Conceived and designed the experiments: RM EG SC. Performed the experiments: SC BB S. François FF ET ER. Analyzed the data: RM EG SC FF S. Ferrari. Wrote the paper: RM EG SC.
Current address: Dulbecco Telethon Institute, Rome, Italy
The authors have declared that no competing interests exist.
Determine global gene dysregulation affecting 4q-linked (FSHD-1) and non 4q-linked (FSHD-2) cells during early stages of myogenic differentiation. This approach has been never applied to FSHD pathogenesis.
By
FSHD-1 and FSHD-2 cells showed, in different steps of myogenic differentiation, a global deregulation of gene expression rather than an alteration of expression of 4q35 specific genes. In general, FSHD-1 and FSHD-2 global gene deregulation interested common and distinctive biological processes. In this regard, defects of cell cycle progression (FSHD-1 and to a lesser extent FSHD-2), protein synthesis and degradation (FSHD-2), response to oxidative stress (FSHD-1 and FSHD-2), and cholesterol homeostasis (FSHD-1 and FSHD-2) may in general impair a correct myogenesis. Taken together our results recapitulate previously reported defects of FSHD-1, and add new insights into the gene deregulation characterizing both FSHD-1 and FSHD-2, in which miRNAs may play a role.
Facioscapulohumeral muscular dystrophy (FSHD [OMIM 158900]) is the third most frequent form of muscle diseases, inherited as an autosomal dominant trait, with an estimated incidence of 1 in 20,000.
The disease is predominantly characterized by progressive, often asymmetric, weakness and wasting of facial, shoulder and upper arm muscles
The molecular defect associated to the disorder has been mapped to the subtelomeric region of the long arm of chromosome 4 (4q35) where a large, complex macrosatellite (the D4Z4 repeat array) is present
However, a small percentage of FSHD cases (<5%) (defined FSHD-2 patients), shows at least one 4qA161 chromosome but no contraction of 4q35 D4Z4
Furthermore, recent studies showed that FSHD-1 and FSHD-2 patients are characterized by 4q D4Z4 hypomethylation that is contraction-dependent in FSHD-1 and contraction-independent in FSHD-2 patients
One approach with no an
In this paper, we present global gene-expression profiles of myoblasts from FSHD-1 and FSHD-2 patients and healthy controls in the context of myogenic differentiation.
Human primary myoblasts derived from FSHD-1 and FSHD-2 (non 4q-linked or phenotypic FSHD) patients and from healthy controls were obtained from the Telethon BioBank (Neuromuscular Disease and Neuroimmunology Unit, Muscle Cell Biology Laboratory, C. Besta Neurological Institute).
CELLLINES | AGE ATBIOPSY/GENDER | SITE OFBIOPSY | MOLECULARDIAGNOSIS | SIZE OFD4Z4ARRAY | HAPLOTYPE |
PD |
MICROARRAYASSAY |
qRT-PCR |
FSHD-1S1 | 35 / M | Quadricepsfemoris | FSHD-1 | 23 kb | 4qA161–4qB168 | 7 | X | |
FSHD-1S2 | 5 / M | Quadricepsfemoris | FSHD-1 | 6–9 kb | 4qA161–4qB164 | 4 | X | X |
FSHD-1S3 | 71 / F | Quadricepsfemoris | FSHD-1 | 27,5 kb | 4qA161–4A163 | 5 | X | X |
FSHD-1S4 | 55 / F | Quadricepsfemoris | FSHD-1 | 29 kb | 4qA161–4qA161 | 3 | X | X |
FSHD-1S5 | 75 / F | Quadricepsfemoris | FSHD-1 | 25 kb | N.D. | 4 | X | |
FSHD-1S6 | 33 / M | Quadricepsfemoris | FSHD-1 | 27,5 kb | N.D. | 5 | X | |
FSHD-1S7 | 17 / F | Quadricepsfemoris | FSHD-1 | 17 kb | N.D. | 4 | X | |
FSHD-2S1 | 12 / M | Quadricepsfemoris | FSHD-2 | >38 kb | 4qA161–4qB168 | 4 | X | X |
FSHD-2S2 | 17 / M | Quadricepsfemoris | FSHD-2 | >38 kb | 4qA161–4qA161 | 3 | X | X |
CN-1 | 62 / F | Quadricepsfemoris | control | - | 4qA161–4qB164 | 5 | X | |
CN-2 | 77 / M | Quadricepsfemoris | control | - | 4qA161–4qB164 | 4 | X | |
CN-3 | 55 / F | Quadricepsfemoris | control | - | 4qA168–4qB164 | 4 | X | X |
CN-4 | 60 / M | Quadricepsfemoris | control | - | 4qA161–4qB163 | 3 | X | |
CN-5 | 20 / M | Quadricepsfemoris | control | - | N.D. | 2 | X | |
CN-6 | 28 / F | Quadricepsfemoris | control | - | 4qA161–4qB163 | 5 | X | |
CN-7 | 37 / F | Quadricepsfemoris | control | - | 4qA161–4qB164 | 6 | X | |
CN-8 | 49 / F | Quadricepsfemoris | control | - | N.D. | 10 | X |
N.D. Not determined.
Population doubling (PD).
*Sequence-lengh polymorphism (SSLP) located 3,5 kb proximal to D4Z4
**Cell lines used in microarray assay and/or qRT-PCR.
Total RNA was isolated from sub confluent cell cultures using the RNeasy Mini Kit (Qiagen), and the purified RNA was treated with RNase-free DNase (Qiagen) to remove any residual DNA. Purified RNA was quantified by NanoDrop spectrophotometry (Thermo Scientific). Quantitative RT-PCR (qRT-PCR) analysis was performed on an IQ™5 Multicolor Real-Time PCR Detection System (Biorad) by TaqMan® Gene Expression Assays (Applied Biosystem) (
Transcript | Primer (5′–3′) | Probes (Reporter – Quencher) |
GAPDH | Fw - cccttcattgacctcaactacatg | TEXAS RED - BHQ-2 (Sigma) |
Rw - tgggatttccattgatgacaagc | ||
POLRA2 | Fw- gcaccacgtccaatgacat | HEX - BHQ-1 (Sigma) |
Rw- gtgcggctgcttccataa | ||
HPRT1 | Fw- agactttgctttccttggtcagg | JOE - TAMRA (Sigma) |
Rw- gtctggcttatatccaacacttcg | ||
KIF18A | Hs00229692_m1 | FAM - BHQ-2 (Applied Biosystems) |
CDC6 | Hs00154374_m1 | FAM - BHQ-2 (Applied Biosystems) |
E2F7 | Hs00403170_m1 | FAM - BHQ-2 (Applied Biosystems) |
SUV39H1 | Hs00162471_m1 | FAM - BHQ-2 (Applied Biosystems) |
DCLRE1B | Hs00224566_m1 | FAM - BHQ-2 (Applied Biosystems) |
MSH2 | Hs00953523_m1 | FAM - BHQ-2 (Applied Biosystems) |
SDR | Hs00190538_m1 | FAM - BHQ-2 (Applied Biosystems) |
LAMA4 | Hs00935293_m1 | FAM - BHQ-2 (Applied Biosystems) |
SOD2 | Hs00167309_m1 | FAM - BHQ-2 (Applied Biosystems) |
PTPRN | Hs00160947_m1 | FAM - BHQ-2 (Applied Biosystems) |
Transcript | Primer (5′–3′) | Correlation coefficient (R∧2) |
Efficiency of reaction (E) | ||
PAX3 | Fw- ggagactggctccatacgtc | E = 99,0% |
Rw- caaattactcaaggacgcgg | R∧2 = 0,924 | |
MYOD1 | Fw- cggcggaactgctacgaag | E = 99,5% |
Rw- gcgactcagaaggcacgtc | R∧2 = 0,990 | |
MYOG | Fw- tcaaccaggaggagcgtgac | E = 97,0% |
Rw- tgtagggtcagccgtgagca | R∧2 = 0,979 | |
MYH2 | Fw- ggaccaactgagtgaactgaaa | E = 95,8% |
Rw- ttgcctcttgataactgagacac | R∧2 = 0,908 |
The statistical analysis was performed using a two-tailed Student's
RNA quality and quantity were assessed using Agilent 2100 Bioanalyzer (Agilent Technologies) and NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific), respectively. 1 µg of total RNA was subjected to ribosomal RNA removal using RiboMinus human/mouse transcriptome isolation kit (Invitrogen), then cDNA was synthesized using Whole-Transcript Sense Target Labeling Assay (Affymetrix®), following manufacturer's procedure. Fragmented biotin-labeled cDNAs were hybridized to Affymetrix® human exon 1.0 ST arrays at 45°C for 17 hours, as described in Affymetrix® Users Manual. Washing and staining steps were carried out using GeneChip Fluidics Station 450, then the arrays were scanned in the Affymetrix® GeneChip® scanner 3000 7G. Affymetrix® GeneChip® operating software was used for acquisition, management and initial processing of the expression data, while arrays quality control was performed using Affymetrix® Expression Console™.
Expression analysis of microarray experiments was performed with Raw Affymetrix data (".CEL" files) were background adjusted, preprocessed and normalized using RMA procedure. The analyses were performed using R statistical environment (
Functional classification analysis of the differentially expressed probes was performed with DAVID Bioinformatics Resource 6.7 (National Institute of Allergy and Infectious Disease (NIAD), NIH (
miRNA target prediction was obtained with microRNA.org (
We analyzed by microarray the expression profile of human primary myoblasts obtained from three FSHD-1 and two FSHD-2 patients, and three healthy controls (CN). To evaluate the molecular perturbation of FSHD upon muscle differentiation, we compared patients and CN proliferating myoblasts as well as the corresponding myotubes obtained after 8 days of cell differentiation. Moreover we analyzed gene expression variations in the differentiation processes of FSHD samples and compared them to that observed in control cells (
A): FSHD-1 and FSHD-2 myoblasts, in respect to controls; 367 genes were up- (128) or down- (239) regulated in FSHD-1 myoblasts and 70 genes were up- (23) or down- (47) regulated in FSHD-2 myoblasts. Four (3 up and 1 down) genes were deregulated in both cell lines. B): FSHD-1 and FSHD-2 myotubes, in respect to controls; 129 genes were up- (71) or down- (58) regulated in FSHD-1 myotubes and 626 genes were up- (178) or down- (448) regulated in FSHD-2 myotubes. Thirteen (4 up and 9 down) genes were deregulated in both cell lines. C): FSHD-1 and FSHD-2 differentiation processes, in respect to the differentiation of control cells; 559 genes were modulated in the differentiation of CN cells, 158 in the differentiation of FSHD-1 and 899 of FSHD-2, cells. FSHD-1 and CN differentiation processes shared 67 entries, whereas FSHD-2 and CN differentiation processes shared 222 entries. FSHD-1 and FSHD-2 differentiation processes shared 25 deregulated genes. FC>2 and p-value <0.01 and <0.001 for FSHD-1 and FSHD-2, respectively.
Regarding the 4q35 chromosome region, the analysis did not reveal a significantly altered pattern of gene expression, in both FSHD-1 and FSHD-2 samples; exceptions were represented by three genes (SNX25, ANKRD37 and SORBS2, located approximately 4 Mb upstream to the D4Z4 array) found down-regulated only in FSHD-1 myotubes (
The probes identified by microarray as up- or down-regulated in FHSD-1 and FSHD-2 cells were categorized in the DAVID program (see criteria in
Biological processes significantly enriched in the set of genes identified by microarray as up- or down-regulated in A) FSHD-1 myoblasts, and B) in FSHD-2 myotubes, and categorized in the DAVID program. Numbers in the bars indicate the number of genes assigned to each gene ontology term. p-value <0.05.
Conversely, the categories of biological processes identified as more severely affected in FSHD-2 myoblasts (
Differently from what observed in FSHD-1 myotubes, FSHD-2 differentiated cells showed that the most significantly affected biological process (p-value up to 10−14) was related to ncRNA metabolic process, including ribosome biogenesis (22 genes) and tRNA metabolic process (21 genes). Others significantly affected categories regarded sterol (13 genes) and amino acid metabolic processes (31 genes) (
Another approach to investigate the gene deregulation in FSHD cells is to analyze the gene chip results in the context of the differentiation process. This could be obtained by categorizing in the DAVID program the variation in gene expression profile obtained analyzing the FSHD-1 and FSHD-2 differentiation processes subtracted with the variation showed by the control cells differentiation. The result of these analyses is schematized in
Diagram showing the biological processes significantly enriched in the set of genes differentially expressed in the differentiation processes of FSHD-1 (yellow bars) and FSHD-2 (grey bars) cells in respect to control. Bar on the left indicated the biological process modulated in control but not in FSHD-1 (yellow bar), and FSHD-2 (grey bars) cells, whereas bars on the right indicated the biological processes modulated in FSHD-1 (yellow bar) and FSHD-2 (grey bars) but not in control cells. All bars group many related GO categories. p-value <10−4.
The gene expression profile analysis of FSHD-1 and FSHD-2 myoblasts and myotubes also evidenced a total of six deregulated miRNAs. Two miRNAs, mir-23b and mir-133a-1, were upregulated in FSHD-1 and FSHD-2 myoblasts, respectively; FSHD-1 myotubes showed the down-regulation of one miRNA (mir-186), whereas in FSHD-2 myotubes four miRNAs (mir-149, mir-15a, mir26a-2, and mir23b) were up-regulated. Furthermore, mir-23b was found deregulated both in FSHD-1 myoblasts and FSHD-2 myotubes. The derived list of deregulated miRNAs was then analyzed for the predicted targeted genes (see
miRNA | GENE TARGET | ||||
CELLLINES | GENESYMBOL | FC (P-VALUE) | GENESYMBOL | FC (P-VALUE) | FUNCTION |
FSHD-1myoblasts | hsa-mir-23b | 3,4 (6,90E-03) | HMGB2 | −2,1 (1,91E-03) | Chromatin conformation |
FSHD-1myotube | hsa-mir-186 | −2,3 (2,09E-03) | HAS2 | 3,8 (1,48E-03) | Biosynthesis of extracellular matrix |
FSHD-2myotubes | hsa-mir-149 | 3,18 (4,22E-05) | NFIBPRKAR2A |
−5,77(2,41E-05)−2,48 (2,43E-04) | RNA biosynthesisSignal transduction |
FSHD-2myotubes | hsa-mir-15a | 6,19 (6,07E-05) | IARSCOPS7APRKAR2A |
−3,03 (8,95E-06)−2,23 (1,35E-05)−2,48 (2,43E-04)−2,54 (4,76E-04) | Protein synthesisSignal transductionSignal transductionTransport |
FSHD-2myotubes | hsa-mir-26a-2 | 2,64 (5,80E-04) | EPC2ZNF410FAM55CSC4MOL | −2,95 (5,67E-05)−2,33 (1,91E-04)−3,30 (3,97E-04)−7,49 (1,13E-05) | Chromatin conformation; regulation of transcriptionRNA biosynthesisUnknownCholesterol byosinthesis |
FSHD-2myotubes | hsa-mir-23b | 6,57 (6,79E-04) | EPS15ENTPD5 | −2,28 (9,07E-04)−2,27 (1,67E-04) | TransportNucleotide metabolism |
*The asterisk indicates the only gene targeted by more than one miRNA.
To confirm the FSHD-1 microarray data we focused our attention on some genes contained in the most enriched categories evidenced by GO analysis. The chosen representative genes were validated by multiplex Real–Time assay performed with Taqman® probes on seven FSHD-1 in comparison to six healthy controls (for a description of the used cell lines see
A: Table reports the genes analyzed in qRT-PCR with fold-change and p-value. The data obtained in the FSHD-1 myoblasts gene chip array and the biological processes identified by the DAVID program, are also reported. The analysis was performed on seven FSHD-1 and six CN myoblast cell lines. B) Bar diagrams show relative expression of PAX3, MYOD1, MYOG and MYH2 in control and FSHD-1 myoblasts (day 0) and myotubes (day 8) relative to GAPDH. *** p-value < ,001.
Furthermore, since the analysis of the FSHD-1 myoblasts gene chip array evidenced a slight up-regulation of the transcription factor PAX3 (P 1×10−2; FC 2.17), a molecule involved in developmental myogenesis, and of MYOD (P 1,01×10−2; FC 2.39,
As shown in
In this paper we have compared the expression profiles of FSHD-1 and FSHD-2 precursor cells in regard to healthy controls before and after myogenic differentiation. In our knowledge, this is the first report that uses human 4q-linked and non 4q-linked (or phenotypic) FSHD primary myoblasts and their in vitro differentiation to investigate global gene deregulation characterizing cells deriving from FSHD patients with a different genetic defect, but with a very similar phenotypic manifestation of the disease
It is noteworthy that only two FSHD-2 cell lines were available for the chip analysis; although this represents a small sample size we decided anyhow to include them in our analysis since this type of FSHD cell has never been analyzed; thus to render the data more significant we decided to use a lower p value (>0.001) than that used for FSHD-1 (>0.01).
A gradient of altered gene expression throughout the 4q35 chromosome linked to D4Z4 contraction has been proposed as a model for the molecular pathogenesis of FSHD-1
However, significant results concerning the altered biological processes of the pathological cells were obtained, by deriving in regard to controls the global deregulation of gene expression in FSHD-1 and FSHD-2 myoblasts and myotubes and by comparing the two pathological differentiation processes to the normal one. By combining the two approaches, we derived that gene deregulation was essentially a feature of FSHD-1 proliferating cells and of FSHD-2 differentiated cells. FSHD-1 myoblasts showed a highly significant gene deregulation linked to cell cycle control essentially affecting G1/S and G2/M transitions. These results are in agreement with previous data derived by the analysis of FSHD-1 cells, and showing the up-regulation of p21, known to arrest progression at G1/S interface, and of WEE1, a negative regulator of entry into mitosis (G2/M transition)
Furthermore, FSHD-1 myoblasts showed the up-regulation of PAX3, a key upstream regulator of the myogenic program: PAX3 up-regulates the myogenic determination gene MYOD1 that, in turn regulates MYOG expression
In our system, the found premature up-regulation of MYOD1 mRNA could be ascribed to PAX3 mRNA up-regulation; furthermore, as previously reported
Remarkably, other two genes SUV39H1 and HMGB2 both involved in chromatin remodeling were down-regulated in FSHD-1 myoblasts. SUV39H1 is a histone methyl-transferase involved in D4Z4 H3K9me3
Thus, in addition to the early partial activation of the myogenic program, proteins involved in chromatin organization are also modulated in FSHD-1 samples, suggesting that their absence might contribute to the epigenetic defect of the D4Z4 array.
Conversely, FSHD-2 cells were characterized by a significant alteration of gene expression only after the
FSHD-2 differentiation analysis also evidenced the deregulation of the cell cycle and of proteasomal ubiquitin-dependent process. Importantly, ubiquitin-dependent proteolysis has been suggested to govern terminal muscle differentiation by coordinating cellular division and differentiation
Interestingly, both FSHD-1 and FSHD-2 cells were affected in sterol biosynthetic process, showing the deregulation, although in the opposite direction, of the same genes. The alteration of cholesterol homeostasis could primarily cause cell damage in membranes lipid rafts, where different proteins are incorporate (e.g. GPI-anchored and cholesterol-linked proteins), and in caveolae a subclass of rafts
In normal cells reactive oxygen species (ROS) generation is counterbalanced by the action of antioxidant enzymes, such as mitochondrial superoxide dismutase (SOD2) and of those involved in glutathione metabolism. The found deregulation of SOD2 in FSHD-1 myoblasts and of glutathione reductase (GSR) and peroxidase (GPX4) in FSHD-2 myotubes could suggest for both FSHD manifestations the occurrence of a similar increased susceptibility to oxidative stress. The deregulation of enzymes involved in oxidative stress resistance and the consequent increased susceptibility to oxidative stress have been already reported for FSHD-1 myoblasts and biopsies
Finally, both FSHD-1 and FSHD-2 cells showed the involvement in the gene deregulation network of some microRNAs (miRNA), a class of molecules previously shown to play an important role in the regulation of muscle development
Although future work is certainly needed to confirm the herein derived observations, taken together our results seem to recapitulate previously reported defects of FSHD-1, and to add new insights into the gene deregulation characterizing both FSHD-1 and FSHD-2. In general, FSHD-1 cells showed an alteration of cell cycle control, a defect in cholesterol homeostasis and presumably in the mitochondrial capacity to buffer oxidative stress. With the exception of cholesterol homeostasis, FSHD-2 cells shared all these features by deregulating different genes. FSHD-2 cells also showed a general deregulation of protein synthesis and degradation. In this regard, proteasome ubiquitin-dependent protein degradation could be viewed as an impairment in exit from the cell cycle. Thus both FSHD manifestations presented cellular deficiencies that do not arise from a 4q position effect mechanism, but rather from a general alteration of gene expression in which miRNA deregulation may play a role.
List of differentially expressed probes in FSHD-1 and FSHD-2 myoblasts (A and B), and in FSHD-1 and FSHD-2 myotubes (C and D).
(XLS)
DAVID classification of biological processes significantly enriched in the set of genes differentially expressed in FSHD-1 and FSHD-2 myoblasts (A and B) and in FSHD-1 and FSHD-2 myotubes (C and D).
(XLS)
DAVID classification of biological processes significantly enriched in the set of genes differentially expressed during the differentiation process of CN (A), FSHD-1 (B) and FSHD-2 (C) cells.
(XLS)
We gratefully acknowledge Dr. Marina Mora (Telethon BioBank) and Eurobiobank for providing normal and FSHD human myoblasts.