The authors have declared that no competing interests exist.
Conceived and designed the experiments: QM WH. Performed the experiments: QM XL ZW WH MG YZ. Analyzed the data: QM WH YM XF. Contributed reagents/materials/analysis tools: YM MG. Wrote the paper: QM WH.
The spatiotemporal expression patterns of microRNAs (miRNAs) are important to the verification of their predicted function. RT-qPCR is the accepted technique for the quantification of miRNA expression; however, stem-loop RT-PCR and poly(T)-adapter assay, the two most frequently used methods, are not very convenient in practice and have poor specificity, respectively.
We have developed an optimal approach that integrates these two methods and allows specific and rapid detection of tiny amounts of sample RNA and reduces costs relative to other techniques. miRNAs of the same sample are polyuridylated and reverse transcribed into cDNAs using a universal poly(A)-stem-loop RT primer and then used as templates for SYBR® Green real-time PCR. The technique has a dynamic range of eight orders of magnitude with a sensitivity of up to 0.2 fM miRNA or as little as 10 pg of total RNA. Virtually no cross-reaction is observed among the closely-related miRNA family members and with miRNAs that have only a single nucleotide difference in this highly specific assay. The spatial constraint of the stem-loop structure of the modified RT primer allowed detection of miRNAs directly from cell lysates without laborious total RNA isolation, and the poly(U) tail made it possible to use multiplex RT reactions of mRNA and miRNAs in the same run.
The cost-effective RT-qPCR of miRNAs with poly(A)-stem-loop RT primer is simple to perform and highly specific, which is especially important for samples that are precious and/or difficult to obtain.
Recently, microRNAs (miRNAs) have been discovered in animals and plants. These non-coding RNAs, with a length of 19–25 nucleotides
Recently, research on miRNAs has increased sharply due to the growing awareness of their importance. An altered miRNA expression profile has been related to the developmental lineage and differential tumor states
We integrate and optimize the above current approaches, and present a cost-effective, more convenient, highly sensitive and accurate RT-qPCR method for the quantification of mature miRNA molecules.
A novel RT-qPCR scheme is proposed for the quantification of miRNA (
Real-time quantification of miRNA includes three steps: polyuridylation, RT reaction and real-time PCR. miRNAs are given a poly(U) tail by poly(U) polymerase. The cDNA molecules are reverse transcribed using poly(A) stem-loop RT primers (SL-poly(A)). The primer has 3′ degenerated anchor sequence and 18 nt of As. Such design guarantees an efficient priming of more than 18 nt U tailed miRNA. The miRNA-specific forward primer and the universal reverse primer are complementary to the stem-loop adapter used for the analysis.
The final quantification of miRNA is performed by real-time PCR analysis using the SYBR® Green fluorescence utilizing the 2−ΔΔ
The dynamic range and sensitivity of the scheme were first evaluated using a synthetic miR-32 target. Synthetic microRNA was quantified based on the
(A) Amplification plot of synthetic hsa-miR-32 miRNA. Target input ranged over eight orders of magnitude (0.2 fM–2 nM). (B) Melting curve of the miR-32 assay. Neither the mock RT control, nor the no-template control (NTC) showed a background signal over 40 cycles. (C) Standard curve of miR-32 of the new assay and TaqMan method. Curve of the new assay was a straight line (
As the most widely accepted approach, Chen’s method (TaqMan® small RNA assays) was applied to validate the sensitivity and quantitative of the proposed assay using 50 ng of yeast tRNA spiked with synthetic miR-32 to give final concentrations between 0.2 fM and 2 nM in the RT reaction. Both methods were performed within the same qPCR run. Amplification efficiency of the new approach (0.975) was comparable to the TaqMan assay (0.952), and correlation coefficient (R2) of both method were greater than 0.99 (
Further validation of the exhibited miRNA quantification protocol was obtained by using total RNA from SiHa cells. In this experiment, 1–1000 pg of total RNA was tailed with poly(U) and cDNA was transcribed from the poly(U)-tailed total RNA. The product was used as a template for SYBR® Green real-time PCR. The
Moreover, there had been reports that indicated that the Exiqon miRCURY assay, which also uses poly(A) tailing of the miRNAs, increased specificity utilizing LNA, but lead to a decrease in amplification efficiency
microRNA | proposed assay (%) | miRCURY (%) | difference (%) |
miR-455 | 96 | 93 | 2.8 |
miR-32 | 99 | 91 | 7.9 |
miR-181a | 97 | 89 | 8.1 |
miR-181b | 98 | 91 | 6.8 |
miR-126 | 92 | 87 | 9.2 |
let-7a | 98 | 95 | 3.1 |
let-7b | 90 | 86 | 4.2 |
let-7c | 105 | 88 | 16.7 |
let-7d | 101 | 92 | 9.2 |
let-7f | 94 | 85 | 8.9 |
|
97 (4.3) | 90 (3.2) | 7.7 (4.0) |
Chen
(A) Amplification plot of hsa-miR-32 miRNA from SiHa cell total RNA with and without double-stranded genomic DNA using stem-loop or linear adapter RT primer. (B) Comparison with and without genomic DNA in the two RT reaction systems for real-time quantification of 6 miRNAs. (C) Dissociation curve analysis of the same experiment of panel A. (D) Comparison of heat-treated SiHa cells, heat-treated bone marrow and purified total RNA of bone marrow for real-time quantification of hsa-miR-32 miRNA. (E) Dissociation curve analysis of the same experiment of panel D. (B & D) The level of miRNA expression is measured in the quantification cycle (
For ulterior validation and application, 102–107 cells of the bone marrow samples and SiHa cells wereheat-lysed as described in the Methods, and added directly as the substrate for polyuridination. We found a significant correlation between the
The sequences of the miRNA paralogs are identical except for 1–3 mismatched bases. To evaluate the specificity of our real-time PCR approach, we tested the amplification with primers having perfect complementarity or with 1–3 nucleotides mismatched to the miR-32 sequence (
(A&B) Relative level of PCR products using a mismatched primer compared to the perfectly matched primer in the normal program (annealing temperature 55°C) and in the high-stringency program (annealing temperature 62°C) for amplifying the target hsa-miR-32. Each column represents the mean (± SD) of three measurements. (C&D) Cross-reaction of the human let-7 family assays (annealing temperature 56°C). The percentage of cross-reaction values was calculated based on the
The specificity of the present assay was ulteriorly assessed with inherent miRNA family. The let-7 family is a representative miRNA family with members that have similar sequences. Cross-reaction of five closely sequence-related members of the let-7 family (let-7a, let-7b, let-7c, let-7d and let-7e) differing in at least one nucleotides were employed for further analysis of the proposed approach (
We used a poly(U) tail instead of the usual poly(A) tail, and it provided more convenience and specificity. miRNAs were tailed by poly(U) and lacked the poly(A) tail, and therefore would not anneal to the ordinary oligo(T) RT primer. Conversely, the poly(A) tail of the mRNA was still present, and could bind to the oligo(T) RT primer. To prove the advantage of the U-tailing, we performed a multiplex RT reaction of mRNA and miRNAs within the same run. As shown in
Both mRNA and miRNAs showed no significant difference of
Optimization of the proposed miRNA quantification technique was required for practical applications. As well as experimental validation of the assay, it needed to be validated with biological samples. A miRNA expression map was created with the new assay by detecting the expression of 3 miRNAs in four BARBL/c mouse tissue samples (n = 5). After measuring the expression of the small nuclear RNA (snRNA) U6 as a housekeeping gene, the miRNA data were normalized by calculating the relative 2−ΔΔ
The miRNA expression values were normalized to the snRNA U6 expression data and are calculated with 2−ΔΔ
The miRNAs play a crucial role in several biological processes and act as regulators of development, differentiation
RT-qPCR is a powerful technique for quantifying gene expression in the life sciences and medicine as it is highly sensitive, accurate and simple
Moreover, we used stem-loop RT primer instead of linear adaptor to make sure that this protocol is insensitive to double-stranded nucleic acid molecules. The spatial constraint of the stem-loop structure might prevent the RT primer from binding double-stranded genomic DNA molecules and enhance the thermal stability of the RNA-DNA heteroduplex
The possibility of the lower amplification efficiency with LNA-spiked primers would be supported by differences between the solution structure of a DNA:LNA helix and the structure of double-stranded DNA
In this new assay, we used poly(U) instead of the traditional poly(A) as it can prevent the oligo(A) RT primer from binding the poly(A) tail of the mRNA. The RT reaction can achieve reverse transcription of miRNAs, mRNA and the internal control (U6) from the same sample in the same system, which has the advantage of keeping the identical reaction efficiency. It has been shown that polyuridylation of pre-miRNA might be inefficient due to the presence of the stem-loop structure
The spatiotemporal expression patterns of miRNAs are important for the verification of their predicted function. There is an urgent need for a highly specific and simple method for quantification of miRNA. The proposed approach offers an alternative method for scientists to quantify multiple miRNA expression of the same sample. We are currently improving the approach, which is expected to increase the utility of this method.
The sequences of the 11 microRNA molecules selected for this assay were obtained from the miRBase Sequence Database Release 15 (
Name | Sequence (5′ to 3′) |
hsa-miR-455 | GCAGUCCAUGGGCAUAUACAC |
hsa-miR-126 | UCGUACCGUGAGUAAUAAUGCG |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGCA |
hsa-miR-181a | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181b | AACAUUCAUUGCUGUCGGUGGGU |
hsa-let-7a | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7b | UGAGGUAGUAGGUUGUGUGGUU |
hsa-let-7c | UGAGGUAGUAGGUUGUAUGGUU |
hsa-let-7d | AGAGGUAGUAGGUUGCAUAGUU |
hsa-let-7e | UGAGGUAGGAGGUUGUAUAGUU |
mmu-miR-122 | UGGAGUGUGACAAUGGUGUUUG |
mmu-miR-133a | GCUGGUAAAAUGGAACCAAAU |
mmu-let-7a | UGAGGUAGUAGGUUGUAUAGUU |
cel-miR-2 | UAUCACAGCCAGCUUUGAUGUGC |
real-time PCR primers | |
miR-455-fw |
|
miR-126-fw |
|
miR-32-fw |
|
miR-181a-fw |
|
miR-181b-fw |
|
let-7a-fw |
|
let-7b-fw |
|
let-7c-fw |
|
let-7d-fw |
|
let-7e-fw |
|
mmu-miR122-fw |
|
mmu-miR-133a-fw |
|
miR-2-fw |
|
U6-Fw |
|
miRNA-rev |
|
Reverser transcription primer | |
Linear RT | GCGAGCACAGAATTAATACGACTCACTATAGGACGGCTTTTTTTTTTTTTTTVN |
SL-poly(A) |
Stem-loop sequence is indicated in italic. Binding sequences for universal reverse primer are indicated in italic and bold. miRNA specific sequences of the forward primer are in bold.
hsa-let-7a and mmu-let-7a are highly conservative. They share the same forward primer.
V: A, C and G; N: A, C, G and T.
The human cervical carcinoma cell line SiHa was purchased from the American Type Culture Collection (ATCC, no. CCL-2) and cultured in a humidified atmosphere of 95% air, 5% CO2 using the recommended medium supplemented with 10% (v/v) fetal bovine serum (FBS).
Studies using human tissues were approved by the Institutional Ethical Committee in Chinese PLA General Hospital. The individual in this manuscript has given written informed consent (as outlined in the PLoS consent form) for the use of tissue samples and to publish these case details. All experiments involving animals were undertaken in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals, with the approval of the Scientific Investigation Board of Chinese PLA General Hospital. Total RNA was extracted from the SiHa cell line, bone marrow of leukemia patients, and tissues of mice using TRIzol® reagent (Invitrogen, catalogue no. 15596026) according to the manufacturer’s instructions.
In order to assess the influence of genomic DNA, we used heat-lysed cells as a template for the RT reaction. The cell pellets were re-suspended in 100 µL 1× PBS, heated at 95°C for 5 min, and immediately chilled on ice before being added directly into the RT reaction.
Yeast tRNA was employed as an RNA carrier to provide a complex RNA background in RT reactions. It was purchased from Invitrogen (catalogue no.15401011).
The integrity and purity of the RNA was measured based on electrophoresis traces and A260/A280 value, respectively. RNA extraction was performed by two different operators simultaneously.
Following the manufacturer’s instructions (New England Biolabs, catalogue no. M0337S), 10 ng of total RNA, certain amounts of the corresponding synthetic miRNA with 50 ng yeast tRNA, or heat-lysed cells was polyuridylated with UTP by poly(U) polymerase at 37°C for 1 h in a 20 µL reaction volume. After extraction with phenol/chloroform and precipitation in ethanol, the treated RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water.
Reverse transcription was performed using the M-MLV RT kit (Invitrogen catalogue no. 28025013) according to the manufacturer’s instructions. The RT reaction was performed using treated total RNA and the RT primer SL-poly(A). The 12 µL RT reaction mixture contained 10 ng of treated RNA (or certain amounts of the corresponding treated synthetic miRNA), 0.5 µL of RT primer SL-poly(A) (5 µM) and 0.5 µL of 10 mM dNTP Mix (10 mM each). The mixture was heated at 65°C for 5 min and quick-chilled on ice. The contents of the tube were collected by centrifugation and 2 µL of DTT (0.1 M), 4 µL of 5× first-strand buffer, 1 µL of RNase inhibitor (40 U/µL, Qiagen) were added. The mixture was incubated at 37°C for 2 min, followed by the addition of 1 µL of M-MLV (200 U) and the incubation was continued for 50 min at 37°C. The reaction was inactivated by heating at 70°C for 15 min. The RT reaction was performed in triplicate to remove the RT outliers.
Real-time PCR was performed using the standard SYBR® Green PCR protocol (SYBR® Green Real-time PCR Master Mix, Toyobo, catalogue no. QPK-201) on a Rotor-Gene RG-3000A thermal cycler (Corbett Research), and each sample was analyzed in triplicate. The 20 µL PCR volume included 3 µL of RT product, 10 µL of 2× SYBR® Green real-time PCR Master Mix, and 1 µL of primer (forward and reverse, 5 µM each). The reactions were incubated at 95°C for 5 min, followed by 45 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 20 s. The level of miRNA expression was measured using the
The 2−ΔΔ
(TIF)
We are thankful for all the patients for consenting to provide tissue samples.