolyPhen [34], [35], [36], and Condel [37] models to estimate the variant's probable impact on protein structure and function.
Sanger sequencing of genomic DNA
Genomic DNA from individuals homozygous for two SNPs of interest was isolated from EBV-infected B cells by the Coriell Institute and sent to us for sequencing. The HG00596 DNA sample containing rs1799904 (p.R80Q; (g.5:95764963C>T; c.239G>A) was obtained from a southern Han Chinese female, while the N586Tfsx4-containing (g.5:95730696TC>T; c.1755delG) DNA sample, HG00350, was obtained from a Finnish female. The primers used for sequencing bidirectionally were:
Exon 2 (510 bp):
(F) CTCAACCAATTCAACCCAATC;
(R) CCCGTGACACAAGTTTACCTATG; and
Exon 13 (545 bp):
(F) CAGCTTTCCAAGAACACATCC;
(R) CCATGTTTGACTTATTTCCTGC
Expression vector construction/mutagenesis
Flag-tagged human PC1/3, a kind gift of J. W. Creemers [20] was modified by site-directed mutagenesis using the Stratagene QuikChange method [38] to introduce the mutations shown in Figure 1. All mutations were verified by sequencing of the entire PC1/3 cDNA insert.
Transient transfection of PC1/3 variants
To assess the biosynthesis and secretion profiles of PC1/3 variants in a cell line that does not express endogenous PC1/3, Ad-293 (Stratagene) HEK cells, plated at a density of 2×105 cells per well in 24-well plates, were transfected with plasmids encoding either wild-type or variant PC1/3s in triplicate wells. Cells were transfected with 200 ng of plasmid DNA per well using Lipofectamine (Invitrogen, Carlsbad, CA). To assess effects in a regulated neuroendocrine cell line (also lacking expression of endogenous PC1/3), Neuro-2A cells (ATCC, cat. No. CCL-131) were transfected in triplicate with the same protocol using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). For both cell lines, five hours post-transfection, 1 ml of growth medium was added to each well and incubation continued for an additional 24 h. Cells were then washed with PBS and 0.3 ml of Opti-MEM (Invitrogen, Carlsbad, CA) containing 100 ug/ml bovine aprotinin (Desert Biologicals) was added to each well. Cells were incubated for an additional 18–24 h before conditioned medium and cells were harvested. Conditioned medium was analyzed first by enzyme assay; both cells and medium samples (for HEK cells) and medium samples (for Neuro- 2A cells) were then subjected to SDS-PAGE followed by Western blotting using primary antiserum against the amino terminus of mature mouse PC1/3 [39]. Mouse monoclonal anti-ß-actin antiserum (Sigma-Aldrich, St. Louis, MO) was used to assess cellular actin levels as a loading control. Western blots were then probed with horseradish peroxidase-coupled secondary antiserum. Visualization of immunoreactive protein was accomplished using the SuperSignal West Femto Maximum Sensitivity Substrate kit (Thermo Scientific, Rockford, IL).
Enzyme assay
Enzymatic activity of secreted recombinant PC1/3 proteins present in conditioned medium obtained from transiently transfected HEK293 cells was measured in triplicate 50 ul reactions in a 96-well polypropylene plate containing 25 ul of conditioned medium and final concentrations of 200 uM substrate (pyr-ERTKR-amc [7-amino-4-methlcoumarin]), 100 mM sodium acetate, pH 5.5, 2 mM CaCl2, 0.1% Brij 35, and a protease inhibitor cocktail (final concentrations: 1 uM pepstatin, 0.28 mM TPCK, 10 uM E-64, and 0.14 mM TLCK). Reaction mixtures were incubated at 37°C and fluorescence measurements (380 nm excitation, 460 emission) were taken under kinetic conditions every 20 seconds for 1 h in a SpectraMax M2 Microplate Reader. Maximum rates were obtained from the linear portion of the kinetic measurement curves. Specific activities of PC1/3 proteins in the conditioned medium were determined by dividing maximum rates by band intensities of total secreted immunoreactive protein, each determined in triplicate, and quantified with an Alphaimager 3300 (Alpha Innotech Corporation, San Leandro, CA) imaging system.
Results
Analysis of public databases; structure-function analysis
A total of 1020 allelic variants (data not shown) within the PCSK1 gene were found in the public databases, of which 54 were potentially consequential splice site or missense variants (Table 1). Thirty-seven non-synonymous substitutions were predicted to be possibly or probably deleterious by at least one model (SIFT, PolyPhen, or Condel, where Condel represents a consensus modeling program). Two of the three previously described variants are common, with MAFs of 23.7% for S690T (rs6235) and 25.0% for Q665E (rs6234), whereas the N221D SNP (rs6232) is less common (MAF = 3.3%). None of these three variants were predicted to be deleterious using SIFT, PolyPhen, or Condel. In contrast, the novel variants that were predicted as “possibly” or “probably” deleterious were unique to one sample or were observed with very low frequency (minor allele frequencies (MAFs) of 0.008%–0.87%. In addition we considered a frameshift variant N586TfX4 (g.5:95730696), which exhibited an unusually large MAF of 6.1% in a previous release of the 1000 Genomes data. We selected the most common novel variant R80Q (rs1799904; MAF = 0.87%), and N586TfsX4 for genomic sequencing and potential functional studies, comparing them with already described common variants of PC1/3.
SNP validation by sequencing
Genomic DNA from two individuals homozygous for the most common variants was obtained from the Coriell Institute and subjected to Sanger sequencing. The DNA sample containing rs1799904 (R80Q (g.5:95764963C>T; c.239G>A) was found to be homozygous for the R80Q mutation in exon 2 (Figure 2), while the N586Tfsx4-containing SNP (g.5:95730696TC>T; c.1755delG) was determined to be a false positive (i.e. no frameshift mutation was found in in exon 13) (data not shown).
Secretion and biosynthesis of PC1/3 variants
In order to assess whether the novel variant R80Q (rs1799904) affected the biosynthesis or secretion of PC1/3, expression vectors encoding wild-type and variant PCSK1s were transiently transfected into HEK and/or Neuro-2a cells (both lines lack expression of endogenous PC1/3). PC1/3 proteins containing the previously described S690T/Q665E (rs6234/rs6235) pair, as well as the individual S690T and Q665E SNPs, did not exhibit significantly altered expression and secretion patterns as compared to wild-type PC1/3. The N221D (rs6232) substitution resulted in reduced secretion and cleaved forms of PC1/3 in the medium (Figure 3). The secretion profile of the R80Q (rs1799904) substitution differed from wild-type PC1/3, in that the 74 and 66 kDa lower molecular weight forms of PC1/3 were absent from the medium (in HEK cell experiments) or reduced (in Neuro-2a cell experiments), although the total level of secreted PC1/3 was not reduced.
HEK cells were transiently transfected with empty pcDNA3 (E); pcDNA3 encoding either wild-type PC1/3; or PC1/3 proteins bearing the mutations under study. Western blots of cell lysates and media from transfected HEK cells were probed with amino-terminally directed PC1/3 primary antiserum for detection of recombinant proteins. The data shown represent 1 of 3 independent experiments performed in triplicate. Total secreted immunoreactive band intensity values, obtained through densitometry analysis and used to calculate specific activity for each variant, are represented above the Western blot and shown as the mean ± S.D.
Catalytic activity of PC1/3 variants
To determine the impact of these variations on PC1/3 catalytic activity, conditioned medium of HEK cells transfected with either empty vector, variant PC1/3s, or wild-type PC1/3 was subjected to a fluorogenic assay. Maximum rates of fluorogenic substrate cleavage were normalized using the band intensities of secreted PC1/3s in order to determine the specific activity of each variant relative to wild-type PC1/3. The S690T/Q665E (rs6234/rs6235) and S690T (rs6234) amino acid substitutions did not significantly alter specific activity (95% confidence level; p>0.13). The Q665E substitution alone resulted in a small but significant 27% decrease in specific activity as compared to wild-type (p = 0.05). The N221D (rs6232) substitution decreased specific activity by 36% (p = 0.02), and the R80Q variation resulted in a 38% decrease (p = 0.02) (Figure 4). When expressed in Neuro-2a cells, the R80Q (rs1799904) variant resulted in a 42–48% decrease (p<0.0001) in activity as compared to wild-type PC1/3 (Figure 5).
Enzymatic activities of secreted recombinant PC1/3 proteins in conditioned medium of transfected HEK cells were compared by measuring maximum cleavage rates using the fluorogenic substrate pyr-ERTKR-amc during a 1 h kinetic assay. Three replicates per transfection condition were assayed in triplicate, and maximum rates were divided by band intensity of immunoreactive protein in the spent medium of the same wells from which activity data were derived. Specific activity values are shown as the mean ± S.D (n = 3). Data represent one of 3 independent experiments performed in triplicate.
Panel A: Neuro-2a cells were transiently transfected with equal amounts of empty pcDNA3 (E), or pcDNA3 encoding wild-type PC1/3 or the novel variant R80Q (rs1799904) PC1/3. Western blots of media were probed using amino-terminally directed PC1/3 primary antiserum. The data shown represent one of 3 independent experiments performed in triplicate. Panel B: Specific activities of wild-type PC1/3 and the R80Q PC1/3 variant. Enzymatic activities of secreted recombinant PC1/3 proteins in conditioned medium were compared by measuring maximum cleavage rates using the fluorogenic substrate pyr-ERTKR-amc during a 1 h kinetic assay. Three replicates per transfection condition were assayed in triplicate, and maximum rates were divided by band intensity of immunoreactive protein in the spent medium of the same wells from which the activity data were derived. Specific activity values are shown as the mean ± S.D. Data represent one of 3 independent experiments, each performed in triplicate.
Discussion
In studies of European populations, PCSK1 represents the third most important gene contributing to extreme obesity [40]. Functional studies of certain SNPs associated with obesity that impose modest or no significant effects on PC1/3 function in vitro have supported the idea that even slight variations in PC1/3 activity can predispose an individual to higher risk of obesity [20]. Individuals who are compound heterozygotes or are homozygous for rare severe deleterious mutations in PCSK1 suffer from multi-dimensional disease states, including small intestinal dysfunction, hyperphagia and obesity [15], [16], [17]. Even heterozygous mutations which result in functional enzymatic changes have been linked to obesity, despite the presence of a normal allele [40]. The mechanism by which modest deficiencies in PC1/3 activity can lead to such profound phenotypes when present on a single allele remains unknown. A closer look into the complex biochemistry of commonly found variations of this enzyme may provide answers to these questions. In this work, we have analyzed public databases for other less common and rare deleterious variants and identified the variant R80Q (rs1799904), and have compared the effects of this variant to those of known polymorphisms.
Consistent with previous studies [19], [20], we found that the amino acid substitutions S690T/Q665E (rs6234/rs6235) did not significantly alter the specific activity or biosynthesis and secretion of PC1/3 in HEK cells. The Q665E substitution alone did result in a slight decrease in specific activity as compared to wild-type enzyme, and may represent the more detrimental of the two mutations (S690T/Q665E), which were previously identified as a paired SNP associated with a higher risk of developing obesity and diabetes [19], [20], [21]. In our hands, the N221D (rs6232) substitution decreased specific activity by a somewhat greater extent than previously reported, possibly due to differences in enzyme assay methods [20].
However, of all of the variants we analyzed in HEK cells, the novel R80Q (rs1799904) variant exhibited the most detrimental effects on PC1/3 maturation and specific activity. This variant yielded an 87 kDa product in the conditioned medium that did not undergo further carboxy-terminal processing to the more active 74 and 66 kDa forms, resulting in an enzyme with significantly lower specific activity, similar to the more common obesity risk N221D (rs6232) variant. This novel R80Q variant exhibited an even more pronounced decrease in specific activity when expressed in a cell line containing a regulated secretory pathway (Neuro-2a), where wild-type PC1/3 is likely able to achieve greater specific activity through more complete maturation to its lower molecular weight forms within regulated secretory vesicles. The lower molecular weight forms of PC1/3 exhibit a different substrate specificity than full-length 87 kDa PC1/3 [41]; this could be an important mechanism for SNPs to exert functional effects. Another possible functional consequence of altering the profile of active species is a change in enzyme stability, since carboxy-terminally truncated species are known to be more labile than the 87 kDa form (reviewed in [2]). Since the C-terminal region of PC1/3 has been implicated in targeting of this enzyme to secretory granules [42], [43], altered C-terminal processing may also result in changes in enzyme distribution. Further studies using immunocytochemistry in transfected Neuro- 2A cells will shed additional light on this question.
The proPC1/3 maturation process begins with the autocatalytic intramolecular cleavage of the pro-domain in the ER at the primary cleavage site, RSKR107–110 [44], [45]. This cleavage yields an 87 kDa form of PC1/3 that, by analogy with the related enzyme furin [46] likely remains associated with its own prodomain through non-covalent interactions until its arrival at the trans-Golgi network. Although this has not yet been strictly demonstrated for PC1/3, the PC1/3 prodomain most likely assists in the folding of the catalytic domain and in enzyme inhibition during secretory pathway transport [47], [48], [49], [50], [51], [52]. If prodomain processing of PC1/3 occurs similarly to that of furin, trans-Golgi network protonation of a histidine in the vicinity of the secondary cleavage site (RRSRR77–81) then results in secondary site cleavage at R81, followed by dissociation of prodomain fragments from PC1/3 [53], [54]. The inhibitory role of the prodomain is of particular interest to this study when we consider the location of the R80Q (rs1799904) substitution within the secondary cleavage site of the prodomain (Figure 1). Independent studies have shown that alteration of mouse proPC1/3 prodomain residues either within or surrounding cleavage motifs can affect propeptide processing; the in vitro proteolytic conversion of an R80A mutant propeptide (the same residue as the R80Q variant studied here) by wild-type enzyme was impaired compared to wild-type propeptide [44]. Given this finding, our lack of identification of propeptide-bearing R80Q PC1/3 is puzzling. We have previously found that a portion of newly synthesized proPC1/3 is subjected to endoplasmic reticulum- associated degradation [52]; this might represent the fate of this molecular species. Collectively, these data support the idea that residues within the secondary cleavage site, including the novel variant studied here, contribute to the proper processing of proPC1/3.
The novel R80Q (rs1799904) variant (MAF = 0.87%) is about one-third as common as the N221D (rs6232) SNP (MAF = 3.3%). Although less common, the R80Q variant should be subjected to further analysis to evaluate its influence on insulin sensitivity, proinsulin conversion and the risk of developing obesity, similarly to the effect of the N221D (rs6232) SNP [20], [22]. We note that 119 individuals in the public datasets have other, less common and rare variants of PCSK1, most of which are predicted to have some detrimental effect on protein function. This mutational burden on the population is not trivial and may also play a role in susceptibility to obesity or other disorders. The importance of rare variants in common disorders is not clear at present, but advances in massively parallel sequencing and computational analysis may soon shed additional light on this question.
In conclusion, we show that the novel PCSK1 variant R80Q (rs1799904) exhibits deleterious effects on PC1/3 maturation. This PC1/3 variant exhibits decreased catalytic activity as compared to wild-type PC1/3 and to previously described obesity risk SNPs; therefore, it may contribute to a higher risk of metabolic disease in the general population. Our results suggest that further study of less common and rare variations in PCSK1 from both biochemical and genetic standpoints will be useful in elucidating the mechanisms by which variant PC1/3s contribute to metabolic diseases such as obesity and diabetes.
Author Contributions
Conceived and designed the experiments: MY MGM IL. Performed the experiments: LAP MY VA ZC RSS. Analyzed the data: LAP VA MY ZC RSS SN MGM IL. Contributed reagents/materials/analysis tools: MGM IL. Wrote the paper: LAP MY MGM IL.
References
- 1. Seidah NG, Mattei MG, Gaspar L, Benjannet S, Mbikay M, et al. (1991) Chromosomal assignments of the genes for neuroendocrine convertase PC1 (NEC1) to human 5q15-21, neuroendocrine convertase PC2 (NEC2) to human 20p11.1-11.2, and furin (mouse 7[D1-E2] region). Genomics 11: 103–107.
- 2.
Hoshino A, Lindberg I (2012) Peptide Biosynthesis: Prohormone Convertases 1/3 and 2. In: Fricker LD, Devi L, editors: Morgan & Claypool Life Sciences Publishers.
- 3. Schafer MK, Day R, Cullinan WE, Chretien M, Seidah NG, et al. (1993) Gene expression of prohormone and proprotein convertases in the rat CNS: a comparative in situ hybridization analysis. J Neurosci 13: 1258–1279.
- 4. Dong W, Seidel B, Marcinkiewicz M, Chretien M, Seidah NG, et al. (1997) Cellular localization of the prohormone convertases in the hypothalamic paraventricular and supraoptic nuclei: selective regulation of PC1 in corticotrophin-releasing hormone parvocellular neurons mediated by glucocorticoids. J Neurosci 17: 563–575.
- 5. Wynne K, Stanley S, McGowan B, Bloom S (2005) Appetite control. J Endocrinol 184: 291–318.
- 6. Smeekens S, Montag AG, Thomas G, Albiges-Rizo C, Carrol R, et al. (1992) Proinsulin processing by the subtilisin-related proprotein convertases furin, PC2, and PC3. Proc Natl Acad Sci USA 89: 8822–8826.
- 7. Rouille Y, Kantengwa S, Irminger JC, Halban PA (1997) Role of the prohormone convertases in the processing of proglucagon to glucagon-like peptides. J Biol Chem 72: 32810–32816.
- 8. Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, et al. (2002) Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci USA 99: 10293–10298.
- 9. Zhu X, Cao Y, Voogd K, Steiner DF (2006) On the processing of proghrelin to ghrelin. J Biol Chem 281: 38867–38870.
- 10. Creemers JW, Pritchard LE, Gyte A, Le Rouzic P, Meulemans S, et al. (2006) Agouti-related protein is posttranslationally cleaved by proprotein convertase 1 to generate agouti-related protein (AGRP)83-132: interaction between AGRP83-132 and melanocortin receptors cannot be influenced by syndecan-3. Endocrinology 147: 1621–1631.
- 11. Brakch N, Rist B, Beck-Sickinger AG, Goenaga J, Wittek R, et al. (1997) Role of prohormone convertases in pro-neuropeptide Y processing: coexpression and in vitro kinetic investigations. Biochemistry 36: 16309–16320.
- 12. Coates LC, Birch NP (1998) Differential cleavage of provasopressin by the major molecular forms of SPC3. J Neurochem 70: 1670–1678.
- 13. Benjannet S, Rondeau N, Day R, Chretien M, Seidah NG (1991) PC1 and PC2 are proprotein convertases capable of cleaving proopiomelanocortin at distinct pairs of basic residues. Proc Natl Acad Sci U S A 88: 3564–3568.
- 14. Thomas L, Leduc R, Thorne BA, Smeekens SP, Steiner D, et al. (1991) Kex2-like endoproteases PC2 and PC3 accurately cleave a model prohormone in mammalian cells: evidence for a common core of neuroendocrine processing enzymes. Proc Natl Acad Sci USA 88: 5297–5301.
- 15. Jackson RS, Creemers JW, Farooqi IS, Raffin-Sanson ML, Varro A, et al. (2003) Small-intestinal dysfunction accompanies the complex endocrinopathy of human proprotein convertase 1 deficiency. J Clin Invest 112: 1550–1560.
- 16. Jackson RS, Creemers JW, Ohagi S, Raffin-Sanson ML, Sanders L, et al. (1997) Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nat Genet 16: 303–306.
- 17. Farooqi IS, Volders K, Stanhope R, Heuschkel R, White A, et al. (2007) Hyperphagia and early-onset obesity due to a novel homozygous missense mutation in prohormone convertase 1/3. J Clin Endocrinol Metab 92: 3369–3373.
- 18. Lloyd DJ, Bohan S, Gekakis N (2006) Obesity, hyperphagia and increased metabolic efficiency in Pc1 mutant mice. Hum Mol Genet 15: 1884–1893.
- 19. Mbikay M, Sirois F, Nkongolo KK, Basak A, Chretien M (2011) Effects of rs6234/rs6235 and rs6232/rs6234/rs6235 PCSK1 single-nucleotide polymorphism clusters on proprotein convertase 1/3 biosynthesis and activity. Mol Genet Metab 104: 682–687.
- 20. Benzinou M, Creemers JW, Choquet H, Lobbens S, Dina C, et al. (2008) Common nonsynonymous variants in PCSK1 confer risk of obesity. Nat Genet 40: 943–945.
- 21. Strawbridge RJ, Dupuis J, Prokopenko I, Barker A, Ahlqvist E, et al. (2011) Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes. Diabetes 60: 2624–2634.
- 22. Heni M, Haupt A, Schafer SA, Ketterer C, Thamer C, et al. (2010) Association of obesity risk SNPs in PCSK1 with insulin sensitivity and proinsulin conversion. BMC Med Genet 11: 86.
- 23. Finishing the euchromatic sequence of the human genome. Nature 431: 931–945.
- 24. Sherry ST, Ward MH, Kholodov M, Baker J, Phan L, et al. (2001) dbSNP: the NCBI database of genetic variation. Nucleic Acids Res 29: 308–311.
- 25. A map of human genome variation from population-scale sequencing. Nature 467: 1061–1073.
- 26.
NHLBI Exome Sequencing Project (2011) Exome Variant Server. Seattle WA: NHLBI Exome Sequencing Project (ESP).
- 27.
NIEHS Environmental Genome Project (2011) NIEHS Exome Variant Server. Seattle WA: NIEHS Environmental Genome Project.
- 28. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, et al. (2010) The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20: 1297–1303.
- 29. Flicek P, Amode MR, Barrell D, Beal K, Brent S, et al. (2011) Ensembl 2011. Nucleic Acids Res 39: D800–806.
- 30. Kumar P, Henikoff S, Ng PC (2009) Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nature Protocols 4: 1073–1082.
- 31. Ng PC, Henikoff S (2002) Accounting for human polymorphisms predicted to affect protein function. Genome Research 12: 436–446.
- 32. Ng CP, Henikoff S (2003) SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Research 31: 3812–3814.
- 33. Ng PC, Henikoff S (2006) Predicting the effects of amino acid substitutions on protein function. Annual Review of Genomics and Human Genetics 7: 61–80.
- 34. Ramensky V, Bork P, Sunyaev S (2002) Human non-synonymous SNPs: server and survey. Nucleic Acids Res 30: 3894–3900.
- 35. Sunyaev S, Ramensky V, Bork P (2000) Towards a structural basis of human non-synonymous single nucleotide polymorphisms. Trends Genet 16: 198–200.
- 36. Sunyaev S, Ramensky V, Koch I, Lathe W 3rd, Kondrashov AS, et al. (2001) Prediction of deleterious human alleles. Human Molecular Genetics 10: 591–597.
- 37. Gonzalez-Perez A, Lopez-Bigas N (2011) Improving the assessment of the outcome of nonsynonymous SNVs with a consensus deleteriousness score, Condel. American Journal of Human Genetics 88: 440–449.
- 38. Braman J, Papworth C, Greener A (1996) Site-directed mutagenesis using double-stranded plasmid DNA templates. Methods Mol Biol 57: 31–44.
- 39. Vindrola O, Lindberg I (1992) Biosynthesis of the prohormone convertase mPC1 in AtT-20 cells. Mol Endocrinol 6: 1088–1094.
- 40. Creemers JW, Choquet H, Stijnen P, Vatin V, Pigeyre M, et al. (2012) Heterozygous mutations causing partial prohormone convertase 1 deficiency contribute to human obesity. Diabetes 61: 383–390.
- 41. Zhou Y, Rovere C, Kitabgi P, Lindberg I (1995) Mutational analysis of PC1 (SPC3) in PC12 cells. 66-kDa PC1 is fully functional. J Biol Chem 270: 24702–24706.
- 42. Zhou A, Mains RE (1994) Endoproteolytic processing of proopiomelanocortin and prohormone convertases 1 and 2 in neuroendocrine cells overexpressing prohormone convertases 1 or 2. J Biol Chem 269: 17440–17447.
- 43. Bernard N, Kitabgi P, Rovere-Jovene C (2003) The Arg617–Arg618 cleavage site in the C-terminal domain of PC1 plays a major role in the processing and targeting of the enzyme within the regulated secretory pathway. J Neurochem 85: 1592–1603.
- 44. Rabah N, Gauthier D, Wilkes BC, Gauthier DJ, Lazure C (2006) Single amino acid substitution in the PC1/3 propeptide can induce significant modifications of its inhibitory profile toward its cognate enzyme. J Biol Chem 281: 7556–7567.
- 45. Goodman LJ, Gorman CM (1994) Autoproteolytic activation of the mouse prohormone convertase mPC1. Biochem Biophys Res Commun 201: 795–804.
- 46. Anderson ED, VanSlyke JK, Thulin CD, Jean F, Thomas G (1997) Activation of the furin endoprotease is a multiple-step process: requirements for acidification and internal propeptide cleavage. EMBO J 16: 1508–1518.
- 47. Creemers JW, Vey M, Schafer W, Ayoubi TA, Roebroek AJ, et al. (1995) Endoproteolytic cleavage of its propeptide is a prerequisite for efficient transport of furin out of the endoplasmic reticulum. J Biol Chem 270: 2695–2702.
- 48. Mains RE, Milgram SL, Keutman HT, Eipper BA (1995) The NH2-terminal proregion of peptidylglycine a-amidating monooxygenase facilitates the secretion of soluble proteins. Mol Endocrinol 9: 3–13.
- 49. Apletalina EV, Juliano MA, Juliano L, Lindberg I (2000) Structure-function analysis of the 7B2 CT peptide. Biochem Biophys Res Commun 267: 940–942.
- 50. Muller L, Cameron A, Fortenberry Y, Apletalina EV, Lindberg I (2000) Processing and sorting of the prohormone convertase 2 propeptide. J Biol Chem 275: 39213–39222.
- 51. Bissonnette L, Charest G, Longpre JM, Lavigne P, Leduc R (2004) Identification of furin pro-region determinants involved in folding and activation. Biochem J 379: 757–763.
- 52. Lee SN, Prodhomme E, Lindberg I (2004) Prohormone convertase 1 (PC1) processing and sorting: effect of PC1 propeptide and proSAAS. J Endocrinol 182: 353–364.
- 53. Tangrea MA, Bryan PN, Sari N, Orban J (2002) Solution structure of the pro-hormone convertase 1 pro-domain from Mus musculus. J Mol Biol 320: 801–812.
- 54. Benjannet S, Rondeau N, Paquet L, Boudreault A, Lazure C, et al. (1993) Comparative biosynthesis, covalent post-translational modifications and efficiency of prosegment cleavage of the prohormone convertases PC1 and PC2: glycosylation, sulphation and identification of the intracellular site of prosegment cleavage of PC1 and PC2. Biochem J 294 (Pt 3) 735–743.