The authors have declared that no competing interests exist.
Conceived and designed the experiments: MA MK FH PdJ JAL. Performed the experiments: MA MK FH NS. Analyzed the data: MA MK FH NS PdJ JAL TL JD TW GB. Contributed reagents/materials/analysis tools: MA TL TW NS JD PdJ GB. Wrote the paper: MA MK FH PdJ TL TW JD JAL. Generated and provided essentially virus-free cell cultures, which were necessary to establish RT-PCR for F-sial and F-M04 (data not shown in the manuscript): TW JD.
Current address: Tissue Biology Research Unit, Department of Surgery, University Children's Hospital Zurich, Zurich, Switzerland
Current address: US Fish and Wildlife Service, Dexter Fish Health Center, Dexter, New Mexico, United States of America
The Chelonid fibropapilloma-associated herpesvirus (CFPHV; ChHV5) is believed to be the causative agent of fibropapillomatosis (FP), a neoplastic disease of marine turtles. While clinical signs and pathology of FP are well known, research on ChHV5 has been impeded because no cell culture system for its propagation exists. We have cloned a BAC containing ChHV5 in pTARBAC2.1 and determined its nucleotide sequence. Accordingly, ChHV5 has a type D genome and its predominant gene order is typical for the
The Chelonid fibropapilloma-associated herpesvirus (CFPHV; Chelonid herpesvirus 5, ChHV5) is strongly associated with fibropapillomatosis (FP), a neoplastic disease of marine turtles
While descriptions of the clinical signs, pathology, and pathogenesis of FP are numerous, research on the FP-associated herpesvirus itself has been impeded by the fact that no cell culture system for propagation of ChHV5 exists
The purpose of the research described here was to (1) generate a Bacterial Artificial Chromosome (BAC)
A BAC library was created from the glottis tumor of a Hawaiian green turtle with FP as described in Materials and Methods. With an estimated average insert size of 130 kbp (not counting the pTARBAC sequences), the library covered approximately two turtle genome sizes. Previously published sequences of ChHV5 (AF035003
Designation | oligonucleotide sequence (5′ to 3′) |
UL10-F |
|
UL10-R |
|
UL27F |
|
UL27R |
|
UL28-F |
|
UL28-R |
|
5′-pol |
|
3′-pol |
|
pol-probe |
[6FAM]-CGATGAAAACCGCACCGAGCGA-[TAMRA] |
UL12-OVa |
|
UL12-OVb |
|
32P-dsUL12 probe |
|
UL22-OVa |
|
UL22-OVb |
|
32P-dsUL22 probe |
|
UL30-OVa |
|
UL30-OVb |
|
32P-dsUL30 probe |
|
= PCR primers (F = forward; R = reverse)
= Taqman primers
= Taqman probe
= oligonucleotide for hybridization (overlapping variants a and b were used to generate 32P-labeled probes
= double stranded probe
Apart of the pTARBAC sequences, BAC CH-651-60O9 comprised a total of 132.233 bp of DNA, which could be divided into a unique long sequence (UL; 101.152 bp), a unique short sequence (US; 13.319 bp), and inverted repeat sequences (IRS; 8.831 bp each), which flanked the US sequence. Thus, the cloned ChHV5 sequences presented themselves in the configuration of a herpesvirus Type D genome, such as it is found in the genus
The linearized, double stranded map, drawn to scale, shows the Repeat Sequences (TRS and IRS) in brown, the Unique Sequences (US and UL) in grey, and the predicted open reading frames (ORFs) in yellow. The relative orientation of each ORF is symbolized in the direction of its arrow shape. The ORF designations and the scale refer to the information provided in
Analysis of the repeated sequences revealed 12 ORFs with more than 40 codons, which encoded for 15 different potential proteins (
Designation | Map position | Predicted Features |
HP1/HP1′ | F(163..570)/C(26563..27591) | Secretory pathway; transmembrane region |
F-LANA/F-LANA′ | F(3391..4416)/C(26563..27591) | Nuclear localization; N-terminal DNA-binding domain |
F-ICP0/F-ICP0′ | F(6387..7202)/C(23780..24595) | Similar to TAF9 RNA polymerase II; Nucleotidylylation signature |
HP4/HP4′ | F(6484..7146)/C(23836..24498) | Hypothetical protein; ORF overlapping with F-ICP0 |
HP6/HP13 | F(8063..8833)/C(22137..22919) | Nuclear localization; ORFs extending into US; N-terminally identical proteins |
HP7/HP11 | F(8349..8900)/C(22118..22633) | Nuclear localization; ORFs overlapping with HP6/13 and extending into US; N-terminally identical proteins |
LF3-like/LF3-like′ | C(12..1916)/F(29066..30970) | Leucine Zipper motif; C-termianl RNA-binding domain; similar to LF3 of Cercopithecine herpesvirus 15; nuclear localization; |
F-ICP4a/F-ICP4a′ | C(86..2041)/F(28941..30896) | Nuclear localization; remote similarity to ICP4; Nucleotidylylation signature |
HP2/HP2′ | C(3693..4373)/F(26609..27289) | Similarity to germ line helicase; overlapping F-LANA on the opposite strand |
HP3/HP3′ | C(4782..5105)/F(25877..26200) | Putative membrane protein; transmembrane helix: aa 33–55 |
HP5/HP5′ | C(7007..7543)/F(23439..23975 | Secretory pathway; transmembrane region: aa 10–27 |
HP8/HP12 | C(8289..8831)/F(22127..22693) | Nuclear localization; products identical within C-terminus |
Eleven ORFs were identified within the US sequence, 5 in one direction and 6 in the opposite direction (
Designation | Map position | Predicted Features |
F-US11 | F(10382..11209) | Nuclear localization |
F-US10 | F(11140..12168) | Similarity to virion protein US10 of Anatid herpesvirus 1 |
HP9 | F(12238..12642) | RGRG Proteasomal degradation domain |
F-US2 | F(18137..19027) | Ser/Arg-rich protein |
F-US1 | F(19204..22140) | Secretory pathway; Signal sequence; transmembrane region |
F-US12 | C(9293..10345) | Nuclear localization; N-terminal RNA-binding domain; similarity to RNA-binding splicing factor |
F-US8 | C(12223..13842) | Glycoprotein E (gE); signal sequence; transmembrane region |
HP10 | C(14015..14482) | Nuclear localization; leuzine-rich |
F-US4 | C(14752..15549) | Glycoprotein; signal sequence; transmembrane region; IG_like domain; a |
F-US3B | C(15650..16591) | Similarity to US3 serine/threonine protein kinase US3 (PK) and to cyclin-dependent kinase 2 |
F-US3A | C(16566..17714) | Similarity to US3 PK and catalytic domain of the Protein Serine/Threonine Kinase |
Although none of the predicted proteins showed direct homology to the immediate early proteins 22 or 27, several candidates were detected, for which nuclear localization was predicted. For example, an N-terminal RNA-binding domain and similarity to RNA-binding splicing factor was predicted for F-US12, which might, therefore, contribute similar functions as either ICP27 or ICP22 of other alphaherpesviruses.
The UL sequence was mostly collinear to the genomes of typical alphaherpesviruses. 76 ORFs were identified within the UL sequence, 40 in the forward direction and 36 in the opposite direction (
Designation | Map position | Predicted features |
F-UL0.5 | c(32683..33594) | Putative nuclear protein |
F-UL01 | 34789..35169 | Glycoprotein L (gL) |
F-UL02 | 35138..35980 | Uracil DNA glycosylase (UDG) |
F-UL03 | 36025..36708 | Nuclear phosphoprotein |
F-UL04 | c(37192..37779) | Nuclear protein |
F-UL05 | c(37823..40357) | Putative component of DNA helicase/primase complex; helicase signature |
HP14 | 38921..39544 | Similarity to hypothetical protein of Gallid herpesvirus 1 |
F-UL06 | 40356..42338 | Putative capsid portal protein |
HP15 | 41039..41554 | Hypothetical nuclear protein |
F-UL07 | 42211..43125 | Herpes_UL7 superfamily |
F-UL08 | c(43118..45361) | Putative UL8 Herpesvirus DNA helicase/primase complex associated protein |
F-UL09 | c(45306..47780) | Putative Origin-binding protein; Domain: DEAD-like helicases superfamily; ATP binding site on conserved domain DEXDc; putative Mg++ binding site on conserved domain DEXDc. |
F-UL10 | 47779..49044 | Glycoprotein M (gM); 99% identical to AAU84515.1 in GenBank |
F-UL11 | c(49134..49418) | Putative myristylated protein |
F-UL12 | c(49325..51004) | 99% identity with gb|AAU84516.1| UL12 [Fibropapilloma-associated turtle herpesvirus]; YqaJ-like viral recombinase domain; herpesvirus alkaline exonuclease |
HP16 | 50429..51067 | Hypothetical protein; predicted bipartite NLS |
F-UL14 | c(51058..51594) | 96% identity with gb|AAU84517.1| UL14 [Fibropapilloma-associated turtle herpesvirus] |
F-UL15A | 51593..52606 | Probable DNA packing protein, N-terminus; 97% identity with gb|AAU84518.1| UL15A [Fibropapilloma-associated turtle herpesvirus] |
F-UL16 | c(52618..53673) | 97% identical to gb|AAU84520.1| UL16 [Fibropapilloma-associated turtle herpesvirus]; herpesvirus UL16/UL94 family; capsid maturation, DNA packaging/cleavage. |
F-UL17 | c(53613..55568) | DNA packaging tegument protein; Multi domain PFAM: pfam04559, herpesvirus UL17 protein; 96% identity to gb|AAU84521.1| UL17 [Fibropapilloma-associated turtle herpesvirus] |
F-UL15B | 55718..56788 | Probable DNA packing protein, C-terminus; 99% identity to gb|AAU84519.1| UL15B [Fibropapilloma-associated turtle herpesvirus] |
HP17 | 57297..57764 | Hypothetical protein |
HP18 | 58434..59129 | Unknown Protein; Similarity to protein RL5A [Human herpesvirus 5] gb|AAO48775.1| |
HP19 | 58933..59415 | Hypothetical protein; E value: 0.035: gb|AAR31234.1| protein RL6 [Human herpesvirus 5] |
HP20 | 59950..60450 | Hypothetical protein; E value 0.017: U54 HHV6B; ref|NP_050235.1| Gene info linked to NP_050235.1 virion transactivator [Human herpesvirus 6] |
F-UL18 | c(60772..61764) | 99% identity to UL18 [Fibropapilloma-associated turtle herpesvirus] gb|AAU84522.1|; VP23 “capsid triplex subunit 2” |
F-UL19 | c(61835..65986) | Major capsid protein; 99% identity to gb|AAU84523.1| major capsid protein [Fibropapilloma-associated turtle herpesvirus] |
F-UL20 | c(66072..66701) | 100% identical with gb|AAU84524.1| UL20 [Fibropapilloma-associated turtle herpesvirus]; Herpesvirus egress protein UL20; 5 TM helices predicted |
F-UL21 | 66784..68187 | 85% identity with gb|AAU84525.1| UL21 tegument protein [Fibropapilloma-associated turtle herpesvirus] |
F-UL22 | c(68248..70485) | Putative glycoprotein H (gH); 98% identity to gb|AAU84526.1| glycoprotein H [Fibropapilloma-associated turtle herpesvirus]; predicted features: signal sequence; 4 N-gly sites; transmembrane helix |
F-UL23 | c(70555..71637) | 98% identity to gb|AAU84527.1| thymidine kinase [Fibropapilloma-associated turtle herpesvirus]; C-terminal extension relative to gb|AAU93321.1| thymidine kinase [Hawaiian green turtle herpesvirus] |
F-UL24 | 71586..72527 | PFAM: cl03293 [Superfamily] cl03293, Herpes virus protein UL24; 100% identity with gb|AAU93322.1| membrane-associated protein [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84528.1| UL24 [Fibropapilloma-associated turtle herpesvirus] |
F-UL25 | 72184..73857 | 99% identity with gb|AAU93323.1| minor capsid protein [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84529.1| UL25 [Fibropapilloma-associated turtle herpesvirus] |
HP21 | c(72282..72755) | Hypothetical protein; predicted NLS |
F-UL26 | 73935..75584 | Putative UL26 capsid maturation protease"; 100% identity with gb|AAU93324.1| capsid maturation protease [Hawaiian green turtle herpesvirus]; 99% identity with gb|AAU84530.1| UL26 [Fibropapilloma-associated turtle herpesvirus] |
F-UL26.5 | 74703..75584 | Putative UL26.5 virion scaffolding protein; 100% identity with gb|AAU93325.1| virion scaffolding protein [Hawaiian green turtle herpesvirus] |
F-UL27 | c(75736..78291) | Glycoprotein B (gB); 100% identity with gb|AAU93326.1| virion membrane glycoprotein B [Hawaiian green turtle herpesvirus]; 99% identity with gb|AAU84531.1| glycoprotein B [Fibropapilloma-associated turtle herpesvirus]; predicted features: signal peptide; 3 transmembrane helices |
HP22 | 76522..77211 | Hypothetical protein |
HP23 | 77350..78219 | Limited similarity to C3 Complement C3 precursor protein |
F-UL28 | c(78288..80540) | ICP18.5; 99% identity with gb|AAU93327.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] |
F-UL29 | c(80728..84312) | Putative UL29 single-stranded DNA binding protein [Green turtle herpesvirus]; [Superfamily] cl09516, ssDNA binding protein; 99% identity with gb|AAQ67362.1| single-stranded DNA binding protein [Green turtle herpesvirus] |
HP24 | 83548..84489 | 6-phosphofructokinase-like hypothetical protein; NLS predicted |
F-UL30 | 84473..87925 | Putative DNA polymerase catalytic subunit [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84534.1| polymerase [Fibropapilloma-associated turtle herpesvirus] |
F-UL31 | c(87852..88775) | [Superfamily] cl14325, nuclear egress lamina protein UL31; 99% identity with gb|AAU93329.1| nuclear phosphoprotein [Hawaiian green turtle herpesvirus] |
F-UL32 | c(88768..90408) | 100% C-terminal identity with gb|AAU93330.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus |
F-UL33 | 90371..90706 | DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] (Quackenbush et al., Virology 246 (2), 392-399 (1998); 100% identity with gb|AAU93331.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] |
F-UL34 | 90719..91513 | 100% identity with gb|AAU93332.1| UL34 membrane-associated phosphoprotein [Hawaiian green turtle herpesvirus] |
F-UL35 | 91561..91926 | 100% identity with gb|AAU93333.1| VP26 basic phosphorylated capsid protein [Hawaiian green turtle herpesvirus] |
F-UL36 | c(91944..98897) | PFAM: [Superfamily] cl04174, Herpesvirus UL36 VP1/2 tegument protein; This family only covers a small central part of this large protein. |
F-UL37 | c(98897..102139) | PFAM: [Superfamily] cl04350, Herpesvirus UL37 tegument protein; closest similarity to gb|AAY59063.1| small tegument protein [Tortoise herpesvirus] |
F-UL38 | 102138..103463 | PFAM: [Superfamily] cl04010, Herpesvirus capsid shell protein VP19C; closest similarity to gb|AAY59064.1| minor capsid protein [Tortoise herpesvirus] |
HP25 | 102623..103132 | Hypothetical protein with predicted bipartite NLS |
F-UL39 | 103441..103923 | Partial similarity to gb|AAQ73541.2| ribonucleotide reductase large subunit [Tortoise herpesvirus] |
F-UL41 | c(104719..105897) | Closest similarity to gb|AER28066.1| tegument host shutoff protein [Gallid herpesvirus 1]; PFAM: cd09867, PIN domain of Flap Endonuclease-1, a structure-specific, divalent-metal-ion dependent, 5′ nuclease and homologs. |
F-UL42 | 105949..107025 | DNA polymerase processivity factor; similarity to ref|NP_944415.1| DNA polymerase processivity subunit [Psittacid herpesvirus 1]; |
F-UL43 | 107061..108287 | Similarity to gb|AEI00251.1| UL43 protein [Gallid herpesvirus 3] |
HP26 | c(107196..107687) | Hypothetical protein |
HP27 | 108437..109090 | Hypothetical protein of 217 aa with at least two Zink-binding domains identified; similarity to ref|YP_001285929.1| protein IG [Psittacid herpesvirus 1] |
F-UL53 | c(109136..110197) | PFAM: [Superfamily] cl03284, UL53 cell fusion glycoprotein K; highest blast scores with envelope glycoprotein gK gK of psittacid herpesvirus 1, anatid-, felid1, gallid3, equid4 herpesviruses; 6 transmembrane helices predicted |
F-UL52 | c(110214..113087) | PFAM: [PHA03180], UL52 helicase-primase primase subunit; similarity to gb|AAG30093.1|AF282130_56 DNA helicase/primase complex protein [Meleagrid herpesvirus 1] |
HP28 (UL55) | 113179..113805 | Limited similarity to UL55 on aa level; E-value 93–04 similarity to ref|YP_443903.1| nuclear protein UL55 [Papiine herpesvirus 2] |
HP29 | c(113896..114384) | Hypothetical protein |
F-M04 | c(114874..115683) | Similarity to emb|CAJ84726.1| m04 protein [Murid herpesvirus 1]; m04 proteins are known to mediate immune evasion by interference with the major histocompatibility complex class I (MHC-I) pathway of antigen presentation to cytolytic T lymphocytes. Instead, the m04 early gene product binds to folded MHC-I molecules in the ER and directs the complex to the cell surface; two transmembrane helices predicted |
HP30 | c(116252..116788) | Hypothetical protein; ORF may N-terminally extend for up to 46 aa; similarity to emb|CAC85009.1| hypothetical protein [Saimiriine herpesvirus 2]; predicted features: signal sequence, transmembrane helix; N-glycosylation site at pos. 40 NFTL |
F-lec1 | 117032..117658 | Probable start codon GGC; PFAM: cl02432 [Superfamily] cl02432, C-type lectin (CTL)/C-type lectin-like (CTLD) domain; CLECT: C-type lectin (CTL)/C-type lectin-like (CTLD) domain; PFAM: cd03593, C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); CLECT_NK_receptors_like: C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); transmembrane helix predicted |
F-lec2 | 117767..118297 | Alternative AAA-start codon at position −57; similar to type II membrane protein CD69 [Equus caballus]; E-value: 5e-09: “C-type lectin domain family (poxviruses)”; PFAM: cd03593, C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); CLECT_NK_receptors_like: C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); E value 1e-10: dbj|BAG69470.1| c-type lectin-like receptor [Gallus gallus]; transmembrane helix predicted |
F-sial | 118474..119433 | Similarity to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase (mus musculus); PFAM: cl02965 [Superfamily] cl02965, Glycosyltransferase family 29 (sialyltransferase) ; E value 6e-70: emb|CAB53395.1| Gal(beta)1,3/4-GlcNAc (alpha)2,3-sialyltransferase [Mesocricetus auratus]; transmembrane helix predicted |
F-Nec2 | c(120491..122230) | Similarity to CD155 (poliovirus receptor) and CD112 (Nectin-2); E-value: 0.016 with glycoside hydrolase family 5 [Eubacterium cellulosolvens 6]; signal sequence predicted |
HP31 | 120755..121279 | Hypothetical protein with similarity to Tau-tubulin kinase 1; E-value: 0.034 |
HP32 | c(122359..124044) | Hypothetical V-set protein; pfam07686, Immunoglobulin V-set domain; Signal sequence predicted |
HP33 | 124921..125382 | Hypothetical protein |
HP34 | 126003..126476 | Hypothetical protein |
HP35 | c(127044..128483) | PFAM: cl02885 [Superfamily] cl02885, heptad repeat 1-heptad repeat 2 region (ectodomain) of the transmembrane subunit of various endogenous retroviruses (ERVs) and infectious retroviruses; signal sequence and transmembrane helix predicted |
HP36 | c(128486..128938) | Hypothetical protein; PFAM: [Superfamily] cl11403, Cellular and retroviral pepsin-like aspartate proteases. |
HP37 (ICP4c) | c(128969..131062) | Hypothetical protein with limited similarity to ICP4 stretching over several domains; predicted features: several NLS, DNA- and RNA-binding domains |
HP38 (ICP4b) | c(130312..131055) | Hypothetical protein with similarity to ICP4s over several regions; predicted features: C-terminal RNA-binding domain; mitochondrial targeting peptide |
According to the sequence determination, the pTARBAC sequences had inserted into an EcoRI site within the F-UL52 open reading frame. With parts of UL52 flanking the insertion, it was assumed that the BAC comprised the entire viral genome. However, while conventional UL genes extended on one side of the UL52 ORF, we detected on the other side of the same gene a row of ORFs that were rather unexpected in the context of an alphaherpesvirus genome (
(A) A double stranded map of the atypical ChHV5 sequences is shown, anchoring in F-UL52. The arrows indicate relative length and orientation of each ORF; yellow ORFs were object of further analysis in this study; numbers refer to the nucleotide count in the forward orientation. EcoRI sites as well as predicted TATA- and GATA-boxes are indicated. The pTARBAC vector in BAC CH-651-60O9 (not shown) was integrated at the EcoRI site within F-UL52. (B) PCR amplification using the primer pairs (see
Designation | oligonucleotide sequence (5′ to 3′) |
P1F |
|
P2R |
|
P3F |
|
P4R |
|
P5R |
|
P6F |
|
P7F |
|
P8R |
|
P12R |
|
P13F |
|
P16R | GGGGACCACTTTGTACAAGAAAGCTGGGTT |
P17F |
|
P18R |
|
P19F |
|
= PCR primers (F = forward; R = reverse)
= this primer consists of a binding part (bold) and is fused to a 5′-att-recombination sequence. The latter part of the primer was not required for the present experiment but was, nevertheless, part of the primer.
In a first approach to address this, overlapping PCR, starting from within UL52, was performed. DNA from tumor materials of independent FP-cases was used as template, while BAC CH-651-60O9 DNA and DNA from unaffected tissue of the same turtles served as controls. The primers used are given in
Ethidium bromide stained agarose gels with the PCR products are shown. (A) PCR products generated with DNA from FP-related tumors as template. The primer pairs used for amplification of each product are indicated below the corresponding lane; M: size marker with specific band sizes provided at the left. For expected sizes of the amplification products in lanes 1 through 7, see
Together, these data strongly suggest that these unconventional genes are actually part of the ChHV5 genome. They also support the notion that the BAC CH-651-60O9 comprises the entire genomic DNA of ChHV5.
Tumor as well as matching normal tissue from fresh cases of FP was collected and RNA was extracted for RT-PCR as described in materials and methods. The primers used for this experiment, designed to target either the F-sial- or the F-M04-gene, are listed in
RNA extracted from fresh tumors as well as from corresponding normal tissue was subjected to RT-PCR as described in materials and methods and the amplification products were separated on a 1%agarose gel. (
Designation |
oligonucleotide sequence (5′ to 3′) |
Att-SiaF |
|
P16R |
|
Att-M04F |
|
M04R-att |
|
= these primers were also used to amplify and clone (for sequence determination) the Australian isotypes of F-M04 and F-sial
= PCR primers (F = forward; R = reverse)
= each primer consists of a binding part (bold) and is fused to a 5′-att-recombination sequence. The latter part of the primer was used for consecutive cloning and sequencing of the amplification product into a Gateway donor vector.
While it is almost standard procedure to clone BACs from replication competent herpesviruses, this is, to our knowledge, the first time that a genomic herpesvirus BAC has been created directly from infected tissue and in the absence of any means to propagate the agent in culture
The nucleotide sequence determination of the BAC revealed that the overall structure of the cloned molecule corresponded in its size (132.233 bp) and configuration (TRS-US-IRS-UL) to a Type D genome, which is typical for members of the
A P-BLAST search of the predicted F-UL52 translation product suggested a relationship to UL52 proteins from various animal alpha herpesviruses, including equid (EHV1), bovid (BoHV1), suid (SuHV1), melagrid (MeHV1), and gallid (GaHV1, 2, 3) herpesviruses. A more distant relationship to beta herpesviruses was also revealed, for example to human (HCMV) and chimpanzee (PaHV2) cytomegaloviruses. Upon alignment and tree-formation of the UL52 aa sequences using the neighbor joining algorithm, the newly discovered F-UL52 species emerged on the same branch as bovid and suid alphaherpesviruses and cytomegaloviruses whereas avian alphaherpesviruses clustered on a different branch (
Upon pairwise comparison of the individual aa sequences (
There is considerable variation in aa length of UL52 of herpesviruses. Alphaherpesvirus UL52s range from 962 to 1124 aa, whereas Betaherpesviruses have much smaller UL52 homologs (640 to 668 aa). With a predicted size of 957 aa, the F-UL52 was closer in size to the UL52s of the alphaherpesviruses and may explain in part the topology of the UL52 phylogenetic tree (
In summary, F-UL52 has a distant but distinct relationship to UL52 of the
To our knowledge, this is the first time that sequences extending to the US fragment of ChHV5 and its flanking repeats are reported. Two very interesting features were observed in the sequence of the ChHV5 US fragment. First, two individual genes (F-US3A and F-US3B), sharing absolutely no apparent sequence homology between each other, were detected, both of which appeared to encode for a herpesvirus protein kinase. Conventionally, the US3 gene encodes for a protein kinase (PK) that is characteristic for the
While in our sequence determination the TRS and IRS sequences
Interestingly, a series of genes was present in our BAC-cloned DNA molecule that may be atypical for alphaherpesviruses but each one of them has well defined homologues in the genomes of beta- or gammaherpesviruses. None of these gene products is known to have an essential role in viral replication. However, each one apparently plays a biological relevant role in either pathogenesis or immunedeviation. One of these (F-M04), has only been described in beta herpesviruses, while another (F-sial) has been found in a gammaherpesvirus (BoHV4), in other virus families like poxviruses and baculoviruses, and also in host cells
Overall, these observations suggest that ChHV5 may combine features of not only the
According to the predicted amino acid (aa) sequences both of these putative proteins are type II membrane proteins and carry the signature of the C-type lectin-like domain superfamily (reviewed in
To our knowledge, ChHV5 is the first virus detected to carry at least two separate genes coding for this type of host-like proteins. Notably, a TATA box was observed in the presumed promoter region of F-lec1 (less than 50 bp upstream of the ATG). In contrast, the F-lec2 gene was preceded with a GATA box in its presumed promoter region. Interestingly, the GATA box had been reported as a functional feature from within the promoter of the RCMV lectin gene
According to the predicted aa sequence, the putative ChHV5 M04 (F-M04) protein is a type I membrane protein with signal sequence (aa 1–24), an extracellular domain (aa 25–230, a transmembrane region (aa 231–253), and a cytoplasmic tail (aa 254–270). Furthermore, at least one N-glycosylation site (N53) and an O-glycosylation site (S37) can be predicted on its ectodomain. Furthermore, a motif-scan revealed a COX2 domain (aa 54–63), an Ig- and MHC-signature (aa 180-186), and a BPD-transp-1-domain (aa 227–262; Binding-protein-dependent transport system inner membrane component). Many of those features are typically found on M04 proteins. Moreover, the predicted size of F-M04 (270 aa) matches nicely into the typical M04 size pattern, which ranges from 256 aa to 271 aa. However, alignment of F-M04 aa sequence (
In MCMV, M04 has been shown to associate with MHC-I molecules and to travel in their company to the cell surface, where the complex may serve as a decoy for preventing effective NK activity
According to the predicted aa sequence, the putative F-sial (
Sialyltransferases are important in viral pathogenesis (reviewed in
Viral sialyltransferases have been reported to glycosylate not only proteins (poxviruses and bovine gamma herpesvirus 4, BoHV-4) but also ecdysteroid hormones (baculoviruses) and DNA (bacteriophages). In each of those examples, the viral glycoslytransferase seems to play an important biological role. While bacteriophages are able to switch their serotype as a result of the viral glycosyltransferase activity, insect molting, and pupation is inhibited because of the baculovirus encoded glycosyltransferase. The only herpesvirus that is currently known to encode a sialyltransferase, BoHV-4, apparently gains a great survival advantage by possessing this gene in its repertoire. Descendents from this relatively modern virus are found worldwide, whereas the glycosyltransferase-less progenitor has been extinguished
One may argue that our approach to generate the ChHV5 BAC clone is tainted with undesirable drawbacks. Due to restriction enzyme digestion and ligation, fragment(s) of the viral genome may be lost and non-viral sequences may be integrated into the final construct. Depending on the site of the pTARBAC insertion, there is also the possibility that the emerging BAC clone may not be infectious. Indeed, this third
In conclusion, we provide new sequence information about ChHV5, which likely covers the entire viral genome. Interestingly, a series of genes was detected throughout this work that are very uncommon for a candidate member of the alphaherpesviruses. While transcripts of selected viral genes that are known to be active during herpesvirus replication were not detected in RNA extracts from tumor tissue, at least two of the newly detected ChHV5 genes, i.e. F-M04 and F-sial, were not merely present but rather expressed in the tumors. This observation suggests that they indeed may play a role in the pathogenesis of FP. Due to their predicted biological activities, it may be speculated F-sial might be involved in tumor formation, whereas F-M04 might protect the infected cells from NK cell activity. The latter notion might imply that MHC-I presentation is also affected in the tumors, which then would interfere with the successful development of anti-tumor vaccines.
All samples were taken post mortem from animals with terminal FP. DNA for BAC cloning was extracted from a glottis tumor of a green turtle (
For the determination of the viral DNA load in turtle tissues, the method of Quackenbusch
A sample from the frozen glottis tumor of a green turtle was ground under liquid nitrogen using mortar and pestle, resuspended in CIB buffer (20 mM NaCl, 80 mM KCl, 15 mM Tris-HCl, 0.5 mM EGTA, 2 mM EDTA, 0.2 mM Spermine, 0.5 mM Spermidine, 18 mM β-Mercaptoethanol, pH 7.2) and homogenized using a Dounce homogenizer. The resulting cell and tissue suspension was mixed with 1% InCert agarose (Cambrex) for high molecular weight DNA extraction. The agarose embedded DNA was partially digested with a combination of EcoRI restriction enzyme and EcoRI methylase before being size fractionated by pulsed-field electrophoresis. DNA fragments from the appropriate size fraction were cloned into the pTARBAC2.1 vector
Overlapping oligonucleotides UL12-OVa and UL12-OVb (
DNA sequencing was performed using the di-deoxy chain termination sequencing method on a shotgun library approach using pCR4bluntTopo (Invitrogen). Plasmid subclones were cycle-sequenced with Big-Dye terminator version 1.0 reagents (Applied Biosystems) and analyzed on a MegaBace 1000 sequencer (Amerham Biotech) or a ABI 377 sequencer (Applied Biosystems). Computer-assisted assembly was done with Lasergene SeqMan (DNASTAR Inc.).
Between 80 and 160 ng of DNA were used per PCR reaction. DNA was amplified with the primers listed in
Between 100 and 200 ng of RNA was used as template for the BioScript OneStep RT-PCR (Bioline, Staunton, MA). The RT-PCR mix contained the primers (
(TIF)
(TIF)
F-UL52 pairwise alignment. The accession numbers for the sequences used are Swiss-Prot: P28962.1 (EHV1); Q6X264 (BoHV5); Q65817 (BoHV1); Q5PP97 (SuHV1); Q85228 (SuHV1, Kaplan strain); A8T7D0 (HCMV); Q8QS36 (PaHV2); Q2QBC3 (CeHV16); Q9YZA1 (ILTV); Q782P1 (GaHV3); Q9E6M4 (GaHV2); Q9IBS6 (GaHV1); Q9DGY9 (MeHV1); B4XS04 (AnHV1). Taxonomic information.
(XLSX)
F-lec pairwise alignment. The accession numbers for the sequences used are: XM_001499388 (EqCD69); P24765(VV-A40); AF302184 (RCMV lectin); AAC28421 (ASFV-8CR). Abbreviations: Eq, equine, horse; VV, vaccinia virus, reference strain WR; RCMV, rat cytomegalovirus; ASFV, african swine fever virus.
(XLSX)
F-M04 pairwise alignment. Swissprot accession numbers are indicated in the leftmost column. Regarding the variability of m04 in MCMV, see Corbett AJ et al. (2007). Extensive sequence variation exists among isolates of murine cytomegalovirus within members of the m02 family of genes. J Gen Virol 88: 758–769.
(XLSX)
F-sial pairwise alignment. The accession numbers for the sequences used are: M35027 (Rabbit Fibroma virus); U46577.1 (Myxoma virus); NC_006967.1 (Deerpox virus); XM_417860.2 (Gallus gallus); NM_006278.1 (Homo sapiens); Q9IZK2 (BoHV4); Q7YQE1 (Bos taurus); M96361.1 (Baculovirus); A4ZUA5 Ampullavirus; A93469.1 (Fowl adenovirus).
(XLSX)
The University of Zurich gave leave to MA in order to work periodically at the Hawaii Institute of Marine Biology, University of Hawaii, Kaneohe, HI, USA. The authors thank Dres. Graham Burgess and Ellen Ariel (James Cook University, Townsville, QL, Australia) for their generous gift of Australian FP tissue.