The authors have declared that no competing interests exist.
Conceived and designed the experiments: NPS UPS PN MN. Performed the experiments: NPS UPS HG. Analyzed the data: NPS UPS HG PN MN. Contributed reagents/materials/analysis tools: PN MN. Wrote the paper: NPS UPS PN MN.
MicroRNAs (miRs) are a class of small RNAs that regulate gene expression. There are over 700 miRs encoded in the mouse genome and modulate most of the cellular pathways and functions by controlling gene expression. However, there is not much known about the pathophysiological role of miRs. TCDD (2,3,7,8-tetrachlorodibenzo-
miR arrays of fetal thymocytes post exposure to TCDD and vehicle were performed. Of the 608 mouse miRs screened, 78 miRs were altered more than 1.5 fold and 28 miRs were changed more than 2 fold in fetal thymocytes post-TCDD exposure when compared to vehicle controls. We validated the expression of several of the miRs using RT-PCR. Furthermore, several of the miRs that were downregulated contained highly complementary sequence to the 3′-UTR region of AhR, CYP1A1, Fas and FasL. Also, the Ingenuity Pathway Analysis software and database was used to analyze the 78 miRs that exhibited significant expression changes and revealed that as many as 15 pathways may be affected.
These studies revealed that TCDD-mediated alterations in miR expression may be involved in the regulation of its toxicity including cancer, hepatic injury, apoptosis, and cellular development.
MicroRNAs (miRs) regulate gene expression. They are endogenously encoded in the genome and belong to a class of small RNAs. The miRs are initially transcribed as long primary transcripts (pri-miRs), which are subsequently modified into pre-miRs that possess approximately 70 nucleotide stem loop structures and are present within the nucleus. Pre-miRs are then exported from the nucleus to the cytoplasm and are modified again to mature miRs consisting of 19–25 nucleotide duplexes. Mature miRs are then incorporated into the RNA-induced silencing complex (RISC). The mature miRs guide the RISC to bind complementary sequences of the target genes most often in the 3′ UTR region
The biological significance of miR generation is evident by their ability to regulate gene expression causing serious effects on various physiological, pathological, and other biological mechanisms and functions. The miRs have been shown to regulate up to 30% of the mammalian genes
TCDD (Dioxin) belongs to a group of halogenated aromatic hydrocarbons and is well known for its immunotoxic and carcinogenic properties
Given that a large number of genes are regulated by miRs and that most of the biological processes including responses to TCDD are expected to be regulated by miRs, it is reasonable to hypothesize that there are certain types of miRs that regulate TCDD-mediated toxicity. Also, previous studies from our laboratory have suggested that prenatal exposure to TCDD causes marked changes in the immune response
Raw data obtained from miR arrays of fetal thymocytes post-TCDD or vehicle exposure were analyzed for miR expression. To this end, cluster analysis of 608 miRs was performed using Ward’s method in vehicle- and TCDD-treated samples and data were represented as columns. Similarity measure of miRs of the two groups was done using Half Square Euclidean Distance method and ordering function of miRs was done on the basis of Input rank. The visualization of cluster analysis of miRs have been shown as a dendrogram (a tree graph) based on the similarity between them (
A. Heat map depicting miR expression profile in fetal thymi exposed to TCDD with that of fetal thymi exposed to vehicle (control). The expression pattern (green to red) represents the spectrum of downregulated to upregulated expression pattern of miRs. B. Depicts fold change expression profile of miRs post-TCDD exposure in comparison to vehicle. Of the ∼251 miRs dysregulated, a significant number of miRs showed more than 1.5 fold change (upregulated or downregulated) in their expression profile. C. Venn diagram illustrating TCDD-mediated downregulated miRs (green circle) and upregulated miRs (red circle) when compared to vehicle.
Differential (upregulated or downregulated) expression of miRs was analyzed using 2-sample t-test method. The significance of analysis of microarrays was performed using Kaplan-Meier method. A p-value of <0.01 in the t-test was considered significant. Of the total 608 miRs screened, 251 miRs showed 1 or more than 1 fold upregulated or downregulated expression. There were 78 miRs that showed more than 1.5 fold change and 28 miRs with 2.0 or greater fold differential expression in TCDD group when compared to the vehicle (
To validate the miR array data, we studied several differentially expressed miRs (upregulated miRs: miR-122 and miR-181a and downregulated miRs: miR-23a, miR-18b, miR-31, and miR-182). To this end, Real-Time PCR was performed on cDNAs converted from total RNAs from thymocytes treated with TCDD or vehicle as described in Materials and Methods. Real-Time PCR analysis demonstrated upregulated expression of miR-122 and miR-181a in thymocytes treated with TCDD when compared to vehicle-treated thymocytes (
A, Expression profile of the miRs in fetal thymi was determined using miR-specific primers and by performing Real-Time PCR. Data are depicted as mean ± SEM of three independent experiments. Asterisk (*) in panel A indicates statistically significant (p<0.05) difference between groups compared. In panel B, miR expression profile from miR arrays are depicted.
Next, we performed further analysis of miR expression in TCDD-exposed fetal thymi when compared to controls. We selected miRs expressing more than 1.5 fold change for further analysis. To this end, 78 miRs were analyzed using Ingenuity Pathway Analysis (IPA) software and database (Ingenuity Systems, Inc). The analysis revealed that there were as many as 15 pathways that may be affected by various miRs dysregulated by TCDD in fetal thymi (
TCDD-induced up- or down-regulated (more than 1.5 fold change) miRs were analyzed using IPA software and the database (Ingenuity Systems, Inc). The data presented in the graph demonstrates various pathways regulated by TCDD-induced miRs. On Y-axis, –log(p-value) represents significance of function by random chance (IPA software, Ingenuity Systems, Inc). Number over each bar represents number of miRs involved in pathways.
TCDD-regulated miRs as described in
miRs | Fold change | Role in Apoptotic pathways and Immunotoxicity |
|
|
Regulate AhR gene expression |
|
|
Regulate AhR gene expression |
|
|
Regulate AhR gene expression |
|
|
Regulate AhR gene expression |
|
|
Regulate AhR gene expression |
|
|
Regulate AhR gene expression |
|
|
Regulate CYP1A1 gene expression |
|
|
Regulate CYP1A1 gene expression |
|
|
Regulate CYP1A1 gene expression |
|
|
Regulates Fas expression |
|
|
Regulates Fas expression |
|
|
Regulates FasL expression |
|
|
Regulates FasL expression |
|
|
Regulates FasL expression |
|
|
Causes apoptosis |
|
|
Induces apoptosis targeting BCL-xL |
There are several reports demonstrating that TCDD induces apoptosis in thymocytes leading to thymic atrophy
miR-23a and Fas 3′UTR binding3' ccUUUAGGGACCG-UUACACUa 5' mmu-miR-23a||||:: | : |||||||244:5' ugAAAUUUGUAUUAAAUGUGAa 3' Fas |
miR-18b and FasL 3′UTR binding3' gauugUCGUGA–UCUAC-GUGGAAu 5' mmu-miR-18b| ||:| ||| | ||||||310:5' uuuuaACCAUUGAAGAAGACACCUUu 3' FasL |
miR-31 and CYP1A1 3′UTR binding3' gucgauacgguCGUAGAACGGa 5' mmu-miR-31|| |||||||359:5' ggcacagagguGC-UCUUGCCa 3' CYP1A1 |
Mmu-let-7e and FasL 3′UTR binding3' uugauauGUUGGAGGAUGGAGu 5' mmu-let-7e| ||:| |||||||350:5' gguggguCUACUUACUACCUCa 3' FasL |
To further corroborate that in the same samples of fetal thymi that were analyzed for miRs, we could see changes in the expression of AhR, CYP1A1, Fas, and FasL genes as reported earlier
A, Fetal thymi exposed to TCDD as described in
Previous studies from our laboratory and others have reported TCDD- mediated upregulation in the expression of Fas and FasL in activated T cells and thymic cells
To further understand the role of mmu-let-7e in FasL expression, we performed a series of
A, EL4 cells, not transfected or transfected with mature mmu-let-7e and exposed to vehicle or TCDD, were analyzed for the expression of FasL by performing Real-Time PCR. In panel B, FasL expression was determined by performing Real-Time PCR on cDNAs generated from EL4 cells not transfected or transfected with mmu-let-7e or anti-mmu-let-7e or negative control (-Ve) for mmu-let-7e and exposed to vehicle or TCDD. Real-Time PCR data are presented as fold change in expression. Data are depicted as mean ± SEM of at least three independent experiments. Asterisks (* and #) in panel A and B indicate statistically significant (p<0.05) difference between groups compared. Panel C, FasL expression at the protein level in EL4 cells not transfected or transfected with mature mmu-let-7e or anti-mmu-let-7e and treated with vehicle or TCDD. Data are depicted as mean ± SEM of at least three independent experiments in panel D. Asterisks (* and #) in panel D indicate statistically significant (p<0.05) difference between groups compared.
Upon examination of FasL expression in these various forms of treatment in EL4 cells using Real-Time PCR, significantly upregulated expression of FasL was observed in TCDD-treated non-transfected EL4 cells, when compared to vehicle-treated non-transfected EL4 cells (
To understand TCDD-regulated expression of mmu-let-7e and its role in regulation of FasL expression, FasL UTR region containing normal mmu-let-7e complementary region or scramble FasL UTR region were cloned into pmiRGLO luciferase expression vector and the clones were designated as pmirGLO-FasL and pmirGLO-FasL-S respectively (as described in Materials and Methods). EL4 cells not transfetcted or transfected with pmirGLO-FasL or pmirGLO-FasL-S plasmids or transfected with mature mmu-let-7e or anti-mmu-let-7e were treated with vehicle or TCDD (100 nM/ml) for 24 hrs. There was ∼75% transfection of EL4 cells (
A: Determination of transfection efficiency of EL4 cells. EL4 cells were co-transfected with GFP containing vector and pmiRGLO-FasL plasmid and were analyzed using flow cytometry. There was more than 74% transfection of EL4 cells. B: Real-Time PCR was performed to determine luciferase expression by performing luciferase assays of EL4 cells not transfected or transfected with pmiRGLO-FasL or pmiRGLO-FasL S and exposed to vehicle or TCDD. Luciferase expression data are presented as fold change in expression. Data are depicted as mean ± SEM of three independent experiments. Asterisks (* and #) in panel B indicate statistically significant (p<0.05) difference between groups compared.
AhR signaling has been shown to be an important player in TCDD-induced thymic atrophy and immunotoxicity. Also, CYP1A1 induction is a hallmark of AhR activation by TCDD
TCDD has previously been shown to cause cancer in various species
miRs | Fold change |
Role in Cancer |
|
|
Role in liver metabolism and cancer |
|
|
Represses Mesenchymal Morphology in Ovarian Cancer cells |
|
|
Role in cancer development |
|
|
C-Myc expression through p53 |
|
|
Regulates MET Protooncogene and effects NF-KB expression |
|
|
Affects Brain Neuronal development |
|
|
Erythroid differentiation |
|
|
Angiogenic signaling and controls blood vessel development |
|
|
Regulates ERK5 signaling and smooth muscle cells |
|
|
Regulates CYPA3 expression |
|
|
Regulates Kinase activity and tumor progression |
|
||
|
|
Promotes lung cancer |
|
|
Inhibits prostate cancer and metastasis by repressing CD44 |
|
|
Epigenetically silenced miRNA and involved in gastric cancer |
|
|
Cancer development |
|
|
Cancer growth and development |
|
|
C-Myc expression through p53 |
|
|
Regulates MET Protooncogenes and effects NF-KB |
|
|
TGF-Beta inducer |
|
|
Mammary tumor development |
|
|
Tumor growth |
|
|
Breast cancer development and inhibits cell proliferation |
|
|
Cancer development |
|
|
Regulates RAS expression |
|
|
Regulates neural stem cell proliferation |
|
|
Role in Colorectal and other types of cancer |
TCDD toxicity has been well characterized to be regulated by signaling through the AhR leading to the induction of a wide range of genes that express DREs on their promoters
While, the immunotoxic effects of prenatal exposure to TCDD on fetal thymocytes have been well characterized, there are no reports on such effects of TCDD on miR profiles. Understanding the role of various miRs in neonatal mice post-TCDD exposure may shed light on the “fetal basis of adult disease” hypothesis. This hypothesis proposes that many chronic diseases including autoimmune diseases during adult stage of life may be the result of prenatal exposure to nutritional, environmental or other forms of stress
The cluster analysis data of miRs showed that TCDD caused significant changes in miR expression profile in fetal thymi when compared to vehicle-treated thymi. Of the miRs screened, 78 miRs were altered more than 1.5 fold and 28 miRs were altered two fold or more, post-TCDD exposure. We further validated the expression profile of some select miRs by performing Real-Time PCR. All the miRs that we analyzed by Real-Time PCR corroborated the data obtained from miR array analysis. Furthermore, the relationship of miRs and their target gene expression was also verified. For example, miRs that showed highly complementary sequence with 3′UTR of AhR, CYP1A1, Fas, and FasL genes were downregulated by TCDD in fetal thymi and the data obtained from RT-PCR showed upregulated expression of the above genes in fetal thymi post-TCDD exposure.
TCDD is known to induce toxicity in a wide range of tissues or organs. In this study, we noted TCDD-induced upregulation of the following miRs (miR-122, -125a, -151, 181a, -200b, -206, -322, -345, -367b, -296, and -466i) and their expression profile varied from 1.5 to 2.0 fold. As shown in
miRs | Fold change |
Role in various Tissues |
|
|
Role in liver metabolism |
|
|
Represses mesenchymal morphology in ovarian cancer cells |
|
|
Involved in osteoclastogenesis and etiology of osteoporosis |
|
|
Modulator of T cell sensitivity and selection |
|
|
Epithelial to mesenchymal transition (EMT) cancer tissues |
|
|
Regulates connexin43 during skeletal muscle development |
|
|
Muscle differentiation and promotes cell cycle quiescence |
|
|
Post-transcriptional regulation of gene in multicellular organisms |
|
|
Regulates thrombospondin-2 (Thbs-2) in placenta |
|
|
Regulates heart development |
|
|
Regulates growth factor receptor overexpression in angiogenic endothelial cells |
|
||
|
|
Promotes endocrine resistance to breast cancer downregulating Bcl-2 |
|
|
Mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells |
|
|
Expressed in cartilage tissues of mouse embryos and targets histone deacetylase-4 gene |
|
|
Inhibits glioma cell migration and invasion by targeting MMPs |
|
|
Involved in the p53 tumor suppressor network with significant effect on cell cycle control and cell proliferation |
|
|
Targets HDAC-1 and induces growth arrest in prostate cancer |
As miRs function as negative regulators of gene expression, we considered miRs that were altered more than 1.5 fold, as also reported in other studies
There were at least six miRs (miR-23a, -23b, -18b, -98, 200a, and -491) that were significantly downregulated (
TCDD has also been shown to cause cancer in various species and it is also considered to be a potential carcinogen in humans
Similarly, there were at least 14 miRs (miR-31, -34a, -181c, -671, -700, -669, -500, -491, -466, -466c, -449a, -134a, mmu-let-7b, mmu-let-7c, and mmu-let-7e) that were downregulated (>1.5 fold) by TCDD in fetal thymi and these miRs have also been shown directly/indirectly to be associated with various types of cancer development. For example, miR-31 has been shown to promote lung cancer
In summary, we demonstrate for the first time that exposure to environmental toxicants such as TCDD during pregnancy can have a significant effect on the miR profile of fetal thymus and thereby influence the regulation of a large number of genes that may affect the development of the immune system. Identification of miRs as targets for TCDD-induced modulation of gene expression offers insights into novel pathways to further understand the mechanisms of toxicity.
Pregnant C57BL/6 mice (timed pregnant: vaginal plug day 0) were purchased from Jackson Laboratory.
The mice were cared and maintained in microisolator cages under conventional housing conditions at the AAALAC-accredited University of South Carolina School of Medicine Animal Resource Facility. IACUC committee of University of South Carolina approved the use of mice for this study (IACUC No: 2033 and date of approval: 09-15-11). Six mice were used in each experimental group and the study was repeated three times.
TCDD was kindly provided by Dr. Steve Safe (Institute of Biosciences & Technology, Texas A&M Health Sciences Center, College Station, Texas). TCDD suspended in corn oil was used in
To determine the prenatal effect of TCDD on miR profile in thymic cell populations of fetuses, a single dose of TCDD (10 µg/kg) or vehicle was administered (ip) into pregnant C57BL/6 mice on GD 14, as described previously
Thymi from fetuses of TCDD or vehicle-treated groups of mice were harvested and transferred in complete RPMI-1640 medium. Single cell suspensions of thymi were prepared as described earlier
Total RNA including miRs from fetal thymi exposed to TCDD or vehicle was isolated using miRNeasy kit and according to the manufacturer’s instructions (Qiagen, Valencia, CA). The RNA was hybridized on Affymetrix GeneChip (2.0) high-throughput miR arrays. The data generated from miR arrays were analyzed using hierarchical clustering and pathway network analysis for the induction or repression. The expression of miRs was analyzed using 2-sample t-test. A p-value of <0.01 in the t-test was considered significant. A fold-change (FC) of more than 1.5 between vehicle and control samples was considered positive, as reported in other studies
To validate the expression of some of the miRs obtained from high-throughput miR array data, we selected 2 upregulated miRs (miR-122 and miR-181b) and 3 downregulated miRs (miR-23a, miR-98, and miR-31). Real-Time PCR assays were performed on cDNA generated from total RNA including miRs isolated from fetal thymocytes exposed to TCDD or vehicle as described earlier. We used miScript primer assays kit (details in
miRBase ID | Target Sequences | Qiagen Cat No |
Mmu-miR-23a_st | AUCACAUUGCCAGGGAUUUCC | MS00007266 |
Mmu-miR-18b_st | UAAGGUGCAUCUAGUGCUGUUAG | MS00011326 |
Mmu-let-7e_st | UUGAUAUGUUGGAGGAUGGAGU | PM12855 Applied Biosys |
Mmu-miR-31_st | AGGCAAGAUGCUGGCAUAGCUG | MS00001407 |
Mmu-miR-182_st | UUUGGCAAUGGUAGAACUCACACCG | MS00011291 |
Mmu-miR-122_st | UGGAGUGUGACAAUGGUGUUUG | MS00001526 |
Mmu-miR-181a_st | AACAUUCAACGCUGUCGGUGAGU | MS00011263 |
We used StepOnePlus Real-Time PCR system V2.1 (Applied Biosystems, Carlsbad, CA) and at the following conditions: 40 cycles using the following conditions: 15 min at 95°C (initial activation step), 15 s at 94°C (denaturing temperature), 30 s at 55°C (annealing temperature), and 30 s at 70°C (extension temperature and fluorescence data collection) were used. Normalized expression (NE) of miRs was calculated using NE ¼ 2_DDCt, where Ct is the threshold cycle to detect fluorescence. The data were normalized to various miRs against internal control miR and fold change of miRs were calculated against control miR, and treatment group (TCDD) was compared with vehicle group. To define significant differences in miR levels in the thymi of TCDD- or vehicle-treated groups, ANOVA was performed using GraphPad version 4.0 (GraphPad Software, Inc., San Diego, CA). Differences between treatment groups were considered significant when: p<0.05.
For the generation of heatmap and analysis of miR expression, we selected miRs that were up- or downregulated more than 1.5 fold in fetal thymi exposed to TCDD, when compared to vehicle controls. Next, the selected miRs were analyzed for their role in expression of various genes and pathways using IPA software and database (version 15, Ingenuity Systems Inc., CA).
We identified miR-specific mRNA targets using micro RNA.org, TargetScan mouse 5.1, and miRGEN (version 3) software and databases. Computational algorithms supported this task by examining base-pairing rules between miR and mRNA target sites, location of binding sites within the target’s 3′-UTR, and conservation of target binding sequences within related genomes. The details of some of miRs and 3′UTR of their target gene (mRNA targets) are described in
To understand the role of mmu-let-7e in regulation of FasL expression, EL4 cells (5×106) were transfected using Lipofectamine RNAMAX transfection kit from Invitrogen and following Reverse Transfection protocol of the company (Invitrogen). Forty eight hrs post transfection, EL4 cells were treated with vehicle or TCDD (100 nM/ml) for 24 hrs. The expression of FasL was determined in the absence or presence of TCDD. In brief, total RNA from EL4 cells not transfected or transfected with mmu-let-7e or anti-let-7e and treated with vehicle or TCDD were isolated using RNeasy mini kit and following the protocol of the company (Qiagen, Valencia, CA). First strand cDNA synthesis was performed on total RNA (1 µg) and using iScript Kit and following the protocol of the company (Bio-Rad). Real-Time PCR was performed to determine the expression of FasL using mouse FasL-specific sets of primers as described elsewhere
We also performed Western blotting to determine FasL expression at the protein level in EL4 cells not transfected or transfected with mmu-let-7e or anti-mmu-let-7e and treated with vehicle or TCDD. To this end, we used FasL-specific polyclonal antibody that cross reacts with mouse FasL (Millipore, Temecula, CA). Western blotting was performed following the protocol of the company and as described earlier
Reporter construct was generated containing mouse FasL UTR DNA sequences. To this end, we used pmirGLO reporter vector from Promega (Promega Corporation, Madison, WI). pmirGLO reporter vector contains two luciferase genes, 1) firefly luciferase reporter gene (luc2) that generates luminescence in the absence of microRNA and 2) Renilla luciferase reporter gene (hRluc-neo fusion protein coding region) that generates luminescence in presence of microRNA. Mouse FasL-specific UTR region complementary to let-7e was cloned into pmirGLO vector and these were designated as pmirGLO-FasL or pmirGLO-FasL scramble (pmiRGLO-FasL S). The details of the FasL sequences cloned into pmiRGLO are as described below.
Both nucleotides of normal and scramble mmu-let-7e-specific FasL UTR regions contain Pmel and Xba1 restriction sites.
Mmu-let-7e sense target sequence:
5′-
Mmu-let-7e antisense target sequence:
5′-
Mmu-let-7e scramble sense target sequence:
5′-
Mmu-let-7e scramble antisense target sequence:
5′-
Oligonucleotides pairs containing Pmel and Xba1 restriction sites (forward and reverse) of mouse FasL UTR region specific to mouse mmu-let-7e were generated by IDT DNA (IDT Inc). Both oligonucleotides (2 µl of each oligonucleotide) of normal or scramble mouse FasL UTR (specific to mmu-let-7e) regions were annealed in the presence of oligo annealing buffer (46 µl) at 90°C for 3 minutes and 37°C for 15 minutes. The annealed oligonucleotides of normal or scramble FasL UTR regions were used immediately for cloning into pmirGLO vector or stored at −20°C.
Annealed oligonucleotides of normal or scramble FasL UTR were ligated to pmirGLO vector restricted with Pmel and Xba1 following the protocol of the company (Promega Corporation, Madison, WI). Ligated pmirGLO-FasL normal or pmirGLO-FasL- S UTR regions were transformed into competent bacterial (DH5 α) cells and positive clones were selected for further use after confirming the clones by sequencing. Positive selected clones were designated as pmirGLO-FasL for clones that contain normal FasL UTR and pmirGLO-FasL-S that contains scramble FasL UTR sequence.
Freshly cultured EL4 cells (5×106) were transfected with 5–10 µg of pmirGLO-FasL or pmirGLO-FasL-Scramble plasmids using Amaxa Nucleofector instrument and EL4 transfection kits from Lonza and following the protocol of the company (Lonza Cologne GMBH, Cologne, Germany). EL4 cells were also transfected independently with Pre-miR miRNA precursors of mmu-let-7e (MI0000561; PM12855) and anti-miR miRNA inhibitors (scramble mmu-let-7e) (MI0000561; AM12855) and negative controls for both from Applied Biosystems (Applied Biosystems) or in combination with pmirGLO-FasL or pmirGLO-FasL-S plasmids. We used Lipofectamine RNAMAX transfection kit and followed Reverse Transfection protocol of the company (Invitrogen). Two days post transfection, EL4 cells were replated in triplicate in 96-well plate (75 µl/well) and the cells were treated with vehicle or TCDD (100 nM/ml) and incubated for 24 h at 37°C, 5% CO2. Following treatments with vehicle or TCDD, luciferase assays were performed using Dual-Glo Luciferase Assay system from Promega and following the protocol of the company (Promega Corporation, Madison, WI). In brief, equal volume (75 µl/well) of Dual-Glo reagent was added to each well and thoroughly mixed. The cells were incubated for 10–15 minutes at room temperature to allow for cell lysis to occur. Firefly luciferase activity was measured by reading the sample luminescence using Victor2 (Perkin Elmer). After first reading of the samples, Dual-Glo Stop & Glo reagent (75 µl/well) was added to each well, mixed thoroughly, and incubated for 10–15 minutes. Renilla luminescence was measured by reading the sample luminescence using Victor2 (Perkin Elmer). Ratio of luminescence from experimental samples to luminescence from the control reporter was calculated. Luminescence ratio was then normalized to the ratio of control wells. Relative luminescence ratio was calculated from the normalized ratios and values were expressed as “normalized-fold induction.”
Total RNA from fetal thymocytes treated with TCDD or vehicle was isolated using RNeasy mini kit from Qiagen and following the protocol of the company (Qiagen, Valencia, CA). First strand cDNA synthesis was performed on total RNA (2 µg) and using iScript Kit and following the protocol of the company (Bio-Rad). To detect the expression of AhR, CYP1A1, Fas, and FasL, sets of primers specific to mouse AhR, CYP1A1, Fas, and FasL were used and PCR was performed as described earlier
Statistical analyses were performed using GraphPad Prism software (San Diego, CA).
Differential (upregulated or downregulated) expression of miRs was analyzed using 2-sample t-test method. The significance of analysis of microarrays was performed using Kaplan-Meier method. Student’s t-test was also used for paired observations if data followed a normal distribution to compare TCDD-induced expression and quantification of CYP1A1 and other genes in thymocytes. Multiple comparisons were made using ANOVA (one-way analysis of variance) test and Tukey-Kramer Multiple Comparisons Test. P-value of ≤0.05 was considered to be statistically significant.