Conceived and designed the experiments: MT EvdB LLMP LC JtM RC JSMP JdK. Performed the experiments: EvdB MJ PA AB FC EvD. Analyzed the data: MT EvdB LLMP PA LC AB FC EvD JtM IL JSMP JdK JG. Contributed reagents/materials/analysis tools: YG JC RC. Wrote the paper: MT JG.
Current address: Merus BV, Utrecht, The Netherlands
Current address: Genmab, Utrecht, The Netherlands
Current address: AIMM BV, Amsterdam, The Netherlands
Current address: Merck Research Laboratories, West Point, Pennsylvania, United States of America
MT., EvdB, MJ, AB, FC, ED, JtM., JdK. and JG are employees of Crucell Holland BV. PA and IL are employees of Algonomics NV.
The hemagglutinin (HA) glycoprotein is the principal target of protective humoral immune responses to influenza virus infections but such antibody responses only provide efficient protection against a narrow spectrum of HA antigenic variants within a given virus subtype. Avian influenza viruses such as H5N1 are currently panzootic and pose a pandemic threat. These viruses are antigenically diverse and protective strategies need to cross protect against diverse viral clades. Furthermore, there are 16 different HA subtypes and no certainty the next pandemic will be caused by an H5 subtype, thus it is important to develop prophylactic and therapeutic interventions that provide heterosubtypic protection.
Here we describe a panel of 13 monoclonal antibodies (mAbs) recovered from combinatorial display libraries that were constructed from human IgM+ memory B cells of recent (seasonal) influenza vaccinees. The mAbs have broad heterosubtypic neutralizing activity against antigenically diverse H1, H2, H5, H6, H8 and H9 influenza subtypes. Restriction to variable heavy chain gene IGHV1-69 in the high affinity mAb panel was associated with binding to a conserved hydrophobic pocket in the stem domain of HA. The most potent antibody (CR6261) was protective in mice when given before and after lethal H5N1 or H1N1 challenge.
The human monoclonal CR6261 described in this study could be developed for use as a broad spectrum agent for prophylaxis or treatment of human or avian influenza infections without prior strain characterization. Moreover, the CR6261 epitope could be applied in targeted vaccine strategies or in the design of novel antivirals. Finally our approach of screening the IgM+ memory repertoire could be applied to identify conserved and functionally relevant targets on other rapidly evolving pathogens.
Influenza pandemics have historically been associated with high levels of morbidity and mortality. Pandemics return periodically and a new pandemic is now overdue. The most serious pandemic threat in recent times has been posed by the highly pathogenic avian influenza virus (HPAI) H5N1 which emerged in South-East Asia in 1997
Preparedness to confront an influenza pandemic is still a major public health issue. Broad spectrum antivirals, such as the neuraminidase inhibitor oseltamivir, have been stockpiled as a first line defence against rapidly spreading HPAI strains. However the use of oseltamivir in the treatment of H5N1 infections has been associated with the generation of resistant viruses
Passive immunization has been anecdotally reported to be effective against H1N1 and H5N1 viruses
Based on our hypothesis that the IgM+ B cell subset contains a diverse repertoire of antibodies against conserved epitopes on pathogens we have applied antibody phage display to search for broadly neutralizing H5N1 mAbs using combinatorial libraries built from B cells isolated from donors recently vaccinated with the seasonal influenza vaccine. Using this approach we have rescued a panel of human antibodies that show an unexpected breadth of influenza subtype neutralization that include H5, H1, H2, H6, H8 and H9 (H2, H5, H6, H9 being identified as high risk pandemic candidates). The binding region of these mAbs has been localised to a conserved region of the HA stem domain. The lead mAb CR6261 showed prophylactic and therapeutic efficacy in mouse models with H5N1 or H1N1 challenge.
The reverse genetics reassortants (RG) NIBRG-14 (A/Puerto Rico/8/34 with low pathogenic (LP) HA and NA of A/Vietnam/1194/04; H5N1) and RG-A/Indonesia/5/05 (A/Puerto Rico/8/34 with (LP) HA and NA of A/Indonesia/5/05; H5N1) were grown in MDCK cells by standard viral culture techniques. The wild type H5N1 strain A/HongKong/156/97 was originally obtained from a 3-year-old child suffering from respiratory disease
IgM+ memory B cells (CD24+/CD27+/IgM+) were sorted from peripheral blood mononuclear cells obtained with written consent from ten normal healthy donors by fluorescent activated cell sorting (FACS, Digital Vantage, Becton Dickinson). ScFv phage display libraries were constructed essentially as described
a) Donor lymphocytes were isolated by Ficoll-plaque from heparinized blood and stained for the phenotypic markers CD27, CD24 and IgM. CD24+ CD27+ cells were gated and the IgM+ cells within this gate sorted directly into Trizol for RNA extraction. b) RT-PCR was performed using a pool of 5′ oligonucleotide primers that cover all VH gene families and a 3′ oligonucleotide primer that anneals in a region of the CH1 domain of Cμ distinct from other immunoglobulin isotypes. c) Using cDNA generated in this way, 10 individual scFv libraries were constructed as described previously
Phage panning to soluble rHA and (anti-Myc-captured) soluble rHA (5.0 µg/ml in PBS, pH 7.4) immobilized to MaxisorpTM Immunotubes (Nunc) was performed essentially as described
Fully human IgG1 antibodies were constructed by cloning the heavy (VH) and light (VL) chain variable regions of H5 rHA-specific scFv-phage antibodies into separate vectors for IgG1 heavy and light chain expression. Human IgG1 mAbs were expressed and purified as described previously
Microtiter plates (Immuno™ Maxisorp, Nunc) were coated overnight at 4°C with 0.5 µg/ml soluble rHA or BPL inactivated virus then washed three times with PBS containing 0.1% v/v Tween-20 and blocked in PBS containing 2% w/v non-fat dry milk (blocking solution) for 1 hr at RT. For scFv-phage binding assays, scFv-phage antibodies were pre-incubated for 1 hr in an equal volume of PBS containing 4% w/v non-fat dry milk and added to the wells. After 1 hr plates were washed with PBS/0.1% v/v Tween-20 and bound phage antibodies were detected using a peroxidase-conjugated anti-M13 antibody (GE Healthcare). For IgG1 binding assays, anti-HA IgG1 in blocking solution were added to wells and incubated for 1 hour at room temperature, after which bound IgG1 was detected using a peroxidase-conjugated mouse anti-human IgG antibody (Jackson). The reaction was developed with O-phenylenediamine substrate (Sigma FAST OPD; Sigma) and stopped by the addition of 1M H2SO4. The absorbance was measured at 492 nm. For competition assays, anti-HA IgG1 were incubated as above and after washing incubated with FITC conjugated CR6261 or CR6323 (0.2 ug/ml) for 5 min at RT followed by anti-FITC rabbit IgG HRP; detection was as above.
For scFv-phage binding assays, PEG/NaCl precipitated scFv-phages were mixed with an equal volume of PBS/2% ELK and blocked for 30 minutes on ice. The blocked phages were added to pelleted cells (untransfected PER.C6® and HA-expressing PER.C6® cells) and incubated for one hour on ice. The cells were washed three times with PBS/1% BSA, followed by a 1 minute centrifugation at 300×
rHA antigen (0.4 µg/lane) was subjected to SDS-PAGE under reducing conditions alongside the marker Precision Plus (Biorad). Fractionated protein was transferred to Immobulon-P membrane (Millipore), blocked with 4% milk powder and probed with 10 µg/ml anti-H5 IgG1 containing supernatants. Immunoreactivity was detected by chemiluminescence following incubation with a peroxidase-conjugated mouse anti-human IgG antibody (Southern Biotech) and 2 min ECL incubation. Membranes were exposed to film (Hyperfilm, GE Healthcare) and image developed.
Surface plasmon resonance (SPR) analysis was performed on a BIAcore3000. Sheep anti-NIBRIG-14 serum or FLU mAb IgG was immobilized on a CM5 sensor chip by amine coupling and then used to capture soluble rHA; one channel on each chip was not coated and used as a negative control. Twelve concentrations of Fabs in 2-fold dilutions from 1000 nM down to 0.39 nM were injected at a constant flow rate of 100 µl/min at 25°C. At the end of the injection, running buffer (HBS-EP, pH 7.4) was applied for 770 s, followed by regeneration of the CM5 chip using 5 µl 10 mM NaOH. The experiments were repeated twice. The resulting data were fitted using a standard 1:1 Langmuir model and the dissociation constant KD calculated. BIAcore evaluation software (version 3.2, July 2001) was used throughout.
MDCK cells were maintained in minimum essential medium (MEM) supplemented with 10 % fetal calf serum (FCS) and 1% penicillin-streptomycin (PS) at 37°C. On the day of the experiment, MDCK cells in 96-well format were washed twice with PBS and incubated in MEM supplemented with 1% FCS, 1% PS and 1 µg/ml TPCK trypsin (for non-H5 viruses). Two-fold serially diluted purified IgG1 or IgG1 containing supernatant was mixed with an equal volume of viral inoculum, followed by 2 hour incubation at 37°C. After the incubation, the mixture (∼100 TCID50) was added to confluent MDCK monolayers. Cells were cultured for 72 hours before the examination of cytopathic effect (CPE). CPE was compared to the positive control (virus-inoculated cells) and negative controls (mock-inoculated cells). The absence of CPE in individual wells was defined as protection. The assay was performed in quadruplicate.
Virus was diluted to 8 HA units and combined with an equal volume of serially diluted IgG1 and incubated for 1 hr at room temperature. An equal volume of 0.5% Turkey red blood cells was added to the wells and incubation continued on a gently rocking plate for 30 min. Button formation was scored as evidence of hemagglutination.
RG-A/Indonesia/5/05 was cultured in the presence of purified CR6261 for 10 passages. A control experiment without CR6261 was done in parallel as a reference. Serially diluted (10−1 to 10−6 folds) viruses were first incubated in the presence of antibody (2.5 µg/ml) for 1 hour at 37°C. This concentration of antibody was previously shown to reduce the H5N1 viral titre by 3 logs (data not shown). The incubated mixture was then absorbed by MDCK cells for 1 hour. Infected cells were washed with PBS twice and replenished with MEM containing 1% FCS and 1% PS, 2.5 µg/ml of CR6261. CPE of these infected cells was monitored 48–72 hrs post-infection. Supernatant from CPE positive wells infected with the lowest virus titre were harvested for a subsequent round of infection. Supernatants from passage 10 were subjected to standard plaque assays and infected cells were overlaid with agar containing CR6261 (2.5 µg/ml). Six individual virus plaques were purified and grown in MDCK cells in the presence of CR6261 (2.5 µg/ml). The HA sequences of these were examined by routine sequencing techniques. Representative mutants were characterized by the neutralization assays as described above.
All experiments were approved prior to commencement by the ethical review committee of the Animal Sciences Group in accordance with Dutch law. Female 7-week-old BALB/c mice were inoculated intranasally on the day indicated with 25 LD50 A/HongKong/156/97 (4.5logTCID50) or A/WSN/33 (6.6logTCID50) or ∼ 10 LD50 A/Vietnam/1194/04 (3.7logTCID50) and observed daily for clinical signs and weighed. Clinical signs were scored with a scoring system (0 = no clinical signs; 1 = rough coat; 2 = rough coat, less reactive, passive during handling; 3 = rough coat, rolled up, laboured breathing, passive during handling; 4 = rough coat, rolled up, laboured breathing, unresponsive) and recorded. Surviving animals were euthanized and bled on day 21. IgG1 was injected i.p. in a volume of 500 µl or i.v. in the tail vein in a volume of 200 µl.
Antibody modelling was performed by individually selecting optimal framework and CDR template fragments from crystal structures based on sequence analysis. CDR's were grafted by structural fit, substituted side-chains were optimised by FASTER algorithm
Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG)
CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT)
CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC)
CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT)
PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen). Multiple >10 clones were sequenced using standard techniques with the primers M13_Fw and M13_rev.
Ten individual phage antibody libraries were constructed from sorted IgM+ memory B cells of three donors vaccinated with a seasonal influenza vaccine and seven unvaccinated donors (
(a) Alignment of VH amino acid sequences from scFv containing the same V(D)J rearrangement as CR6323 or CR6261 with the germline IGHV1-69. Note that although multiple mutations are present in the CDR1 and CDR2 loops Phe at position 54 is conserved (Kabat numbering). scFv that were neutralizing in an IgG1 format are shown in bold (b) DNA alignment and amino acids for the HCDR2 of (b) CR6323 and (c) CR6261 with related mAbs. Note the identical codon usage and conservation of silent mutations suggesting a clonal origin.
No | ID | Clones | IGHV | IGHD/ frame | IGHJ | VH Mutations/100bp |
1 | 6364 | 1 | 1-02 | 1-01 / 1 | 4 | 3.8 |
2 | 6366 | 1 | 1-02 | 5-05 / 3 | 4 | 4.2 |
3 | 6347 | 2 | 1-02 | 7-27 / 3 | 3 | 2.1 |
4 | 6141 | 11 | 1-18 | 6-06 / 1 | 6 | 7.6 |
5 | 6365 | 1 | 1-69 | 1-26 / 3 | 3 | 0.7 |
6 | 6269 | 8 | 1-69 | 1-26 / 3 | 1 | 5.9 |
7 | 6325 | 1 | 1-69 | 1-26 / 3 | 6 | 4.5 |
8 | 6334 | 1 | 1-69 | 2/OR15-2a / 1 | 6 | 10.8 |
9 | 6261 | 42 | 1-69 | 2-02 / 1 | 6 | 6.9 |
10 | 6332 | 1 | 1-69 | 2-15 / 2 | 6 | 8.0 |
11 | 6327 | 1 | 1-69 | 3-03 / 2 | 4 | 5.2 |
12 | 6339 | 1 | 1-69 | 3-03 / 2 | 4 | 5.9 |
13 | 6344 | 1 | 1-69 | 3-10 / 2 | 4 | 6.6 |
14 | 6342 | 1 | 1-69 | 3-10 / 2 | 5 | 19.1 |
15 | 6323 | 18 | 1-69 | 3-22 / 2 | 1 | 5.9 |
16 | 6343 | 1 | 1-69 | 3-22 / 2 | 4 | 6.3 |
17 | 6331 | 1 | 1-69 | 3-22 / 2 | 5 | 2.8 |
18 | 6262 | 6 | 1-69 | 4-04 / 2 | 6 | 9.4 |
19 | 6329 | 1 | 1-69 | 6-25 / 1 | 4 | 9.4 |
20 | 6143 | 1 | 3-07 | 3-16 / 3 | 1 | 4.2 |
21 | 6151 | 3 | 3-09 | 5-05 / 3 | 4 | 2.8 |
22 | 6307 | 1 | 3-21 | 1-26 / 3 | 4 | 1.4 |
23 | 5111 | 31 | 3-21 | 2-08 / 2 | 4 | 3.8 |
24 | 6295 | 2 | 3-21 | 3-10 / 2 | 4 | 0.7 |
25 | 6302 | 1 | 3-23 | 1-26 / 3 | 4 | 6.3 |
26 | 6134 | 1 | 3-23 | 3-03 / 2 | 5 | 6.3 |
27 | 6139 | 7 | 3-23 | 3-10 / 2 | 4 | 5.6 |
28 | 6144 | 9 | 3-23 | 4-17 / 3 | 4 | 3.8 |
29 | 6301 | 1 | 3-23 | 5-24 / 3 | 5 | 4.2 |
30 | 6367 | 1 | 3-23 | 6-06 / 1 | 4 | 1.4 |
31 | 6368 | 7 | 3-23 | 6-13 / 2 | 3 | 3.5 |
32 | 6369 | 9 | 3-23 | 6-19 / 3 | 4 | 14.6 |
33 | 6299 | 1 | 3-48 | 3-09 / 2 | 4 | 6.3 |
34 | 6149 | 5 | 3-48 | 5-12 / 1 | 4 | 3.8 |
35 | 6304 | 1 | 3-48 | 7-27 / 1 | 2 | 9.8 |
36 | 6300 | 1 | 4-34 | 3-03 / 2 | 6 | 0.4 |
37 | 6148 | 1 | 4-34 | 4-17 / 3 | 4 | 4.6 |
38 | 6145 | 4 | 4-34 | 5-05 / 3 | 6 | 1.8 |
39 | 6137 | 29 | 4-39 | 3-10 / 3 | 6 | 3.8 |
40 | 6136 | 2 | 4-59 | 5-24 / 3 | 5 | 9.1 |
41 | 6132 | 3 | 5-51 | 4-17 / 2 | 6 | 1.7 |
42 | 6133 | 1 | 5-51 | 4-23 / 2 | 5 | 2.1 |
43 | 6357 | 1 | 5-51 | 5-24 / 3 | 5 | 1.7 |
Clones represent scFv with the same V(D)J recombination that were either identical, carried mutations in the VH gene or paired with a different VL gene compared to the prototype scFv. The table is sorted on V, D and J gene families consecutively. The average nucleotide mutation frequency of each VH gene is shown.
Next we converted all 91 distinct scFv into full length IgG1 and characterised them based on binding and neutralization activity. A group of 55 clones represented by 13 mAbs with a unique V(D)J recombination were characterised by strong binding to different H5 rHA antigenic formats (data not shown) and
(a) Neutralizing activity of purified IgG1 against 100 TCID50 of H5N1 viruses, the 50% neutralizing concentration (IC50) was calculated by the Spearman-Karber method. (b) Immunoblot of H5 rHA probed with indicated IgG1. Molecular weight marker (MW) and subunit locations indicated.
IgG1 | Clones | IGHV | Neutralizing activity NIBRG-14 (µg/ml) | HAI (µg/ml) | H5 competition ELISA % binding to HA | |||
IC100 | IC50 | IC50 | CR6261-FITC | CR6323-FITC | ||||
CR6261 | 23 | 1-69 | 0.78 | 0.55 | >50 | 6 | 2 | |
CR6329 | 1 | 1-69 | 3.1 | 1.9 | >50 | 21 | 3 | |
CR6342 | 1 | 1-69 | 6.3 | 2.19 | >50 | 12 | 9 | |
CR6325 | 2 | 1-69 | 6.3 | 2.6 | >50 | 12 | 2 | |
CR6327 | 1 | 1-69 | 6.3 | 2.6 | >50 | 24 | 12 | |
CR6323 | 18 | 1-69 | 6.3 | 3.7 | >50 | 2 | -6 | |
CR6332 | 1 | 1-69 | 13 | 4.5 | >50 | 9 | -5 | |
CR6334 | 1 | 1-69 | 6.3 | 4.5 | >50 | 15 | 6 | |
CR6344 | 1 | 1-69 | 25 | 6.3 | >50 | 17 | 8 | |
CR6307 | 1 | 3-21 | 25 | 8.9 | >50 | 60 | 79 | |
CR6331 | 1 | 1-69 | 25 | 10 | >50 | 5 | -3 | |
CR6343 | 1 | 1-69 | 50 | 13 | >50 | 52 | 56 | |
CR6262 | 3 | 1-69 | 25 | 15 | >50 | 47 | 44 | |
CR5111 | 8 | 3-21 | >100 | >100 | >50 | 86 | 113 | |
Neg. Ctrl | NA | 1-69 | >100 | >100 | >50 | 100 | 108 |
Hemagglutination inhibition (HAI) and microneutralizing assay are described in the
Because the IgM+ memory B cell libraries were pooled before selection it was not possible to immediately determine if the neutralizing mAbs were rescued from B cells of a single donor or different donors; we addressed this issue in two ways. Analysis of individual IgM+ memory B cell libraries by specific RT-PCR and sequencing showed one of the three seasonal influenza vaccinated donors (#1020) was the source of at least 4 of the neutralizing mAbs (
(a) PCR amplification of cDNA from each donor IgM+ memory B cell library using oligonucleotide pairs designed so their 3′ ends specifically anneal in the HCDR1 and HCDR3 regions. Donors are indicated at the top of the figure. The expected size of the amplified fragment is indicated with an arrow. The identity of the bands was confirmed by sequencing (b) Binding and neutralizing activity of donor serum collected at the same time as the B cells used for library construction (note serum was not available for donor 12). IgM and IgG ELISA reactivity was measured against rHA and neutralizing activity against H1N1 (A/Hong Kong/54/98) and H5N1 (A/Vietnam/1203/04). Donor 1020 who was PCR positive for the tested neutralizing mAbs is indicated in bold.
Given the conserved nature of the HA2 subunit and its known ability to induce cross-reactive immune responses
(a) The binding activity of the IgG1 panel (5 µg/ml) was measured against 0.5 µg/ml directly coated recombinant HA antigen (see
The monovalent affinity of CR6261, CR6323 and CR6307 was measured by Biacore. The affinity of CR6261 and CR6323 was similar for rH1, rH5 and rH9 HA and in the low nanomolar range (
mAb | HA | Ka (1/Ms) | Kd (1/s) | KD (M) |
CR6261 | H1 | 9.8×105 | 3.7×10−3 | 3.8×10−9 |
H5 | 2.7×105 | 1.1×10−3 | 4.1×10−9 | |
H9 | 6.8×105 | 3.7×10−3 | 5.4×10−9 | |
CR6323 | H1 | 1.4×105 | 5.4×10−4 | 3.9×10−9 |
H5 | 1.9×105 | 1.2×10−3 | 6.3×10−9 | |
H9 | 1.3×106 | 2.7×10−3 | 2.1×10−9 | |
CR6307 | H5 | 7.0×104 | 4.5×10−4 | 6.4×10−9 |
Conserved structural correlates have been identified that support the classification of HA subtypes into groups and clades as described above
(a) FACS binding of IgG1 to surface expressed H5 rHA was measured after sequential treatment with trypsin (solid bars), pH 4.9 buffered medium (open bars) and DTT (striped bars) and expressed as percentage binding to untreated rHA from two independent experiments (mean±s.e.m.). (b) Global view of CR6261, VL is rose, VH is blue, HCDR2 is green, Thr56 red and Phe54 green. (c) Surface representation of trimeric H1 HA (A/South Carolina/1/18; 1RUZ). HA1 subunits are green, burgundy and pink, HA2 subunits yellow, blue and orange. The hydrophobic pocket is white and shown magnified as an inset with the HCDR2 of CR6261 in green docked to the structure. HA residues around and forming the hydrophobic pocket are labelled in black and HCDR2 residues in the pocket are green. (d) perpendicular view of the hydrophobic pocket down the axis of helix 38–55 occupied by Phe54 of HCDR2 in purple.
We next investigated the interaction of CR6261 with the helix 38–55 region by modelling. A 3-D structure of the VH-VL region of CR6261 was modelled by homology to framework regions and CDR fragments from existing x-ray crystal structures (
Surface representation of the hydrophobic pocket recognized by CR6261 from crystal structures of H5 (2IBX) and H9 (1JSD) and the corresponding region from crystal structures of H3 (1MQM) and H7 (1TI8). HA residues around and forming the hydrophobic pocket are indicated in black, H3 numbering is used throughout for consistency. Note the H38N and Q40T replacements in the H3 and H7 structures that introduce a potential glycosylation site in the region.
Several pieces of experimental evidence support the localisation of the antigenic region. First, CR6261 neutralisation escape variants of RG-A/Indonesia/5/05 were generated, after extensive passaging, that harboured a fixed mutation (H111L) in the HA2 subunit; viruses with this unique mutation were confirmed to be resistant to CR6261 neutralisation (IC50>100 µg/ml vs. 6.25 µg/ml for wild type). His111 is a conserved H1 and H9 group specific residue
(a) The hydrogen bond interaction of HA2 His111 with HA1 Thr318 is shown (circled red) in the H5 structure 2IBX. (b) An H3 structure (1MQM) is shown where the peptidic plane re-orientation of Thr318 is indicated by a red arrow.
Second, when H5 residues were substituted for corresponding H3 residues in the hydrophobic pocket reductions in surface expressed H5 rHA binding were measured for CR6261 and CR6323 (
(a) FACS binding of IgG1 to surface expressed mutants of H5 rHA. Mean fluorescent intensity (MFI) values were normalised by NIBRG-14 antiserum reactivity to the corresponding mutant and expressed as the average percentage of wild type H5 rHA binding from two independent experiments (see key for colour code). Adjacent are sequence alignments of the corresponding region, mutated residues are boxed. (b) FACS binding activity to WT or mutant H5 rHA performed as above for CR6261 (solid bars), CR6261 with the HCDR2 mutation F54L (open bars) or F54A (striped bars). MFI was normalised as above and expressed as mean±s.e.m. arbitrary units from two independent experiments.
Although our data argue that the IGHV1-69 CDR2 of CR6261 and the other mAbs has a critical role in forming the antigen binding site, this VH gene does not confer HA specificity by itself. A VH gene matched control antibody binding rabies virus glycoprotein failed to bind or neutralise H5N1 viruses (
Finally we observed that CR6307, which does not use the IGHV1-69 germline gene, is not subtype cross-reactive and only weakly competes with CR6261 or CR6323 for binding to rHA, does not appear to be sensitive to the mutations around the hydrophobic pocket (
We examined the
Kaplan-Meier survival curves of BALB/c mice were injected (i.p.) with CR6261 or irrelevant control (15 mg/kg) then challenged 24 h later (i.n.) with (a) 10 LD50 of A/Vietnam/1203/04 (n = 5) or (b) 25 LD50 A/WSN/33 (n = 10) and observed daily for a period of 21 days. Haematoxylin-Eosin stained lung sections taken 6 d.p.i from (c) CR6261 or (d) control mAb treated mice (1 d.p.i.) and challenged with 25 LD50 A/Hong Kong/156/97. (e) Survival (upper panel), mean±s.e.m. body weight, (middle panel) and median clinical signs (bottom panel) of mice (n = 10) challenged as in (c,d) and injected i.v. with 15 mg/kg CR6261 IgG1 3 (dark blue), 4 (light blue), 5 (green) or 6 days (orange) or control mAb (black dotted line) 4 days after challenge (see colored arrows in bottom panel). The day five time point at which therapeutic efficacy is lost is indicated by a grey box.
Clinical interventions to treat H5N1 infections generally begin after the onset of symptoms. To establish the effective treatment window of CR6261 a single dose (15 mg/kg) was injected i.v. to rapidly achieve peak circulating concentrations, 3, 4, 5 or 6 days after challenge with 25 LD50 A/Hong Kong/156/97 (
In this study we have built combinatorial libraries and selected a panel of human monoclonal antibodies against H5 HA from a particular compartment of memory B cells that are characterized by their continued expression of IgM on the surface. Our results suggest that IgM+ memory B cells express mAbs recognizing T-dependent antigens at high affinity, and consistent with a hallmark of memory B cells, all selected H5N1 mAbs contained mutated VH genes. Memory B cells are also generally defined by their rapid proliferation and differentiation into antibody secreting plasma cells on re-exposure to antigen. Yet from this study it is not clear that the IgM+ memory B cells expressing the cross-neutralizing HA specificities participate in a true recall response upon vaccination. An increase in serum neutralizing activity was measured in all vaccinated donors for H1N1 but not H5N1, even in donor #1020 from which the heterosubtypic neutralizing mAbs were isolated. Thus if the B cell clones expressing CR6261 and the other cross-reactive mAbs were present in the donor prior to vaccination (as would be expected) then a true recall response associated with differentiation into plasma cells has not likely occurred. Although we can not exclude the possibility that at later time points serological differences could have been measured the results are consistent with the observation that measurable heterosubtypic immunity is rare in the general population
We have not made a comparative analysis of other B cell compartments to investigate whether related clones are present in isotype switched memory cells or plasma cells of donor #1020 or other donors. However, preliminary data for a mAb isolated from the bone marrow of an H5N1 infected patient was recently reported that possesses cross-neutralizing activity between H5N1 and H1N1
The epitopes of CR6261, CR6323 and the other cross-neutralizing mAbs were localised to the stem domain of HA using a combination of homology modelling, mutagenesis and mapping with escape variants. This region is highly conserved and, based on comparisons at a sequence and structural level, appears to segregate into two groups one containing H1, H2, H5, H6, H8, H9, H11, H12, H13 and H16 subtypes and the other H3, H4, H7, H10, H14 and H15 subtypes. The neutralizing mAbs described in this study recognize antigenic determinants in the first group that confer different levels of neutralization potency against these subtypes but do not recognise representative virus strains from subtypes in the second group tested so far. Escape mutants of a murine anti-H2N2 mAb (C179) with cross-neutralizing activity to H1 subtypes but not H3 subtypes have also placed its epitope in this region
Development of clinical interventions against a potential influenza pandemic are challenged by uncertainty over future pandemic viral subtypes
Alignment of H2N2 HA sequences. (a) Amino acid alignment of sequences from CR6261 and CR6323 neutralised and non-neutralised influenza strains. Only residues that differ from the top sequence Human H2N2 (Hu_H2; A/Singapore/1/57) are shown, H3 numbering is used. Other sequences were Avian H2 (Av_H2; A/WF/Hong Kong/MPU3156/05), Human H5N1 (Hu_H5; A/Vietnam/1203/04), Avian H5N1 (Av_H5; A/Japanese white eye/Hong Kong/1038/06), Human H1N1 (Hu_H1; A/Hong Kong/54/98) and Avian H9N2 (Av_H9; A/Duck/Y280/97). Antigenic sites based on H1 are boxed Ca1 (red), Ca2 (burgundy), Cb (green), Sa (light blue) and Sb (yellow). Human H2N2 residues that fall outside the predicted antigenic sites and differ from the CR6261 neutralised avian H2N2 strain are boxed on the top sequence. (b) the antigenic sites from above are shown mapped onto a surface representation of H1N1 crystal structure (1RUZ) using the colour scheme above, the boxed unique residues of the non-neutralised human H2N2 strain are marked in dark blue on the surface.
(0.08 MB DOC)
We thank Carla Ophorst, Cynthia Leung, Els de Boer-Luitze, Erwin Claassen, Simon Riemersma, Gerrit Jan Weverling, Marion Cornelissen, Tonja van der Kuyl, Anna Arov and Herbert Heyneker for advice, assistance and reagents.