We have the following interests. The institution of some of the authors SRG, EP and FPR at the Hospital for Special Surgery, New York has received grants from Boehringer Ingelheim. SRG serves on the board of and owns stock in Telik Inc and is a paid consultant to Bone Therapeutics. There are no patents, products in development or marketed products to declare. This does not alter our adherence to all the PLOS ONE policies on sharing data and materials, as detailed online in the guide for authors.
Conceived and designed the experiments: MRS WKT SRG FPR JHH. Performed the experiments: MRS WKT SRG FPR JHH PEP AS. Analyzed the data: MRS SRG FPR JHH PEP BOW. Contributed reagents/materials/analysis tools: MRS SRG JHH PEP BOW. Wrote the manuscript: MRS WKT SRG FPR JHH PEP.
Giant cell tumor of bone (GCTB) is a benign, locally destructive neoplasm, with tumors comprised of mesenchymal fibroblast-like stromal cells; monocytic, mononuclear cells of myeloid lineage; and the characteristic osteoclast-like, multinucleated giant cells. Hampering the study of the complex interaction of its constituent cell types is the propensity of longstanding, repeatedly passaged cell cultures to undergo phenotypic alteration and loss of osteoclast-inducing capacities. In this study, we employed a novel, single-step technique to purify freshly harvested stromal cells using a CD14-negative selection column. Using 9 freshly harvested GCTB specimens and the purified stromal cell component, we performed analyses for markers of osteoblast lineage and analyzed the capacity of the stromal cells to undergo osteoblastic differentiation and induce osteoclastogenesis in co-cultures with monocytic cells. Successful purification of the CD14-negative stromal cells was confirmed via flow cytometric analysis and immunocytochemistry. Osteogenic media upregulated the expression of osteocalcin, suggesting an osteoblastic lineage of the GCTB stromal cells. The effects of the Wnt pathway agonist, SB415286, and recombinant human bone morphogenetic protein (BMP)-2 on osteoblastogenesis varied among samples. Notably, osteogenic media and SB415286 reversed the receptor activator of NF-κB ligand (RANKL)/osteoprotegerin (OPG) expression ratio resulting in diminished osteoclastogenic capacity. Recombinant human BMP2 had the opposite effect, resulting in enhanced and sustained support of osteoclastogenesis. Targeting the giant cell tumor stromal cell may be an effective adjunct to existing anti-resorptive strategies.
Giant cell tumor of bone (GCTB) is a benign, locally aggressive neoplasm that arises within the epiphyseal regions of long bones, as well as axial sites such as the sacrum or spine [
Although characteristically osteolytic, bone formation does occur in GCTB under certain circumstances. Scattered nodules develop within the neoplastic tissue in up to 30% of cases [
GCTB stromal cells play an essential role in the recruitment of the tumor-associated myeloid lineage cells and formation of the osteoclast-like giant cells [
To date, studies of GCTB stromal cells have employed cell populations purified through serial passaging of the tumor cells. The extended time in culture and repeated passaging, however, are associated with a progressive alteration in the original biologic activities and functional properties of the stromal cells, including a gradual loss in the ability of the stromal cells to induce osteoclasts when co-cultured with myeloid lineage osteoclast precursors [
Nine GCTB specimens were freshly harvested in accordance with protocols and informed patient consent waivers approved by the Hospital for Special Surgery’s Institutional Review Board. Clinical information for each patient is shown in
1 | 40 | M | Sacrum | 8.2 | Yes |
2 | 42 | F | Distal femur | 6.0 | No |
3 | 39 | F | Distal femur | 7.0 | No |
4 | 28 | M | Distal femur | 5.7 | No |
5 | 24 | F | Distal femur | 6.0 | No |
6 | 51 | F | Patella | 2.0 | No |
7 | 36 | M | Distal femur | 6.0 | No |
8 | 18 | F | Distal femur | 4.5 | No |
9 | 43 | F | Distal femur | 5.0 | No |
* Maximal diameter determined based on preoperative radiographic measurement.
The freshly harvested GCTB tissue was minced and digested with 0.1 mg/mL type I collagenase (Worthington, Lakewood, NJ) in MEM-α for 1 hour with frequent agitation. Dispersed cells were passed through a 70 µM nylon filter and cells were counted. Stromal cells were isolated using a negative selection technique, in which total dispersed cells were labeled with magnetic beads bound to a monocyte marker, CD14 (Miltenyi Biotech, Auburn, CA), according to the manufacturer’s recommendations, then passed through a magnetized column. CD14 surface expression in the adherent and non-adherent fractions was characterized by analytical flow cytometry analysis (FACS Aria®) (anti-CD14 antibody ab28061; ABCAM®; Cambridge, MA) and immunocytochemistry according to manufacturer’s protocol. The initial non-adherent, CD14-negative fraction was highly enriched in GCTB stromal cells (
(A) Flow cytometry analysis of CD14+ cell population in total dispersed cells, stromal cell fraction and column retained fraction after CD14 negative selection column separation (top row: unstained control; bottom row: FITC-labeled anti-CD14 Ab). (B) Post-column separation phase contrast microscopy demonstrating morphology consistent with GCT stromal cells (left) and a combination of multinucleated giant cells plus monocytic, mononuclear cells (right). (C) CD14 immunofluorescence of cells grown on glass coverslips from the stromal cell (left) and column retained fractions (right). (D) Isolated GCT stromal cells maintain their ability to induce osteoclast formation in co-culture with human peripheral blood monocytes.
Freshly isolated GCTB stromal cells were plated in MEM-α supplemented with 10% fetal bovine serum (FBS) at 50,000 cells per well in a 12-well plate. Cells were grown in the presence or absence of the glycogen synthase kinase (GSK) 3β inhibitor, SB415286 (10 µM) (GlaxoSmithKline, Middlesex, UK) [
Reverse transcription of purified RNA to cDNA was performed using a commercially available kit (Fermentas; Glen Burnie, MD). After performing quantitative real-time PCR (qPCR) using a Biorad ICycler platform and SYBR green master mix (BioRad, Hercules, CA), the relative expression levels for each gene were determined using the ΔΔCt method, normalized to the expression level of the housekeeping gene
OPG | CCGCGTGTGCGAATGCAAGG | TGGGGTTCCAGCTTGCACCAC |
RANKL | AAGGAGCTGTGCAAAAGGAATT | TGATGTGCTGTGATCCAACGA |
Osteocalcin | CTGCGATGACACAGCAAATC | GGACTTTGCCTTCTTCCACA |
Osterix | TTCTGACTGTCTGCCCAGTG | GCCTTGTACCAGGAGCCATA |
ALP | CCACGTCTTCACATTTGGTG | GCAGTGAAGGGCTTCTTGTC |
BMP2 | ACATGGTTGTGGAGGGTTGT | CAACTGGGGTGGGGTTTT |
BMP3 | TAGAGTCTTGCGCTTGCAGA | GAAACAAAATGCATTGGCAGT |
BMP4 | TCCATGCTGTACCTGGATGA | GGAACGTGTGTGTGTGGTGT |
BMP6 | GCGCCAACTAAGCTAAATGC | TCCAAGGCAGAATGTGTGTC |
BMP7 | TGCCATCTCCGTCCTCTACT | GCAATGGAGGATCCAGAAAA |
ALK2 | CAAAATCCATCCGCAAGACT | GCTGGACAATGACAACAACG |
ALK3 | AGCCTCCAGACTCACAGCAT | CATGCCATGGGTAAAAACAG |
ALK6 | CCTGCGGGTTAAGAAAACAC | CTCTGCCCACAAACAGAAGA |
BMPRII | TCTTTTCTTTGCCCTCCTGA | AGCAGGATGGTCCATGGTAG |
Runx2 | TCTGGCCTTCCACTCTCAGT | ATGAAATGCTTGGGAACTGC |
Freshly isolated GCTB stromal cells were plated at 5×106 cells/well and exposed to vehicle or BMP2 or SB415286 for 0-4 hours. Protein extraction was carried out in 1X SDS lysis buffer (100 mM Tris pH 6.8, 2% SDS, 2.5% β-mercaptoethanol, 15% glycerol, 0.2 mg/mL bromophenol blue, 1 mM phenylmethanesulfonylfluoride (PMSF) (Sigma-Aldrich, St. Louis, MO) on ice. Samples were boiled for 5 minutes, loaded onto a 10% Tris-HCl precast gel (Biorad, Hercules, CA), and run at 200 V for 1 hour in 1X Tris/glycine/SDS buffer. Semi-dry transfer to a PVDF membrane (Millipore, Billerica, MA) was performed in 1X Towbin buffer, followed by blocking with 5% nonfat dry milk solution in phosphate-buffered saline (PBS)-Tween 20. Primary antibodies used were mouse anti-active-β-catenin, clone 8E7 (1:1000) (Millipore, Billerica, MA) or rabbit anti-Phospho-Smad1/5 (Ser463/465) (41D10) (1:1000) (Cell Signaling Technology, Beverly, MA); followed by secondary anti-mouse horseradish peroxidase (HRP) (1:10,000) (Sigma Aldrich, St. Louis, MO) or anti-rabbit HRP (1:10,000) (Sigma-Aldrich, St. Louis, MO). ECL detection reagent was applied (GE Healthcare Biosciences; Pittsburgh, PA) and digital images were acquired on a commercially available fluorescent imager (Biorad, Hercules, CA).
Freshly isolated, peripheral blood monocytes were obtained from human donors, as previously described [
Flow cytometry analysis of total dispersed tumor cells identified a population of CD14+ myeloid cells, and fractionation using anti-CD14 magnetic beads separated these CD14+ cells from the CD14-negative population with high efficiency (
To assess the constitutive phenotype of CD14-negative cells from the different tumors, purified RNA was prepared from freshly sorted cells and reverse transcribed to cDNA, followed by quantitative PCR to examine the expression levels of osteoblast lineage genes. Despite the use of primary freshly isolated cells, the mRNA levels for four representative osteoblast genes (Runx2, Osx, ALP, and osteocalcin) were highly variable. Several approaches were undertaken to further characterize the osteoblast lineage of the CD14-negative cells. First, sorted stromal cells were grown in the presence or absence of osteogenic media. As shown in
GAPDH-normalized mRNA levels of osteocalcin in cells cultured for 12 days in MEM-α or osteogenic media. (A) Osteogenic media induced osteocalcin expression (p<0.05). (B) Von Kossa staining demonstrates enhanced matrix deposition in the presence of mineralizing culture conditions.
Previous studies have shown that the differentiation of osteoblasts from mesenchymal precursors is regulated by the Wnt and BMP signaling pathways [
(A) GAPDH-normalized expression (qPCR) of osteocalcin mRNA levels after 12 days of growth in MEM-α with or without the Wnt signal activator, SB415286 (p= 0.78). (B) Western blot of hypophosphorylated beta-catenin after treatment of cultures with SB415286 for 0, 1, or 4 hours, indicating up-regulation of Wnt signaling.
To further examine the osteogenic potential of the tumor stromal cells, CD14-negative stromal cells were treated with recombinant human BMP2 (rhBMP2). There were no differences in median expression levels of Osx (p=0.27), ALP (p=0.25), Runx2 (p=0.58), or osteocalcin (p=0.78), in response to BMP2 (
(A) GAPDH-normalized expression (qPCR) of osteocalcin mRNA levels after 12 days of growth in MEM-α in the absence or presence of recombinant human BMP2. (B) Western blot analysis of phsopho-Smad 1/5 at 1 and 3 hours after treatment of cultures with vehicle or BMP2, indicating up-regulation of BMP signaling.
Existing evidence suggests that the pro-osteoclastogenic capacity of GCTB stromal cells is associated with a high expression ratio of RANKL/OPG [
(A) Freshly isolated stromal cells were cultured for 12 days in MEM-α alone, in osteogenic media, or in medium supplemented with SB415286 or BMP2. The ratio of OPG/RANKL mRNA levels are presented relative to the ratio obtained by culture in MEM-α. While BMP2 suppresses the ratio, SB415286 increases it and osteogenic conditions fail to alter the values. The results for BMP2 treatment differs from that of cells grown in osteogenic media. (B) GCT stromal cells were cultured in the presence or absence of rhBMP-2 in MEM-α media over 21 days. Normalized OPG/RANKL ratios are presented relative to the ratio in untreated, freshly-isolated cells.
As seen with culture in MEM-α, GCTB stromal cells grown in osteogenic media expressed increased levels of OPG mRNA, but the effects on RANKL mRNA levels varied (data not shown). Nevertheless, overall, the OPG/RANKL mRNA ratios were increased in comparison to control cultures grown in standard MEM-α (p<0.05) (
Because the above studies were terminated at the single time point of 12 days, we next sought to determine whether OPG and RANKL expression changed as a function of time, particularly following treatment with BMP2. GCTB stromal cells were freshly isolated from 3 independent samples, and grown in the presence or absence of rhBMP2 over a 21-day period (representative study shown in
To confirm that the alterations in the OPG mRNA levels described in
Stromal cells were cultured for 12 days in MEM-α, osteogenic media, or with medium supplemented with SB415286, or rhBMP2. OPG production in culture media was suppressed by BMP2 but increased in the presence of osteogenic media or SB415286 from culture days 10-12 as determined by ELISA.
Co-culture of GCTB stromal cells with human peripheral blood monocytes resulted in a marked stimulation of osteoclast formation in all samples tested (data not shown), as quantified by triplicate counts of TRAP+ multinucleated giant cells. Pretreatment of the GCTB stromal cells with osteogenic media or the Wnt/β-catenin pathway activator SB415286 resulted in significant reductions in the osteoclast-inducing activity compared to the controls (p<0.05) (
Human peripheral blood monocytes were added to GCTB stromal cells pre-exposed to 12 days of MEM-α media supplemented with (A) SB415286, (B) osteogenic media, or (C) rhBMP2. The number of osteoclasts, enumerated as TRAP+ multinucleated cells, is shown.
A previous publication reported the presence of mRNA for several BMPs in stromal cells cultured from GCTB [
Freshly isolated GCTB stromal cells from three tumors were assayed for GAPDH-normalized mRNA expression of BMPs 2, 3, 4, 6, and 7 as well as ALK2, ALK3, ALK6 and BMPRII by qPCR.
In this investigation, we used histologic evaluation of GCTB and
It is conceivable that our strategy of extracting CD14+ monocyte-lineage cells and co-localizing MNGC’s from total dispersed cells did not effectively separate other cells known to be present in GCTB such as macrophage precursors, osteoclasts, endothelial cells, or cells of the adaptive immune system. However, GCTB stromal cells isolated using the CD14 negative selection technique (1) were morphologically consistent with cells of osteoblast-lineage; (2) were enriched in osteoblast markers; (3) were capable of undergoing terminal differentiation in the presence of mineralizing culture conditions; and (4) strongly induced osteoclastogenesis in co-culture with human monocytes. These data indicate that our method of isolation was specific for isolating a highly enriched, functional population of GCTB stromal cells. Further refinement of this isolation method is ongoing, as is an effort to validate these findings beyond the limited number of samples demonstrated herein.
Our experiments demonstrated that negatively selected, uncultured stromal cells can undergo further differentiation and matrix mineralization under pro-osteogenic conditions. Although activation of Wnt and BMP signaling pathways promoted differentiation, the baseline characteristics and responsiveness to Wnt and BMP agonists varied extensively between different tumors. The observed variability in osteoblast-associated gene expression, the effects of the various culture conditions on gene expression profiles, and the functional properties of the cells may have resulted from the heterogeneity of the patients from which specimens were obtained, as well as their varied treatment-related factors (
Previous assertions that GCTB stromal cells are of osteoblast lineage were based on their expression of osteoblast and pre-osteoblast molecular markers [
Previous studies have provided evidence that GCTB stromal cells exhibit osteoclastogenic activity when co-cultured with monocytic osteoclast precursors [
Culture of our CD14-negative stromal cells under osteoblast-inducing conditions resulted in a striking reversal in the OPG/RANKL ratios involving both up-regulation of OPG and downregulation of RANKL. Both the osteogenic media and the activation of the Wnt/β-catenin signal pathway by the GSK-3 inhibitor enhanced OPG expression and increased the OPG/RANKL ratio compared to control. Although the mechanism by which the osteogenic media produced these effects is not known, we speculate that the effects of SB415286 were related to increased expression of dephosphorylated β-catenin (
The loss of osteoclast-inducing capacity after induction of differentiation of the stromal cells into a more definitive osteoblast phenotype has important and potentially promising clinical implications for the therapeutic inhibition of GCTB osteolytic activity. In a recent study of patients with refractory, non-resectable GCTB, treatment with denosumab, a human monoclonal antibody that binds and inhibits RANKL, resulted in depletion of tumoral giant cells, accompanied by inhibition of osteolytic progression in a majority of patients [
In contrast to the findings with osteogenic media and Wnt/β-catenin pathway activation, we found that BMP treatment of stromal cells inhibited the effects of long-term culture on the increase in the OPG/RANKL ratio. Importantly, these results were accompanied by maintenance of the osteoclast–inducing capacity of the stromal cells even after prolonged culture. BMP ligands are members of the Transforming Growth Factor Beta superfamily of proteins and initially bind to the Type II receptor resulting in recruitment, dimerization and phosphorylation of the Type I receptor. Receptor dimerization drives formation of R-SMAD/co-SMAD complexes that, upon nuclear translocation, function as transcription factors regulating cell proliferation, apoptosis, and differentiation [
Recent data have suggested that activation of the BMP/SMAD signal pathway also may enhance osteoclastogenesis through direct effects on osteoclast precursors [
In summary, our studies confirm that GCTB stromal cells are of osteoblast lineage, as evidenced by their capacity for expression of definitive markers of differentiated osteoblasts and initiation of bone mineralization under osteogenic conditions. We speculate that the arrest of the stromal cells in a state of early osteoblast differentiation is associated with up-regulation of RANKL production and that the production of this potent osteoclast-inducing factor accounts for the unique capacity of the tumors to form multinucleated osteoclasts and to induce osteolysis. Our findings that activation of the Wnt/β-catenin and BMP pathways differentially modulate the phenotype and osteoclast-inducing activity of the stromal cells has potential clinical applications for treating patients with refractory destructive GCTB.