Conceived and designed the experiments: RS NM LBB DJE JB DS MSM CAW SAH. Performed the experiments: RS NM LBB MSM MF NW CH CB RK RL DD MWE IY. Analyzed the data: RS NM CM RH HM DT RW FL TAH MSM CAW. Contributed reagents/materials/analysis tools: RS NM LBB MF RL JB DS MSM MW DN CAW DS. Wrote the paper: RS NM RH CAW DJE.
Current address: Fisher BioServices, Germantown, Maryland, United States of America
Current address: Center for Genomic Sciences, Allegheny-Singer Research Institute, Pittsburgh, Pennsylvania, United States of America
R.S. and other authors with affiliation listed as Ibis Biosciences Inc., are employees of Ibis Biosciences, a subsidiary of Abbott Molecular, Inc., which manufactures the instruments and reagents used in this study. N.M. and other authors with affiliations listed as MRIGlobal are employees of MRIGlobal, an independent, not-for-profit contract research organization that was funded by Ibis and the Department of Homeland Security to carry out the validation studies. The opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the United States Army or the Pentagon Force Protection Agency.
Technology for comprehensive identification of biothreats in environmental and clinical specimens is needed to protect citizens in the case of a biological attack. This is a challenge because there are dozens of bacterial and viral species that might be used in a biological attack and many have closely related near-neighbor organisms that are harmless. The biothreat agent, along with its near neighbors, can be thought of as a
Technology for detecting biothreat agents requires accurate identification of a broad array of bacterial and viral organisms that can cause severe disease and/or death, whether they occur as a result of a biological attack or from a natural source in the environment. The National Institute of Allergy and Infectious Diseases (NIAID) has compiled a list of priority pathogens for biodefense (
This requirement presents a problem for conventional molecular methods where specific PCR is used in conjunction with probes to detect specific bioagents. Not only are potentially pathogenic near neighbors present in a specimen often not distinguished, but the near neighbors sometimes react to produce false positives for the biothreat agent. To overcome these limitations, we have developed a new strategy for biothreat identification that couples biothreat cluster-specific PCR amplification to electrospray ionization/mass spectrometry (PCR/ESI-MS)
Using this strategy, we designed a comprehensive assay to detect ten bacterial and four viral biothreat clusters. The assay identified the major biothreat organisms and differentiated these from their near neighbors and from thousands of other bacteria and viruses, providing a seamless net of biosurveillance for these clusters in a comprehensive biothreat assay (
Ten bacterial and four viral clusters identified in the biothreat assay are shown. In each cluster the key biothreat agent and its near neighbors are indicated. The HHS/USDA select agent and NIAID A, B, C pathogen lists are reflected by symbols shown in the legend. Attenuated or live vaccine strains of some of these organisms are, however, excluded from the select agent list (
Biothreat clusters targeted by this assay are shown in
BW Threat Target | Primer Pair | Gene Name | Forward Primer (5′ –>3′) | Reverse Primer (5′–>3′) |
|
BCT352 | Initiation factor IF-2 |
|
|
|
BCT355 | endospore cytoplasmic protein |
|
|
|
BCT2381 | pXO1, reverse transcriptase |
|
|
|
BCT2379 | pXO2, no gene name |
|
|
|
BCT1111 | Ribonulcease P |
|
|
|
BCT1112 | Ribonulcease P |
|
|
|
BCT1070 | Ribonulcease P |
|
|
|
BCT1071 | Ribonulcease P |
|
|
|
BCT1075 | Ribonulcease P |
|
|
|
BCT1076 | Ribonulcease P |
|
|
|
BCT1079 | Isocitrate dehydorgenase |
|
|
|
BCT1080 | insertion sequence IS1111A transposase |
|
|
|
BCT2328 | Aspartate semi-aldehyde dehydrogenase |
|
|
|
BCT2332 | Galactose epimerase |
|
|
|
BCT1084 | Ribonulcease P |
|
|
|
BCT1083 | Ribonulcease P |
|
|
|
BCT2323 | Cholera enterotoxin subunit A |
|
|
|
BCT2927 | glyceraldehyde-3-phosphate dehydrogenase |
|
|
|
BCT2012 | Outer membrane protein |
|
|
|
BCT2339 | F1 Capsule antigen |
|
|
|
BCT2337 | Plasminogen activator precursor |
|
|
|
BCT2326 | insertion sequence:IS200-like and disrupted inv |
|
|
|
BCT358 | Valine synthetase |
|
|
|
BCT1105 | invasion plasmid antigen H |
|
|
|
BCT1106 | invasion plasmid antigen H |
|
|
Variola virus | VIR985 | RNA helicase NPH-II |
|
|
Variola virus | VIR979 | DNA helicase |
|
|
Ebola virus/Marburg virus | VIR853 | RNA-dependent RNA polymerase | TA/ipdU/GG/ipdU/G/ipdU/IIIIAATGTCTTTGATTGGATGCA | TG/ipdC//ipdU/A/ipdU/AAIIITCACTGACATGCATGTAACA |
Ebola virus/Marburg virus | VIR858 | RNA-dependent RNA polymerase |
|
|
Influenza Virus | VIR2798 | Polymerase PB1 |
|
|
Influenza Virus | VIR1266 | Nucleoprotein |
|
|
VEE, WEE, EEE, Chikungunya | VIR966 | methyltransferase |
|
|
VEE, WEE, EEE, Chikungunya | VIR2499 | methyltransferase | TGCCAGCIACAITGTGIGAICAIATGAC | TGACGACTATICGCTGGTTIAGCCCIAC |
We demonstrate here that two primer pairs, BCT352 targeting the translation initiation factor IF-4 (
To demonstrate the resolving capabilities of these genomic signatures, we obtained a collection of 34 bacilli from the United States Army Medical Research Institute for Infectious Diseases (USAMRIID). These include fully virulent, partially virulent, and avirulent
STRAIN | Phenotype | Data Source | GenBank Identifier | Bacillus_INFB (BCT352) | Bacillus_SSPE (BCT355) | BA_PX01 (BCT2381) | BA_PX02 (BCT2379) |
Ames | pX01+/pX02+ | GenBank/Complete Genome | 21392688 | [34 25 21 25] | [42 23 23 21] |
|
|
Ames Ancestor | pX01+/pX02+ | 47566322 | [34 25 21 25] | [42 23 23 21] |
|
|
|
A2012 | pX01+/pX02+ | 20520075 | [34 25 21 25] | [42 23 23 21] |
|
|
|
A0248 | pX01+/pX02+ | 229599883 | [34 25 21 25] | [42 23 23 21] |
|
|
|
CDC 684 | pX01+/pX02+ | 227812678 | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | [44 27 14 41] | |
KrugerB | pX01+/pX02+ | 311703252 | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | [44 27 14 41] | |
WesternNA | pX01+/pX02+ | 311703298 | [34 25 21 25] |
|
[41 15 22 34] | [44 27 14 41] | |
Sterne | pX01+/pX02- | 49183039 | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | Target Absent | |
Ames | pX01+/pX02+ | Ibis MeasuredBase Counts | N/A | [34 25 21 25] | [42 23 23 21] |
|
|
New Hampshire | pX01+/pX02+ | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | [44 27 14 41] | |
Vollum | pX01+/pX02+ | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | [44 27 14 41] | |
Vollum 1B | pX01+/pX02+ | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | [44 27 14 41] | |
Sterne | pX01+/pX02- | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | Target Absent | |
STI | pX01+/pX02- | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | Target Absent | |
V770-NP1R | pX01+/pX02- | N/A | [34 25 21 25] | [42 23 23 21] | [41 15 22 34] | Target Absent | |
ATCC4728 | pX01−/pX02+ | N/A | [34 25 21 25] | [42 23 23 21] | Target Absent | [44 27 14 41] | |
Delta NH-1 | pX01−/pX02+ | N/A | [34 25 21 25] | [42 23 23 21] | Target Absent | [44 27 14 41] | |
Delta Sterne | pX01−/pX02- | N/A | [34 25 21 25] | [42 23 23 21] | Target Absent | Target Absent |
Bolded base counts indicate SNP variants compared to the primary signature at that locus.
Representative strains of the
The bubonic plague caused by
Genomic data from the completely sequenced
The
In the biothreat assay, the
To demonstrate the specificity of the assay for the
The genus
We previously described a high-throughput pan-
To demonstrate the ability to detect and identify
The
Several extremely dangerous pathogens that can infect humans and animals are found in the
In the biothreat assay, members of the
The genus
In the biothreat assay, the clostridia are identified using two primer pairs, BCT1075 and BCT1076, targeting RNase P. These two primer pairs are capable of amplifying all members of the genus
Q fever is a zoonosis caused by
In the biothreat assay, we use primers targeting isocitrate dehydrogenase (
The
Organisms in the
Diarrheagenic enterobacteria, such as
In the biothreat assay, a primer pair targeting the valine synthetase (BCT358) gene provides identification of all of the above species in the
In order to provide additional separation between
The genus
The genus
Influenza A viruses are important respiratory pathogens that cause annual epidemics and occasional pandemics. Influenza viruses cause serious global economic and public health burdens. Emergence of new influenza A virus strains can be caused by “antigenic shift,” resulting from reassortment of gene segments (including H and/or N types), by “antigenic drift” resulting from the continuing accumulation of mutations in the H and N genes, or by species jump by a virus that acquires the ability to infect and be transmitted among humans as has happened in the influenza pandemics over the last century
In the biothreat assay, two of the previously described sets of primer pairs (VIR2798 and VIR1266) were included for rapid detection of presence of influenza A or B virus. Base composition data from the amplified regions of over a 1000 influenza A H5N1 strains from GenBank were analyzed. The majority of these could be grouped into the six base composition clusters as shown in
The above sections describe in detail the primer pairs used in the biothreat assay and the ability of the individual groups of primer pairs to detect the targeted biothreat cluster. All of these primer pairs were assembled into a single assay kit containing groups of two to three primer pairs per well for screening for all the listed biothreat agents simultaneously. The assay layout is shown in
Data analysis and reporting for this assay were optimized for detecting the targeted biothreat clusters, and detection of organisms outside this group are not reported. Two different types of report are currently available. The first is a summary that reports detection and lack thereof for each of the 14 groups described in the previous sections for each sample (
The limit of detection (LOD) of the biothreat assay in analysis of environmental aerosol samples, one of its intended uses, was determined by analyzing serial 10-fold dilutions of nucleic acids from a number of test agents with air filter nucleic acid extract from a biodefense monitoring program (“
The LODs and the false negative rates for all threat agents tested are summarized in
Threat | GE/well | Percent complete | Correct | False Negative Rate | UL (95% Confidence) |
|
200 | 98% | 104/109 | 4.6% | 9.3% |
|
1000 | 100% | 93/96 | 3.1% | 7.8% |
|
200 | 100% | 96/97 | 1% | 4.9% |
|
40 | 100% | 96/96 | 0% | 3.3% |
|
200 | 100% | 94/96 | 3.1% | 6.4% |
|
200 | 100% | 96/96 | 0% | 3.3% |
200 | 100% | 89/96 | 7.3% | 13.1% | |
|
40 | 100% | 96/96 | 0% | 3.3% |
Vaccinia virus | 200 | 100% | 96/96 | 0% | 3.3% |
|
1000 | 100% | 96/96 | 0% | 3.3% |
|
40 | 100% | 95/96 | 1% | 4.9% |
|
200 | 100% | 96/96 | 0% | 3.3% |
VEE | 200 | 100% | 96/96 | 0% | 3.3% |
|
40 | 100% | 95/97 | 2% | 6.3% |
|
40 | 100% | 95/96 | 1% | 4.9% |
It is critical that an assay used for biodefense monitoring be capable of detecting threats and, perhaps as importantly, of not falsely identifying a threat. The sample preparation methods employed by environmental monitoring programs result in samples containing significant amounts of nucleic acids from a variety of species. Two methods were employed to determine the specificity of the biothreat assay. First, over 1000 samples containing environmental background without a specific target agent were analyzed and used to calculate false positive rates for each agent. Second, the ability of the biothreat assay kit to detect a threat when the sample contained both the targeted threat and a near neighbor but not when the sample contained only the near neighbor was assessed.
A total of 1,353 samples in an environmental air background were analyzed during the determination of sensitivity. Each of these samples contained only two of the agents under investigation. Because the biothreat assay simultaneously analyzes each sample for every threat agent, the results from those samples not containing a particular threat agent were used to determine the false positive rates of that agent. For example, in the LOD determination of
Threat | Detection | False Positive Rates | UL (95% Confidence) |
|
0/1192 | 0% | 0% |
|
0/1206 | 0% | 0% |
|
0/1198 | 0% | 0% |
|
1/1198 | 0% | 0% |
|
0/1203 | 0% | 0% |
|
0/1135 | 0% | 0% |
|
0/1205 | 0% | 0% |
|
0/1209 | 0% | 0% |
|
0/1169 | 0% | 0% |
|
0/1182 | 0% | 0% |
|
0/1270 | 0% | 0% |
|
0/1170 | 0% | 0% |
|
0/1207 | 0% | 0% |
|
0/1157 | 0% | 0% |
|
0/1205 | 0% | 0% |
|
167/1193 | 14%* | 13.9%* |
Near-neighbor nucleic acids were added to the sample in excess (fivefold higher than the LOD) of the target biothreat nucleic acids (added at twofold the LOD). The results are presented in
Spiked nucleic acid extracts (Concentration) | Type: Biothreat (BT) orNear Neighbor (NN) | Organisms identified |
|
|
|
|
|
|
|
|
|
|
||
|
|
|
|
|
|
|
|
|
|
||
|
||
|
||
|
||
|
||
|
|
|
|
||
|
|
|
|
|
|
|
||
|
||
|
|
|
|
||
|
||
|
|
|
|
||
|
|
|
|
||
|
|
|
|
Indicates inability to differentiate the species further.
Near-neighbor organism not detected.
To determine the ability of the biothreat assay to distinguish between threat agents and near neighbors, the biothreat assay was challenged with nucleic acids purified from a panel of organisms. These samples were diluted in Tris-EDTA (pH 8.0) to allow for analysis on the biothreat assay plate at 1000 GE/well for each organism individually. In every case, the challenge organism was correctly identified. When possible, additional strains or sub-species were also identified. However, the intended use of the biothreat assay is to alarm the end user when a threat is present. The data presented in
CRP Cat# | Organism | Type: Biothreat (BT) or Near Neighbor (NN) |
BACI002 | BT | |
BACI012 | NN; (pXO2-) | |
BACI055 | NN (pXO1-) | |
BACI124 | BT | |
BACI126 | BT | |
BACI123 |
|
BT |
BACI207 | BT | |
BACI225 | BT | |
BACI228 | NN | |
BACI232 | NN | |
BACI020 | NN | |
BURK003 | BT | |
BOTB | BT | |
FRAN017 | NN | |
FRAN003 | NN | |
FRAN004 | NN | |
FRAN012 |
|
BT |
FRAN016 | BT | |
FRAN029 |
|
BT |
RICK002 | BT | |
YERS001 | NN | |
YERS014 |
|
NN |
YERS015 |
|
NN |
YERS002 | NN | |
YERS017 | NN (caf-) | |
YERS018 | BT | |
YERS019 | BT | |
YERS020 | NN (pla-) | |
YERS021 | BT | |
YERS022 | NN (caf-) | |
YERS023 | BT | |
YERS059 | NN | |
YERS061 | BT | |
YERS008 | NN | |
YERS012 | NN |
The ability of an instrument to provide measurements that are directly proportional to the concentration of the test analyte is referred to as linearity. Data obtained from experiments used to determine the LOD within an environmental matrix were analyzed for linearity. The total GE reported by the PLEX-ID was plotted against the actual concentration; linear trend lines were generated to determine linearity within the challenge concentrations.
Organism | Range tested (GE/well) | Linear range (GE/well) | ||||
|
1000 | 200 | 40 | 8 | 2 | 0–1000 |
Vaccinia virus | 5000 | 1000 | 200 | 40 | 8 | 0–5000 |
|
1000 | 200 | 40 | 8 | 2 | 0–200 |
|
1000 | 200 | 40 | 8 | 2 | 0–200 |
|
1000 | 200 | 40 | 8 | 2 | 40–1000 |
|
1000 | 200 | 40 | 8 | 2 | 0–200 |
|
1000 | 200 | 40 | 8 | 2 | 0–200 |
|
1000 | 200 | 40 | 8 | 2 | 40–1000 |
|
1000 | 200 | 40 | 8 | 2 | 8–40 |
|
1000 | 200 | 40 | 8 | 2 | 8–1000 |
1000 | 200 | 40 | 8 | 2 | 200–1000 | |
|
1000 | 200 | 40 | 8 | 2 | 8–1000 |
|
1000 | 200 | 40 | 8 | 2 | 40–1000 |
|
1000 | 200 | 40 | 8 | 2 | 8–200 |
VEE | 1000 | 200 | 40 | 8 | 2 | 8–1000 |
Influenza | 1000 | 200 | 40 | 8 | 2 | Not tested |
Only linear in samples without environmental air background.
The biothreat assay described here identifies ten bacterial and four viral biothreat clusters included in the NIAID priority pathogen (Category A: seven agents, Category B: 18; Category C: three) and HHS/USDA select agent (18 agents) lists. The assay also identifies a broad range of near-neighbor organisms that may cause severe disease in humans or animals or that may be harmless environmental organisms. The biothreat cluster analysis strategy using PCR/ESI-MS addresses several fundamental design requirements for biothreat protection. First, biothreat agents and near-neighbor organisms are identified unambiguously and equally. Closely related organisms often cause false alarms in conventional PCR approaches to detect biothreat agents. Perhaps more importantly, it enables identification of unexpected pathogens within the biothreat clusters that might be used in a biological attack. Second, the genetic targets for amplification in the biothreat assay are universally conserved, essential to microbial life. This lowers the risk of failed detections because these targets cannot be dispensed with by the microbe and would be difficult to modify by engineering to avoid detection. Third, the comprehensive nature of the biothreat assay enables very broad surveillance of the potential biothreat landscape, including the detection of the virulence plasmids where appropriate. Fourth, the PCR/ESI-MS instrumentation enables very high-throughput sample analysis; the theoretical maximum throughput of the biothreat assay on a current-generation PLEX-ID instrument is approximately 180 specimens over 24 hours.
Some of the component primer pairs of the comprehensive biothreat assay were validated before the biothreat assay was assembled. The
The
The
The
Assembly of this comprehensive collection of biothreat cluster primers into a single assay on the PLEX-ID has the potential to serve a variety of biosecurity needs. First, the biothreat assay can be used for environmental surveillance − the application that was experimentally demonstrated in this manuscript. Another potential use of the assay is as a reflex test to the pan-bacterial PLEX-ID assay intended to identify all bacteria in normally sterile bodily fluids (e.g., blood, cerebral spinal fluid)
Although several of the primer pairs used in this assay were studied previously, the biothreat assay is a multiplexed version: Thirty-six primer pairs are combined into 16 PCR reactions. The multiplexed assay was tested with environmental air from Biowatch filters. Feasibility studies were performed at 1000 GE of each target organism spiked into background matrix. The environmental background did not inhibit the ability of PLEX-ID to correctly detect the target organisms. Additional studies were conducted to demonstrate the analytical performance of the assay. These included sensitivity, specificity, linearity, and breadth of coverage of the biothreat clusters. Analytical sensitivity of the target organisms varied between 40–1000 GE/well with no false positive detections, and false negative rates below 5% for most organisms tested. The matrix that was used as background had high loads of environmental bacterial signatures (data not shown), including alphaproteobacteria such as
In summary, the PLEX-ID Biothreat Assay kit was evaluated for detection of biothreat agents in environmental air samples. The data presented demonstrate the capability of the PCR/ESI-MS method to accurately detect and identify organisms from ten bacterial and four viral biothreat clusters. The assay discriminated between target agent and near neighbors with high specificity and sensitivity. The method accurately reported each organism with which it was challenged and accurately identified threat species as a threat; species and/or strains that are not considered a threat were not reported as such. The assay is capable of simultaneous detection of most NIAID Category A, B, and C priority pathogens and HHS/USDA select agents and thus provides a means for comprehensive coverage using a high-throughput assay. The validation data support use of the Ibis PLEX-ID and the biothreat assay for detection of biological warfare agents in complex environmental matrices. Additional testing of this assay with an EU validation panel is described in a companion manuscript (Grunow et al.
The nucleic acid samples used in this study were obtained from the Critical Reagents Program (CRP), BEI Resources, ATCC, Keim Genetics Lab, or were prepared from MRI culture collections. Environmental collections were obtained on dry filter unit (DFU) filters from a variety of locations in the Washington, D.C. region. Nucleic acids were eluted from the environmental matrix by placing DFUs in 20 ml PBS/0.2% Triton X-200 and manually shaking. The eluent was then shaken in a Biospec Mini BeadBeater-96 with ATL buffer (Qiagen), Herring Sperm DNA, Proteinase K, and antifoam for 5 min. Samples were incubated for 21 min at 16°C and then centrifuged. AL buffer (Qiagen) was added to the supernatants and incubated for 1 min at 70°C. Ethanol was added to the sample, which was then loaded onto a Qiagen spin column, centrifuged, and sequentially washed with AL, AW2, and AW4 buffers (Qiagen). The sample was eluted from the spin columns in 200 µl of AE buffer (Qiagen).
The primer pairs that make up the biothreat assay (
Internal positive controls similar to the amplicon expected from one of the primer pairs in each of the multiplexed reactions were made from cloned synthetic DNA (BlueHeron Biotechnology, Bothell, WA) and were included in each PCR reaction at 100 copies per reaction. The internal controls were designed to be identical to the expected target priming regions with the exception of five-base pair deletions to enable the control to be distinguished from the target-derived amplicon. PCR was performed in a 50 µL reaction volume containing 5 µL nucleic acid extract in a reaction mix as previously described
After thermocycling, plates were stored at −40°C until the samples could be analyzed by ESI/MS on the PLEX-ID. Mass spectrometry was performed on a PLEX-ID biosensor (Abbott Molecular, Des Plaines, IL). After PCR amplification, 30 µL aliquots of each PCR reaction were desalted and analyzed by mass spectrometry as previously described
Data analysis and results reporting was performed in an automated fashion using on-board computer on the Ibis PLEX-ID system. For this assay, a customized reporting rule set was designed that allowed rapid and accurate detection of the biothreat targets. The biothreat assay report has 21 primer groups or threat clusters as shown in
In addition to the summary style report shown in
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
(DOCX)
The authors thank Dr. Matthew Davenport from the Department of Homeland Security and Keim Genetics Lab for providing