ࡱ > ~ } r bjbjVV 4 < < j % % % % % 0 ` E E E E \ ^ ^ ^ ^ ^ ^ > ^ ^ E E s E E \ \ E `
ߊ % H 0 ( ^ ^ : Supplementary Text S1
Genotyping conditions for microsatellite markers
A total of 13 microsatellites and a sex marker were analyzed for all individuals according to the below conditions. Amplifications were conducted in four multiplex reactions (PCR 1-4), and in all cases, the 5 dye labels were supplied by Applied Biosystems Inc (ABI). All PCR reactions contained 1 unit Go Taq polymerase (Promega) with 1x associated buffer (working out at 1.5-2 mM MgCL2 per reaction). All PCR amplifications were based on a 2 minute heat start at 94C, denaturizing for 20 seconds at 94C, annealing for 45 seconds, elongation at 72C for 1 minute and a final hold at 4C.
PCR 1: 1.7M (6-FAM) primer GT509 ADDIN EN.CITE Berube200015015015017Berube, M.Jorgensen, H.McEwing, R.Palsboll, P. J.Univ Wales, Sch Biol Sci, Bangor LL57 2UW, Gwynedd, Wales. Univ Copenhagen, Dept Evolutionary Biol, DK-2100 Copenhagen O, Denmark.
Berube, M, Univ Wales, Sch Biol Sci, Deiniol Rd, Bangor LL57 2UW, Gwynedd, Wales.Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliaeMolecular EcologyMol. Ecol.Molecular Ecology2181-2183912baleen whalekinshipMysticetiSTR lociPOPULATION2000Dec0962-1083ISI:000166112700037Article<Go to ISI>://000166112700037English[1], 0.3 M (6-FAM) primer GATA098 ADDIN EN.CITE Palsbll199718118118117Palsbll, P.Brub, M.Larsen, A. H.Jrgensen, H.Primers for the amplification of tri- and tetramer microsatellite loci in cetaceansMolecular EcologyMolecular Ecology893-89561997[2], 0.15 M (6-FAM) primer EV001Pm ADDIN EN.CITE Valsecchi199615415415417Valsecchi, E.Amos, W.Valsecchi, E, UNIV CAMBRIDGE,DEPT GENET,DOWNING ST,CAMBRIDGE CB2 3EH,ENGLAND.Microsatellite markers for the study of cetacean populationsMolecular EcologyMol. Ecol.Molecular Ecology151-15651cetacean conservationmicrosatellitespopulation markersSTRwhalesSIMPLE-SEQUENCE LOCIDNAAMPLIFICATIONCONSERVATION1996Feb0962-1083ISI:A1996TZ21500017Article<Go to ISI>://A1996TZ21500017English[3], 0.17M (VIC) primer EV037Mn ADDIN EN.CITE Valsecchi199615415415417Valsecchi, E.Amos, W.Valsecchi, E, UNIV CAMBRIDGE,DEPT GENET,DOWNING ST,CAMBRIDGE CB2 3EH,ENGLAND.Microsatellite markers for the study of cetacean populationsMolecular EcologyMol. Ecol.Molecular Ecology151-15651cetacean conservationmicrosatellitespopulation markersSTRwhalesSIMPLE-SEQUENCE LOCIDNAAMPLIFICATIONCONSERVATION1996Feb0962-1083ISI:A1996TZ21500017Article<Go to ISI>://A1996TZ21500017English[3], 0.18 M (NED) primer GT310 ADDIN EN.CITE Berube200015015015017Berube, M.Jorgensen, H.McEwing, R.Palsboll, P. J.Univ Wales, Sch Biol Sci, Bangor LL57 2UW, Gwynedd, Wales. Univ Copenhagen, Dept Evolutionary Biol, DK-2100 Copenhagen O, Denmark.
Berube, M, Univ Wales, Sch Biol Sci, Deiniol Rd, Bangor LL57 2UW, Gwynedd, Wales.Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliaeMolecular EcologyMol. Ecol.Molecular Ecology2181-2183912baleen whalekinshipMysticetiSTR lociPOPULATION2000Dec0962-1083ISI:000166112700037Article<Go to ISI>://000166112700037English[1], 1.5 mM MgCl2 and 0.2 mM dNTP, 28 amplification cycles with annealing temperature of 59C.
PCR 2: 0.2 M (NED) primer GT211 ADDIN EN.CITE Berube200015015015017Berube, M.Jorgensen, H.McEwing, R.Palsboll, P. J.Univ Wales, Sch Biol Sci, Bangor LL57 2UW, Gwynedd, Wales. Univ Copenhagen, Dept Evolutionary Biol, DK-2100 Copenhagen O, Denmark.
Berube, M, Univ Wales, Sch Biol Sci, Deiniol Rd, Bangor LL57 2UW, Gwynedd, Wales.Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliaeMolecular EcologyMol. Ecol.Molecular Ecology2181-2183912baleen whalekinshipMysticetiSTR lociPOPULATION2000Dec0962-1083ISI:000166112700037Article<Go to ISI>://000166112700037English[1], 0.4 M (NED) primer GT575 ADDIN EN.CITE Berube200015015015017Berube, M.Jorgensen, H.McEwing, R.Palsboll, P. J.Univ Wales, Sch Biol Sci, Bangor LL57 2UW, Gwynedd, Wales. Univ Copenhagen, Dept Evolutionary Biol, DK-2100 Copenhagen O, Denmark.
Berube, M, Univ Wales, Sch Biol Sci, Deiniol Rd, Bangor LL57 2UW, Gwynedd, Wales.Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliaeMolecular EcologyMol. Ecol.Molecular Ecology2181-2183912baleen whalekinshipMysticetiSTR lociPOPULATION2000Dec0962-1083ISI:000166112700037Article<Go to ISI>://000166112700037English[1], 0.1 M (PET) primer ZFYX0582F, 0.25 M primer ZFY0752R, 0.2 M primer ZFX0785R ADDIN EN.CITE Palsbll199818218218217Palsbll, P. J.Clapham, P. J.Jrgensen, H.Larsen, H.Mattila, D. K.Sears, R. S. J.Vasquez, O.The value of parallel analysis of uni- and bi-parental inherited loci: the North Atlantic humpback whale (Megaptera novaeangliae)In: Karp, A., Isaac, P.G., Ingram, D.S. (eds) Molecular tool for screening biodiversity: plants and animals, London: Chapman and Hall, 426-430.In: Karp, A., Isaac, P.G., Ingram, D.S. (eds) Molecular tool for screening biodiversity: plants and animals, London: Chapman and Hall, 426-430.1998[4], 2 mM MgCl2 and 0.2 mM dNTP, 30 amplification cycles with annealing temperature of 59C.
PCR 3: 0.07M (NED) primer GATA417 ADDIN EN.CITE Palsbll199718118118117Palsbll, P.Brub, M.Larsen, A. H.Jrgensen, H.Primers for the amplification of tri- and tetramer microsatellite loci in cetaceansMolecular EcologyMolecular Ecology893-89561997[2], 0.25M (VIC) primer GATA028 ADDIN EN.CITE Palsbll199718118118117Palsbll, P.Brub, M.Larsen, A. H.Jrgensen, H.Primers for the amplification of tri- and tetramer microsatellite loci in cetaceansMolecular EcologyMolecular Ecology893-89561997[2], 0.08M (VIC) primer GT023 ADDIN EN.CITE Berube200015015015017Berube, M.Jorgensen, H.McEwing, R.Palsboll, P. J.Univ Wales, Sch Biol Sci, Bangor LL57 2UW, Gwynedd, Wales. Univ Copenhagen, Dept Evolutionary Biol, DK-2100 Copenhagen O, Denmark.
Berube, M, Univ Wales, Sch Biol Sci, Deiniol Rd, Bangor LL57 2UW, Gwynedd, Wales.Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliaeMolecular EcologyMol. Ecol.Molecular Ecology2181-2183912baleen whalekinshipMysticetiSTR lociPOPULATION2000Dec0962-1083ISI:000166112700037Article<Go to ISI>://000166112700037English[1], 2 mM MgCl2 and 0.2 mM dNTP, 28 amplification cycles with annealing temperature of 54C.
PCR 4: 0.2M (6-FAM) primer DIrFCB14 ADDIN EN.CITE Buchanan199615115115117Buchanan, F. C.Friesen, M. K.Littlejohn, R. P.Clayton, J. W.FISHERIES & OCEANS CANADA,INST FRESHWATER,WINNIPEG,MB R3T 2N6,CANADA. AGRES,INVERMAY AGR CTR,MOSGIEL,NEW ZEALAND.Microsatellites from the beluga whale Delphinapterus leucasMolecular EcologyMol. Ecol.Molecular Ecology571-57554cetaceamicrosatellitepopulation geneticsgenotypeHUDSON-BAYMAP1996Aug0962-1083ISI:A1996VF47800010Article<Go to ISI>://A1996VF47800010English[5], 0.2 M (NED) primer EV104Mn ADDIN EN.CITE Valsecchi199615415415417Valsecchi, E.Amos, W.Valsecchi, E, UNIV CAMBRIDGE,DEPT GENET,DOWNING ST,CAMBRIDGE CB2 3EH,ENGLAND.Microsatellite markers for the study of cetacean populationsMolecular EcologyMol. Ecol.Molecular Ecology151-15651cetacean conservationmicrosatellitespopulation markersSTRwhalesSIMPLE-SEQUENCE LOCIDNAAMPLIFICATIONCONSERVATION1996Feb0962-1083ISI:A1996TZ21500017Article<Go to ISI>://A1996TZ21500017English[3], 0.2 M (PET) primer EV94Mn ADDIN EN.CITE Valsecchi199615415415417Valsecchi, E.Amos, W.Valsecchi, E, UNIV CAMBRIDGE,DEPT GENET,DOWNING ST,CAMBRIDGE CB2 3EH,ENGLAND.Microsatellite markers for the study of cetacean populationsMolecular EcologyMol. Ecol.Molecular Ecology151-15651cetacean conservationmicrosatellitespopulation markersSTRwhalesSIMPLE-SEQUENCE LOCIDNAAMPLIFICATIONCONSERVATION1996Feb0962-1083ISI:A1996TZ21500017Article<Go to ISI>://A1996TZ21500017English[3], 1.5 mM MgCl2 and 0.2 mM dNTP, 29 amplification cycles with annealing temperature of 59C.
DNA fragments were separated and sized in a capillary based ABI 3730 genetic analyzer. Genotypes were first automatically called, then manually checked by two persons before exporting data. All samples were genotyped twice, and poorly amplified individuals removed. Whale 1 and 2 were genotyped up to 10 times for each marker on two separate DNA isolations. Markers GT310 and GATA098 were excluded from the analyses due to unreliable binning of alleles and PCR amplification respectively.
Sequencing the mtDNA control region
All mtDNA sequencing performed at the Institute of Marine Research in Bergen were conducted according to the below conditions, whereas sequencing for the other samples has been described previously ADDIN EN.CITE ADDIN EN.CITE.DATA [6].
MtDNA sequencing of the samples from the Atlantic was performed by amplifying DNA and thereby sequencing the PCR product in both the forward and reverse directions. The PCR conditions for the two directions were identical except for the primers, and each reaction contained 0.5 units Go Taq polymerase (Promega) with 1x associated buffer (working out at 1.5 mM MgCL2), and 0.2 mM dNTP. Primer concentrations were 0.2 M of each primer (MT4(M13F) and MT3(M13Rev) (modified from ADDIN EN.CITE Arnason199315515515517Arnason, U.Gullberg, A.Widegren, B.ARNASON, U, LUND UNIV,DEPT MOLEC GENET,WALLENBERG LAB,BOX 7031,S-22007 LUND 7,SWEDEN.CETACEAN MITOCHONDRIAL-DNA CONTROL REGION - SEQUENCES OF ALL EXTANT BALEEN WHALES AND 2 SPERM WHALE SPECIESMolecular Biology and EvolutionMol. Biol. Evol.Molecular Biology and Evolution960-970105MITOCHONDRIAL DNACONTROL REGIONCETACEANSWHALEBONE WHALESSPERMWHALESFIN WHALEBALAENOPTERA-MUSCULUSB-PHYSALUSHYBRIDIZATION1993Sep0737-4038ISI:A1993LX26600003Article<Go to ISI>://A1993LX26600003English[7]) for the forward PCR product, and BP15851(M13F) (modified from ADDIN EN.CITE Larsen199615215215217Larsen, A. H.Sigurjonsson, J.Oien, N.Vikingsson, G.Palsboll, P.UNIV COPENHAGEN,DEPT POPULAT BIOL,INST ZOOL,DK-2100 COPENHAGEN O,DENMARK. MARINE RES INST,IS-121 REYKJAVIK,ICELAND. INST MARINE RES,MARINE MAMMAL DIV,N-5024 BERGEN,NORWAY.Populations genetic analysis of nuclear and mitochondrial loci in skin biopsies collected from central and northeastern North Atlantic humpback whales (Megaptera novaeangliae): Population identity and migratory destinationsProceedings of the Royal Society of London Series B-Biological SciencesProc. R. Soc. Lond. Ser. B-Biol. Sci.Proceedings of the Royal Society of London Series B-Biological SciencesProc. R. Soc. Lond. Ser. B-Biol. Sci.Proceedings of the Royal Society of London Series B-Biological SciencesProc. R. Soc. Lond. Ser. B-Biol. Sci.1611-16182631376DNASUBDIVISIONPOLYMERASESEQUENCESBAY1996Nov0962-8452ISI:A1996VV85400029Article<Go to ISI>://A1996VV85400029English[8]) and MN312(M13R) (Modified from ADDIN EN.CITE ADDIN EN.CITE.DATA [9]) for the reverse PCR product. Amplification was as follows: hot start at 94C for 2 min, followed by 30 cycles of denaturizing at 94C for 50 seconds annealing at 53C for 50 seconds and elongation at 72C for 3min 30 seconds, and finally a 10 min elongation at 72C and a 4C hold. The amplicon was sequenced by a standard Big Dye 3.1 protocol (Applied Biosystems) and M13F for forward PCR product and M13R for the reverse PCR product. Sequencing primers:
MT4(M13F) - GTAAAACGACGGCCAGTCCTCCCTAAGACTCAAGGAAG
MT3(M13Rev)- CAGGAAACAGCTATGACCCATCTAGACATTTTCAGTG
BP15851(M13F) -GTAAAACGACGGCCAGTGAAGAAGTATTACACTCCACCAT
MN312(M13R) - CAGGAAACAGCTATGACCCGTGATCTAATGGAGCGGCCA
M13F - GTAAAACGACGGCCAGT
M13R CAGGAAACAGCTATGACC
1. Berube M, Jorgensen H, McEwing R, Palsboll PJ (2000) Polymorphic di-nucleotide microsatellite loci isolated from the humpback whale, Megaptera novaeangliae. Molecular Ecology 9: 2181-2183.
2. Palsbll P, Brub M, Larsen AH, Jrgensen H (1997) Primers for the amplification of tri- and tetramer microsatellite loci in cetaceans. Molecular Ecology 6: 893-895.
3. Valsecchi E, Amos W (1996) Microsatellite markers for the study of cetacean populations. Molecular Ecology 5: 151-156.
4. Palsbll PJ, Clapham PJ, Jrgensen H, Larsen H, Mattila DK, et al. (1998) The value of parallel analysis of uni- and bi-parental inherited loci: the North Atlantic humpback whale (Megaptera novaeangliae). In: Karp, A, Isaac, PG, Ingram, DS (eds) Molecular tool for screening biodiversity: plants and animals, London: Chapman and Hall, 426-430.
5. Buchanan FC, Friesen MK, Littlejohn RP, Clayton JW (1996) Microsatellites from the beluga whale Delphinapterus leucas. Molecular Ecology 5: 571-575.
6. Pastene LA, Goto M, Kanda N, Zerbini AN, Kerem D, et al. (2007) Radiation and speciation of pelagic organisms during periods of global warming: the case of the common minke whale, Balaenoptera acutorostrata. Molecular Ecology 16: 1481-1495.
7. Arnason U, Gullberg A, Widegren B (1993) Cetacean mitochondrial DNA control region sequences of all extant baleen whales and 2 sperm whale species. Molecular Biology and Evolution 10: 960-970.
8. Larsen AH, Sigurjonsson J, Oien N, Vikingsson G, Palsboll P (1996) Populations genetic analysis of nuclear and mitochondrial loci in skin biopsies collected from central and Northeastern North Atlantic humpback whales (Megaptera novaeangliae): Population identity and migratory destinations. Proceedings of the Royal Society of London Series B-Biological Sciences 263: 1611-1618.
9. Palsboll PJ, Clapham PJ, Mattila DK, Larsen F, Sears R, et al. (1995) Distribution of mtDNA haplotypes in North-Atlantic humpback whales the influence of behaviour on population structure. Marine Ecology-Progress Series 116: 1-10.
? H b * 6 S
̸𨘨xdT; 0hy h:Zb CJ OJ PJ QJ aJ mH nHsH tH h:Zb CJ OJ QJ aJ mH sH 'h h CJ H*OJ QJ aJ mH sH he CJ OJ QJ aJ mH sH h CJ OJ QJ aJ mH sH hG* CJ OJ QJ aJ mH sH h<