Conceived and designed the experiments: EG ES JD. Performed the experiments: ES JD MH JP MS. Analyzed the data: EG ES FC JD JP MS. Contributed reagents/materials/analysis tools: ES JD MH JP MS. Wrote the paper: EG ES.
The authors have declared that no competing interests exist.
Minor Histocompatibility (H) antigen mismatches significantly influence the outcome of HLA-matched allogeneic stem cell transplantation. The molecular identification of human H antigens is increasing rapidly. In parallel, clinical application of minor H antigen typing has gained interest. So far, relevant and simple tools to analyze the minor H antigens in a quick and reliable way are lacking.
We developed a uniform PCR with sequence-specific primers (PCR-SSP) for 10 different autosomal minor H antigens and H-Y. This genomic minor H antigen typing methodology allows easy incorporation in the routine HLA typing procedures. DNA from previously typed EBV-LCL was used to validate the methodology. To facilitate easy interpretation for clinical purposes, a minor H database named dbMinor (
A simple, uniform and rapid methodology was developed enabling determination of minor H antigen genotypes of all currently identified minor H antigens. A dbMinor database was developed to interpret the genomic typing for its potential clinical relevance. The combination of the minor H antigen genomic typing methodology with the online dbMinor database and applications facilitates the clinical application of minor H antigens anti-tumor targets after stem cell transplantation.
Minor Histocompatibility (H) antigens crucially affect the outcome of HLA-matched allogeneic stem cell transplantation (SCT)
Both the expansion of the genomic identification of minor H antigens and the growing interest in the application of minor H antigens as therapeutic tools require a simple and uniform allele specific PCR protocol, an up-to-date database, and tools that facilitate interpretation of the combined HLA and minor H antigen typing data. Here we report on the development of a uniform methodology for genotyping of all currently molecularly identified minor H antigens. Moreover, a minor H antigen database has been developed providing immediate information of the potential clinical relevance of the minor H antigen typing results for the relevant donor/recipient pair.
In total PCR-SSP for ten autosomally encoded minor H antigens and one for the Y-chromosome encoded H-Y minor H antigen were prepared. The design of the allele specific primers for PCR-SSP (
minor H antigen | allele | 5′ primer | 3′ primer | length (bp) |
HA-1 | +/H | CTTAAGGAGTGTGTGCTGC |
ACTCCTACACATCCCTCAGA | 190 |
−/R | CTTAAGGAGTGTGTGTTGC |
ACTCCTACACATCCCTCAGA | 190 | |
HA-2 | +/V | ACAGTCTCTGAGTGGCTCAG | GCTCCTGGTAGGGGTTCA |
271 |
−/M | ACAGTCTCTGAGTGGCTCAG | GCTCCTGGTAGGGGTTCA |
271 | |
HA-3 | +/T | CTTCAGAGAGACTTGGTCA |
GTTCATGAGCCCATGTTCCAT | 129 |
−/M | CTTCAGAGAGACTTGGTCA |
AGACTCAGCAGGTTTGTTAC | 318 | |
HA-8 | +/R | TGCAGTCAGCAGATCACC |
CTTCTGGGCAACAGTTATGGA | 187 |
−/P | TGCAGTCAGCAGATCACC |
CTTCTGGGCAACAGTTATGGA | 187 | |
HB-1 | +/H | ATTCTTTTCTATAGGTTCTCTG |
AGGGCATATGTTCCACTTGCTT | 211 |
−/Y | GCCATTCTTTTCTATAGGTTCT |
AGGGCATATGTTCCACTTGCTT | 214 | |
ACC-1 | +/Y | CATTGCCTCAACAGCTTCAAG | GGTTGTGGTATCTGTAGG |
137 |
−/C | CATTGCCTCAACAGCTTCAAG | GGTTGTGGTATCTGTAGG |
137 | |
ACC-2 | +/D | GATGGAAAAGGAGTTTGAAGGCG |
CAGCCTCCGTTTTGCCTTATC | 197 |
−/G | GATGGAAAAGGAGTTTGAAGGCG |
CAGCCTCCGTTTTGCCTTATC | 197 | |
SP110 | +/R | AATGTGGTTTGAAGACCAAAAGT | CTTGTACTCTCATCTTACCTC |
185 |
−/G | AATGTGGTTTGAAGACCAAAAGT | CTTGTACTCTCATCTTACCTC |
185 | |
PANE1 | +/R | AGGCAAGTCCCACACTC |
AATGGGGTAAATGACGTGCTG | 207 |
−/Stop | CAGGCAAGTCCCACACTC |
AATGGGGTAAATGACGTGCTG | 207 | |
UGT2B17 | + | TGTGTTGGGAATATTCTGACTATAA | CCCACTTCTTCAGATCATATGCTT | 353 |
- | - | |||
H-Y (SRY) | + | TGGCGATTAAGTCAAATTCGC | CCCCCTAGTACCCTGACAATGTATT | 136 |
- | - |
Differences between the primer for the immunogenic allele and the non-immunogenic allele are indicated in bold. The specificity of primers for HB-1 and ACC-1 was increased by introducing mismatches in the primer sequences (shaded nucleotides). Single nucleotide polymorphisms (SNPs) are underlined. All sequences are depicted from 5′ to 3′. H-Y PCR-SSP was based upon the
EBV-LCL | Original typing | Original methodology | Ref. | PCR-SSP Typing |
HAR03 | HA-1−/HA-1HH | CTL and sequencing | HA-1HH | |
HAR05 | HA-1−/HA-1RR | CTL and sequencing | HA-1RR | |
HEL02 | HA-2+/HA-2VM | CTL and sequencing | HA-2VM | |
HEL03 | HA-2−/HA-2MM | CTL and sequencing | HA-2MM | |
HoRe | HA-3+/HA-3TT | CTL and sequencing | HA-3TT | |
HoDo | HA-3−/HA-3MM | CTL and sequencing | HA-3MM | |
SKH | HA-8+/HA-8RP | CTL and sequencing | HA-8RP | |
SDK | HA-8−/HA-8PP | CTL and sequencing | HA-8PP | |
MT | HB-1HH | PCR-RFLP | H. Dolstra, personal communication | HB-1HH |
HM | HB-1YY | PCR-RFLP | HB-1YY | |
IHW1182 | ACC-1YY | CTL/linkage | ACC-1YY | |
IHW1018 | ACC-1CC | CTL/linkage | ACC-1CC | |
IHW1182 | ACC-2DD | CTL/linkage | ACC-2DD | |
IHW1018 | ACC-2GG | CTL/linkage | ACC-2GG | |
DRN | SP110+ | CTL and PCR-RFLP | SP110RG | |
CAN | SP110− | CTL and PCR-RFLP | SP110GG | |
KSN | PANE1RStop | CTL and PCR-RFLP | PANE1RStop | |
GAO | PANE1StopStop | CTL and PCR-RFLP | PANE1StopStop | |
RAR | UGT2B17+ | CTL and PCR | UGT2B17+ | |
DCR | UGT2B17− | CTL and PCR | UGT2B17− | |
MoDo | H-Y+ | CTL | H-Y+ | |
ReRe | H-Y− | CTL | H-Y− |
EBV-LCL typed for HA-8, SP110, PANE1, and UGT2B17 were provided by Dr. E. Warren, Seattle, USA. For ACC-1 and ACC-2, EBV-LCL from individuals from the CEPH (Centre d'Etude du Polymorphisme Humain) panel
PCR mixes contained 80 ng genomic DNA, 0.25 U Amplitaq (Perkin-Elmer, Norwalk, CT), 0.01% gelatin, 0.8 mM dNTP, 0.5 µM specific primers, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris HCl (pH 8.3), 6% sucrose, and 1 mM cresol red. To increase the yield of HA-1 and HB-1 products, primer concentrations were doubled. The PCR program started with 2 minutes at 94°C, followed by 10 cycles of 10 seconds at 94°C, and 60 seconds at 65°C. Subsequently, 20 cycles were run using the following conditions: 10 seconds at 94°C, 50 seconds at 61°C, and 30 seconds at 72°C. Samples were analyzed on a 2% agarose gel. Internal control primers for human platelet antigen (5′-ACCTAGATAGGTGCGAGCTCACC-3′ and 5′-CAGACTGAGCTTCTCCAGCTTGG-3′; 0.125 µM each) were used for the immunogenic alleles, resulting in a product of 439 bp. For the non-immunogenic alleles, the human growth hormone-2 control primers 5′-CAGTGCCTTCCCAACCATTCCCTTA-3′ and 5′-ATCCACTCACGGATTTCTGTTGTGTTTC-3′ were used to amplify a product of 504 bp. Internal control primers for UGT2B17 had the sequence 5′-TGCCAAGTGGAGCACCCAA-3′ and 5′-GCATCTTGCTCTGTGCAGAT-3′. These primers yield a 761 bp product derived from the HLA-DR locus.
All currently available information on the molecularly identified minor H antigens has been imported into the minor H antigen database (dbMinor:
Allele specific PCR-SSP on genomic DNA was established for all minor H antigens and their alleles known to date.
PCR-SSP of DNA of two unrelated individuals (CAN and 80821) was performed and analyzed as described in the Materials and
The first lane of each minor H locus represents the immunogenic allele; the second lane displays the non-immunogenic allele.
Bands relevant for minor H antigen typing are boxed.
The products of 439 and 504 bp reflect the internal control for the immunogenic and the non-immunogenic allele respectively.
The control band for UGT2B17 has a size of 761 bp.
Since the minor H antigens UGT2B17 and H-Y have no allelic counterpart, the latter typing was performed with a single set of primers.
Genomic DNA of 22 reference cell lines was used to validate the newly developed genomic typing method.
Upon development and validation of the uniform minor H antigen typing methodology, 22 cell lines from the 13th International Histocompatibility Workshop Symposium (IHWS) reference panel were typed. These cell lines are generally available and have been used before by several researchers to identify novel minor H antigens
HA-1 | HA-2 | HA-3 | HA-8 | HB-1 | ACC-1 | ACC-2 | SP110 | PANE1 | UGT2B17 | H-Y | |
IHW1003 | HR | VV | MM | RP | HY | CC | GG | RG | R - | + | − |
IHW1010 | HH | VV | MM | RR | HH | CC | GG | RG | R - | + | + |
IHW1029 | RR | VV | TM | RP | HY | CC | GG | RR | RR | + | + |
IHW1031 | RR | VV | TM | RP | HH | CC | GG | RG | RR | + | − |
IHW1045 | HR | VV | TM | PP | HY | CC | GG | RG | R - | + | − |
IHW1046 | RR | VV | TM | RP | HH | YC | DG | GG | R - | + | + |
IHW1053 | HR | VV | MM | RR | HH | CC | GG | RR | R - | + | − |
IHW1056 | HH | VV | MM | RR | HH | CC | GG | RG | R - | + | + |
IHW1074 | RR | MM | TM | RR | HH | CC | GG | RG | RR | + | − |
IHW1077 | HR | VV | TT | RP | HH | CC | GG | RG | R - | − | + |
IHW1088 | RR | VM | TT | PP | HH | CC | GG | RR | RR | + | − |
IHW1091 | RR | VV | TT | RP | HH | YC | DG | RG | RR | + | + |
IHW1103 | RR | VV | TT | RP | HY | CC | GG | GG | R - | + | + |
IHW1108 | HR | VV | TT | RP | HH | YY | DD | RG | R - | + | − |
IHW1116 | HR | VV | TM | RP | HH | YC | DG | RG | RR | + | + |
IHW1117 | HH | VV | TM | PP | HH | CC | GG | RG | R - | + | − |
IHW1124 | HR | VV | TM | RP | HH | CC | GG | RR | R - | + | + |
IHW1135 | RR | VM | TM | PP | HH | YC | DG | RR | R - | + | − |
IHW1141 | HR | VV | TM | RP | HH | YC | DG | RG | R - | + | + |
IHW1143 | HR | VV | TT | PP | HH | CC | GG | RR | R - | − | − |
IHW1161 | RR | VV | TT | PP | HH | CC | GG | RG | RR | + | + |
IHW1166 | HH | VV | MM | RP | HH | CC | GG | RG | RR | + | − |
Typing is depicted as the amino acid resulting from the genomic sequences. The stop codon for PANE1 is indicated by a “-“.
The minor H antigen database (dbMinor) supports 4 applications, i.e. the minor H antigen database (I), the minor H antigen search based upon HLA typing (II), a full donor/recipient minor H antigen and HLA typing analysis (III), and a data submission section (IV). All 4 components of the database and the applications are mutually linked (
Data from dbMinor are obtained via direct submission and from literature screening.
The data in dbMinor can be analyzed via an HLA-based query, a full typing query and a minor H antigen query.
Results from these queries are linked to external data from the NCBI database.
The minor H antigen database allows data searches for basic information on individual minor H antigens. The information includes the references to the relevant articles, the amino-acid sequence of the peptide, and the HLA restriction molecule. If available, links show the related clinical studies, the genes and the protein data available at the NCBI. Likewise, detailed information on tissue distribution and mRNA expression are included.
This searching method has been designed to list the potential expression of minor H antigens in an individual based upon the individuals' HLA typing. HLA typing has to be entered in a two-digit format. The results of the query give an indication whether minor H antigens may play a role in post-transplant immune reactivity and for which minor H antigens typing should be performed. In case HLA sub-alleles have been reported to be unable to express the minor H antigen of interest, it is specifically listed in the results.
The combined HLA and minor H antigens typing results of the donor/recipient pair under study subsequently provides information on putative minor H antigen reactivity. An automatic query has been designed to analyze these putative immune reactivities. Upon submission of the locally obtained minor H antigen typing results in combination with the 2-digit HLA typing data (
A. Query section: Minor H antigen typing data can be entered by marking the checkboxes per allele per minor H antigen. HLA typing data has the 2-digit format. Full typing for all HLA loci is not required. After submitting the query, a page with results will appear
B. Results: The results section lists minor H antigens relevant in the particular donor-recipient combination based upon the HLA typing. In case donor and recipient are minor H antigen matched, as is the case here for HA-1, the sign “ = ” will appear between donor and recipient. In case recipient and donor are minor H antigen mismatched, the disparities are indicated by an arrow. The direction of the arrow indicates the direction of the immune responses. In this example immune reactivity can occur in the recipient-to-donor (host-versus-graft, rejection) direction for HA-2 and HA-3 and in the donor-to-recipient (graft-versus-host) direction for HA-8 and for the various H-Y antigens.
The tissue distribution of each relevant minor H antigen is listed as “broad” or “restricted”. By clicking these terms, a detailed list of target cells expressing the minor H antigen will be displayed.
Minor H antigens are presented by selected HLA molecules. The HLA alleles expressed by recipient and donor that are not able to present a minor H antigen are listed at the bottom of the results section. Information will appear in case a particular minor H antigen cannot be presented by a specific HLA sub-allele (4-digit format; in this example HLA- DQB1*0503/0504 for DQ5/H-Y).
New minor H antigen data can be submitted directly to the dbMinor (
Routine typing for minor H antigens of stem cell and solid organ transplant donor and recipient is a prerequisite for their potential clinical use and provides insights in the minor H antigen allo-immune reactivities
Today, information on minor H antigen typing may have relevant spin-offs in the area of stem cell and renal transplantation. Regarding the former, typing of donor/recipient pairs prior to SCT provides information on two crucial GvH reactivities; i.e.; GvHD and GvT. Broadly expressed minor H antigens are prone to causing GvHD. Pre-SCT information on the disparities for the broad minor H antigens is relevant enabling early anticipation on putative development of GvHD. Minor H antigens with tissue distribution restricted to the hematopoietic system play a role in the graft-versus-leukemia (GvL) effect post-SCT
Beside the development of a uniform genomic typing method for minor H antigens, quick and easy interpretation of the potential clinical consequences of the minor H antigen typing results are desired. Interpretation of the typing results in relation to GvH reactivities in SCT is rather complex; the recipient requires to be homozygous or heterozygous for the immunogenic minor H allele, while the donor should be homozygous for the non-immunogenic allele. Minor H antigens are peptides encoded by polymorphic proteins. In general, only one polymorphic allele of the protein is immunogenic. Some exceptions are reported, e.g. the HLA-B44 restricted HB-1 and the HLA-B60 restricted HA-1 can be immunogenic bidirectionally
In all algorithms implemented in dbMinor, the two-digit HLA typing format is used instead of the high resolution 4-digit format. The rationale behind this strategy is lack of complete data regarding this issue for most minor H antigens. For some minor H antigens sub-alleles have been reported that are unable to present the minor H antigen of interest. For example the HLA-DQ5/H-Y minor H antigen can be presented by individuals who carry either the HLA-DQB1*0501 or the HLA-DQB1*0502 allele. However, the HLA-DQB1*0503 and HLA-DQB1*0504 alleles are unable to present this particular H-Y peptide (Laurin et al. in press). If such exceptions have been reported, they are specifically listed. As soon as more information on this issue becomes available for other minor H antigens, 4-digit-based queries will be implemented.
In summary, we here describe a universally applicable genomic PCR-based minor H antigen typing protocol. It offers a simple, uniform, and rapid methodology to determine minor H antigen genotypes of all currently molecularly identified minor H antigens. The methodology can be combined with the online applications for the interpretation of minor H antigen typing results identifying donor/recipient pairs eligible for adoptive immunotherapy and patients with increased risk for developing GvHD. The minor H antigen genomic methodology combined with the online applications will further facilitate the clinical application of minor H antigens in transplantation.
The authors thank Dr. M. Oudshoorn and Dr. G. M. Th. Schreuder for critically reading the manuscript. Dr. E. H. Warren is acknowledged for providing the SP110 and PANE1 sequences and EBV-LCL and Dr. H. Dolstra for providing the HB-1HH and HB-1YY DNA.