Conceived and designed the experiments: XW FT GG. Performed the experiments: XW FT YZ. Analyzed the data: XW FT GG. Contributed reagents/materials/analysis tools: YZ. Wrote the paper: XW GG.
The authors have declared that no competing interests exist.
The zinc-finger antiviral protein (ZAP) is a host factor that specifically inhibits the replication of certain viruses, including Moloney murine leukemia virus (MoMLV), HIV-1, and certain alphaviruses and filoviruses. ZAP binds to specific viral mRNAs and recruits cellular mRNA degradation machinery to degrade the target RNA. The common features of ZAP-responsive RNA sequences remain elusive and thus whether a virus is susceptible to ZAP can only be determined experimentally. Xenotropic murine leukemia virus-related virus (XMRV) is a recently identified γ-retrovirus that was originally thought to be involved in prostate cancer and chronic fatigue syndrome but recently proved to be a laboratory artefact. Nonetheless, XMRV as a new retrovirus has been extensively studied. Since XMRV and MoMLV share only 67.9% sequence identity in the 3′UTRs, which is the target sequence of ZAP in MoMLV, whether XMRV is susceptible to ZAP remains to be determined.
We constructed an XMRV-luc vector, in which the coding sequences of Gag-Pol and part of Env were replaced with luciferase-coding sequence. Overexpression of ZAP potently inhibited the expression of XMRV-luc in a ZAP expression-level-dependent manner, while downregulation of endogenous ZAP rendered cells more sensitive to infection. Furthermore, ZAP inhibited the spreading of replication-competent XMRV. Consistent with the previously reported mechanisms by which ZAP inhibits viral infection, ZAP significantly inhibited the accumulation of XMRV-luc mRNA in the cytoplasm. The ZAP-responsive element in XMRV mRNA was mapped to the 3′UTR.
ZAP inhibits XMRV replication by preventing the accumulation of viral mRNA in the cytoplasm. Documentation of ZAP inhibiting XMRV helps to broaden the spectrum of ZAP's antiviral activity. Comparison of the target sequences of ZAP in XMRV and MoMLV helps to better understand the features of ZAP-responsive elements.
The zinc-finger antiviral protein (ZAP) was initially recovered as a host factor that inhibits Moloney murine leukemia virus (MoMLV) infection
Analyses for the step at which ZAP blocks MoMLV replication reveal that ZAP prevents viral mRNA accumulation in the cytoplasm without affecting the formation and nuclear entry of the viral DNA
Whether a virus is sensitive to ZAP seems to be determined by the presence of ZAP-responsive element (ZRE) in the viral mRNA. The ZRE in MoMLV was mapped to the 3′UTR and the ZREs in SINV were mapped to multiple fragments
Xenotropic murine leukemia virus-related virus (XMRV), a γ-retrovirus, was originally thought to be involved in prostate cancer in a cohort of patients lacking a functional RNaseL gene
In this report we show that human ZAP inhibits XMRV infection by preventing the accumulation of viral mRNA in the cytoplasm.
Due to the similarity between XMRV and MoMLV, we speculated that ZAP might inhibit XMRV by the same mechanism as it inhibits MoMLV. To facilitate sample handling and detection of viral infection, we constructed an XMRV vector carrying the firefly luciferase reporter gene. Since ZAP inhibits the expression of MLV-luc vector, the XMRV reporter was generated in a similar manner as constructing MLV-luc
(A) Schematic structure of XMRV-luc vector. The coding sequences of Gag-Pol and part of Envelope were replaced with luciferase-coding sequence to generate pXMRV-luc. (B) Overexpression of hZAP inhibits XMRV-luc infection. 293TRex cells expressing hZAP-v1-myc and hZAP-v2-myc upon tetracycline induction were infected with VSV-G pseudotyped XMRV-luc. Cells were equally divided into two dishes at 6 h postinfection, with one mock treated and the other treated with tetracycline. Cells were lysed and luciferase activity was measured at 48 h postinfection (upper panel). The luciferase activity in the absence of ZAP was set as 100. Data presented are means ± SD of three independent experiments. The expression of hZAP was confirmed by Western blotting (lower panel). (C) ZAP inhibits XMRV-luc in an expression-level-dependent manner. 293TREx-hZAP-v2 cells were infected with XMRV-luc. At 6 h postinfection the cells were equally split and tetracycline was added to the concentrations indicated. Cells were lysed and luciferase activity was measured at 48 h postinfection. Fold inhibition was calculated as the luciferase activity in mock treated cells divided by the luciferase activity in the tetracycline treated cells (upper panel). Data presented are means ± SD of three independent experiments. The expression levels of hZAP-v2 were measured by Western blotting (lower panel). (D) ZAP inhibits XMRV replication. 293Trex-hZAP-v2 Cells were infected with XMRV produced in 293T cells. At 8 h postinfection, cells were mock treated or treated with doxycycline to induce hZAP-v2 expression. Samples were taken every day and subjected to RT assays.
There are two forms of human ZAP (hZAP) arising from alternative splicing, which differ only at the C-terminal domain
To assess whether ZAP's inhibitory effect on XMRV-luc is dependent on the expression level of ZAP, hZAP-v2 expression was induced by increasing concentrations of tetracycline. With the increasing expression level of hZAP-v2, fold inhibition of hZAP-v2 against XMRV-luc increased accordingly (
To test whether ZAP is able to inhibit the replication of XMRV, replication-competent virus was produced by transfecting XMRV proviral DNA into HEK 293T cells. 293Trex-hZAP-v2 cells were infected with XMRV, followed by treatment of the cells with doxycycline to induce ZAP expression. Virus spreading was monitored by measuring reverse transcriptase (RT) activity in the cell culture supernatants. In the absence of ZAP expression, the peak RT activity was detected at 10 days postinfection (
To test whether endogenous hZAP inhibits XMRV-luc, HOS cells were transfected with siRNAs directed against hZAP (ZAPi-1 and ZAPi-2) to downregulate endogenous ZAP expression, and then challenged with XMRV-luc. The ZAP mRNA levels were downregulated by about 60% (
HOS cells were transfected with control siRNA (Ctrl) or siRNAs directed against hZAP (ZAPi-1 and ZAPi-2), followed by infection with XMRV-luc for 5 h. At 48 h postinfection, cells were lysed. (A) Endogenous hZAP mRNA levels were measured by real-time PCR. (B) Luciferase activity was measured and presented as relative light units (RLU). Data presented are means ± SD of three measurements.
ZAP has been demonstrated to inhibit MoMLV infection by promoting viral mRNA degradation in the cytoplasm without affecting the formation and nuclear entry of the viral DNA
To analyze whether hZAP promotes XMRV mRNA degradation, 293Trex-hZAP-v2 cells were infected with XMRV-luc and cultured for an extensive period of time to establish stable infection. ZAP expression significantly inhibited XMRV-luc expression (
293TRex-hZAP-v2 cells harbouring XMRV-luc provirus were mock treated or treated with 1μg/ml tetracycline for 48 h to induce ZAP expression. (A) Cells were lysed and luciferase activity was measured (upper panel). Data presented are means ± SD of three independent experiments. The expression of hZAP was confirmed by Western blotting (lower panel). (B) Cytoplasmic RNA was extracted and subjected to Northern blotting to detect the mRNA indicated (upper panel). Expression of hZAP was confirmed by Western blotting (lower panel).
ZAPs was recently reported to stimulate type I interferon production through interaction with RIG-I
(A) Control shRNA and shRNAs against RIG-I (Ri446 and Ri583) were stably expressed in 293TRex-hZAP-v2 cells. RIG-I mRNA levels were measured by real-time PCR and normalized to that of GAPDH. Data presented are means ± SE of three parallel experiments. (B) Cells were transfected with pGl3-IFNβ-luc and pRL-TK. At 48 h posttransfection, cells were transfected with poly (I:C). Luciferase activity was assayed 12 h later. (C) Cells were infected with XMRV-luc, mock treated or treated with tetracycline for 48 h to induce ZAP expression, and luciferase activities were measured. Fold inhibition was calculated as the luciferase activity in mock treated cells divided by that in tetracycline treated cells. Data presented are means ± SE of three parallel experiments.
Previous studies demonstrate that ZAP targets specific viral mRNA sequences
(A) Schematic structures of HR'-CMV-luc vectors. (B) 293TRex-hZAP-v2 cells were infected with the vectors indicated. At 3 h postinfection, cells were mock treated or treated with 1 μg/ml tetracycline to induce ZAP expression. At 48 h postinfection the cells were lysed and luciferase activity was measured. Fold inhibition was calculated as luciferase activity in mock treated cells divided by luciferase activity in tetracycline treated cells (up panel). Data presented are means ± SD of three independent experiments. The expression of hZAP-v2 was confirmed by Western blotting (lower panel).
The ZRE in MoMLV was also mapped to the 3′UTR
(A) Schematic structures of the truncation constructs of 3′UTR. (B) Analysis of the sensitivity of the 3′UTR truncation mutants to ZAP. Fold inhibition was measured as described in the legend to
Infection of cells by retroviruses can be restricted by host factors through a variety of mechanisms
ZAP has been reported to inhibit the infection of MoMLV, HIV-1, Ebola virus, Marburg virus and certain alphaviruses
ZAP binds directly to ZRE-containing viral mRNAs. No obvious common motifs or secondary structures have been observed in the so far identified ZREs. The crystal structure of the N-terminal domain of ZAP, the putative major RNA-binding domain, predicts that the target RNA should have a tertiary structure to place some nucleotides in the correct position to fit into a three-dimensional cleft on ZAP surface
In summary, here we report that ZAP inhibits XMRV infection by targeting the viral mRNA for degradation in the cytoplasm. The ZRE in XMRV is mapped to the U3 region of the 3′UTR. Such findings broaden the antiviral spectrum of ZAP.
pCR2-TOPO-VP62, an infectious clone of XMRV was kindly provided by Dr. Stephen P. Goff (Columbia University, Howard Hughes Medical Institute)
5LTRup: 5′-gGAATTCgctgaaagaccccaccataag;
5LTRdown: 5′-cgGGATCCgtccctagatctcgagaacactt;
3LTRup: 5′-aGCGGCCGCtttgtaaaagacagaatttcg;
3LTRm3: 5′-gttgttagtttcgctttatctgagg;
3LTRm5: 5′-cctcagataaagcgaaactaacaac;
3LTRdown: 5′-caaatgaaagacccccgagctgggtag;
X-luc5: 5′-cgGGATCCaccatggaagacgccaaaaacat;
X-luc3: 5′-ccgcgtGCGGCCGCttacaatttggactttcc
pHR'-CMV-Luc, a lentivector that is not sensitive to ZAP, has been described previously
UTR5-5: 5′-aaGAATTCagccttttgctgtttgcatc
UTR5-3: 5′-ttcaGTCGACggatccgtccctagatct
Luc3-5: 5′-ggacggatccaccatggaagacgccaa
UTR3-3: 5′-ccagCTCGAGtgggaacacgggtacccg
Sd1-F: 5′- agCCGCTCGAGattttattcagtttc
Sd2-F: 5′-agCCGCTCGAGttctcaaaagttacaag
Sd-R: 5′-ccagCTCGAGtgggaacacgggtacccg
Ad-F: 5′-agCCGCTCGAGtgtaaaagacagaatttc
Ad1-R: 5′-agCCGCTCGAGgccgagtgtggagttc
AD2-R: 5′-agCCGCTCGAGaaactgttgttagt
The plasmids expressing shRNAs directed against RIG-I (Ri446 and Ri538) and a control shRNA were generated by annealing pairs of oligonucleotides and cloning into pSuper-retro-puro (OligoEngine) using
Control:
shRIGi446:
shRIGi538:
pcDNA4TO/myc-hZAP-v1 and pcDNA4TO/myc-hZAP-v2, which express myc-tagged hZAP-v1 and hZAP-v2, respectively, have been describes previously
Control siRNA (siCtrl: Catalog No. D-001810-10) and siRNAs against hZAP (ZAPi-1: Catalog No. J-017449-11 and siZAPi-2: Catalog No. J-017449-09) were obtained from Thermo Scientific. siRNA was transfected into cells by lipofectamine 2000 (Invitrogen) following the manufacturer's protocol.
All the cells were maintained in DMEM supplemented with10% FBS. Transfection was performed using lipofectimine 2000 (Invitrogen) following the manufacturer's instruction. 293TRex-hZAP-v1 and 293TRex-hZAP-v2 cells have been described previously
Production of VSV-G pseudotyped SR-Ctrl, SR-RIG-Ii446 and SR-RIG-Ii583 transducing viruses, and transduction of 293TRex-hZAP-v2 cells with these viruses have been previously reported
VSV-G pseudotyped XMRV-luc was produced by cotransfection of 293T cells with pVSV-G, pHIT60 and the XMRV-luc vector. To produce VSV-G pseudotyped lentiviruses, 293T cells were cotransfected with pVSV-G and pCMVdelR8.2 (a plasmid expressing HIV Gag and Pol proteins), and pHR'-CMV-mcs-luc vectors.
Replication-competent XMRV was produced by transfection of 293T cells with pCR2-TOPO-VP62. Plasmid pVSVG was included to enhance XMRV infection efficiency.
To evaluate the antiviral activity of ZAP, cells were infected with XMRV-luc or HR'-CMV-mcs-luc based vectors. At 5 h postinfection, cells were equally divided into two dishes, with one mock treated and the other treated with tetracycline. The cells were lysed and luciferase activities were measured with the Luciferase Assay System (Promega) at 48 h postinfection. Fold inhibition was calculated as the luciferase activity in mock treated cells divided by that in tetracycline treated cells.
To establish a 293Trex-hZAP-v2 cell line carrying XMRV-luc provirus, 293Trex-hZAP-v2 cells were infected for 4 times with XMRV-luc, followed by cultivation and passage for a week.
293TRex-hZAP-v2 cells were seeded in 35 mm dishes and infected with XMRV-luc viruses at varying dilution on the next day. Right after infection the cells were untreated or treated with tetracycline to induce hZAP-v2 expression. At 24 h postinfection, Hirt DNA was extracted as described previously
X2LTR5: 5′-agtcatccgatagactgag
X2LTR3: 5′-ttatagggctaggactggg
hMtDNAsp:
hMtDNAap:
Cytoplasmic RNA was extracted using RNeasy Kit (Qiagen) following the manufacturer's instruction, followed by reverse transcription with MLV reverse transcriptase using random primers. The mRNA levels of hZAP and RIG-I were measured by SYBR Green real-time PCR in Rotor-gene 6000 (Corbett Life Science) using the following program: 1) 50°C 2 min, 1 cycle; 2) 95°C 5 min, 1 cycle; 3) 95°C 15 s -> 60°C 30 s -> 72°C 30 s, 40 cycles; 4) 72°C 10 min, 1 cycle. The mRNA level of
qhZAP FP:
qhZAP RP:
qRIG-I FP:
qRIG-I RP:
qGAPDH FP:
qGAPDH RP:GGGGTCATTGATGGCAACAATA
293Trex-hZAP-v2 Cells were seeded in 60 mm disks and infected the day after with 2 ml XMRV virus produced in 293T cells. At 8 h postinfection, cells were mock treated or treated with doxycycline to induce expression of hZAP-v2. Supernatants were collected every day and subjected to RT assays as described previously
Cytoplasmic RNA was isolated from cells with an RNeasy kit (Qiagen) according to the manufacturer's instructions. The RNA samples were separated by electrophoresis, transferred to nylon membrane, and hybridized for 15–20 h with 32P-labeled probes prepared by a random primer labeling kit (Stratagene, La Jolla, CA). The probe for XMRV-luc mRNA was the coding sequence of
293TRex-hZAP-v2-Ctrl, 293TRex-hZAP-v2-Ri446, and 293TRex-hZAP-v2-Ri583 cells (∼1×105) were seeded on 24-well plates and transfected with reporter plasmid pGL3-IFNβ-luc (a kind gift from Prof. Zhengfan Jiang, Peking University, China) on the following day. To normalize transfection efficiency, 0.01 μg of pRL-TK Renilla reporter plasmid (Promega) was included in each transfection. Cells were mock treated or treated with tetracycline (1 μg/ml) to induce ZAP expression. At 48 h posttransfection, cells were stimulated for 12 h by transfection of 0.25 μg poly (I:C), and luciferase activity was measured with the Dual-Luciferase Reporter Assay system (Promega).
(TIF)
(TIF)
We thank Professor Goff SP for providing the VP62-encoding plasmid and Professor Jiang ZF for providing the reporter plasmid pGL3-IFNβ-luc.