The Shrimp NF-κB Pathway Is Activated by White Spot Syndrome Virus (WSSV) 449 to Facilitate the Expression of WSSV069 (ie1), WSSV303 and WSSV371

Pei-Hui Wang; Zhi-Hua Gu; Ding-Hui Wan; Ming-Yan Zhang; Shao-Ping Weng; Xiao-Qiang Yu; Jian-Guo He

doi:10.1371/journal.pone.0024773

Loading metrics

Open Access

Peer-reviewed

Research Article

The Shrimp NF-κB Pathway Is Activated by White Spot Syndrome Virus (WSSV) 449 to Facilitate the Expression of WSSV069 (ie1), WSSV303 and WSSV371

Pei-Hui Wang,

Affiliation MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯
Zhi-Hua Gu,

Affiliation MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯
Ding-Hui Wan,

Affiliation MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯
Ming-Yan Zhang,

Affiliation MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯
Shao-Ping Weng,

Affiliation MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯
Xiao-Qiang Yu,

Affiliation Division of Cell Biology and Biophysics, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, Missouri, United States of America
⨯
Jian-Guo He

* E-mail: lsshjg@mail.sysu.edu.cn

Affiliations MOE Key Laboratory of Aquatic Product Safety / State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China, School of Marine Sciences, Sun Yat-Sen University, Guangzhou, People’s Republic of China
⨯

The Shrimp NF-κB Pathway Is Activated by White Spot Syndrome Virus (WSSV) 449 to Facilitate the Expression of WSSV069 (ie1), WSSV303 and WSSV371

Pei-Hui Wang,
Zhi-Hua Gu,
Ding-Hui Wan,
Ming-Yan Zhang,
Shao-Ping Weng,
Xiao-Qiang Yu,
Jian-Guo He

Published: September 12, 2011
https://doi.org/10.1371/journal.pone.0024773

Reader Comments

Post a new comment on this article

incorrect primers for WSSV371

Posted by wph326 on 26 May 2013 at 13:34 GMT

We are sorry for providing incorrect primers for WSSV371 in Table S2. And now we list the correct primers of WSSV371 in the construction of luciferase reporter vectors as followings:
Forward primer: GGGGTACCGTGCTTGGTGGTAACAGAAAGTACG;
Reverse primer: CCGCTCGAGTGAGAATAGACTCGCCGAACACTAC

No competing interests declared.

Subject Areas
?

For more information about PLOS Subject Areas, click here.
We want your feedback. Do these Subject Areas make sense for this article? Click the target next to the incorrect Subject Area and let us know. Thanks for your help!

Transcription factors
Is the Subject Area "Transcription factors" applicable to this article?

Thanks for your feedback.
Shrimp
Is the Subject Area "Shrimp" applicable to this article?

Thanks for your feedback.
Drosophila melanogaster
Is the Subject Area "Drosophila melanogaster" applicable to this article?

Thanks for your feedback.
Invertebrate genomics
Is the Subject Area "Invertebrate genomics" applicable to this article?

Thanks for your feedback.
Toll-like receptors
Is the Subject Area "Toll-like receptors" applicable to this article?

Thanks for your feedback.
Gene regulation
Is the Subject Area "Gene regulation" applicable to this article?

Thanks for your feedback.
Insects
Is the Subject Area "Insects" applicable to this article?

Thanks for your feedback.
Luciferase
Is the Subject Area "Luciferase" applicable to this article?

Thanks for your feedback.

The Shrimp NF-κB Pathway Is Activated by White Spot Syndrome Virus (WSSV) 449 to Facilitate the Expression of WSSV069 (ie1), WSSV303 and WSSV371

The Shrimp NF-κB Pathway Is Activated by White Spot Syndrome Virus (WSSV) 449 to Facilitate the Expression of WSSV069 (ie1), WSSV303 and WSSV371

Reader Comments

Post Your Discussion Comment

Why should this posting be reviewed?

Thank You!

incorrect primers for WSSV371

Posted by wph326 on 26 May 2013 at 13:34 GMT