Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

Surbhi Jain; Ting-Tsung Chang; James P. Hamilton; Selena Y. Lin; Yih-Jyh Lin; Alison A. Evans; Florin M. Selaru; Pin- Wen Lin; Shun-Hua Chen; Timothy M. Block; Chi-Tan Hu; Wei Song; Stephen J. Meltzer; Ying-Hsiu Su

doi:10.1371/journal.pone.0026799

Loading metrics

Open Access

Peer-reviewed

Research Article

Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

Surbhi Jain,

Affiliation Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania, United States of America
⨯
Ting-Tsung Chang ,

Contributed equally to this work with: Ting-Tsung Chang, James P. Hamilton

Affiliation Department of Medicine, Infectious Diseases and Signaling Research Center, College of Medicine, National Cheng Kung University, Tainan, Taiwan, Republic of China
⨯
James P. Hamilton ,

Contributed equally to this work with: Ting-Tsung Chang, James P. Hamilton

Affiliation Division of Gastroenterology and Hepatology, Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America
⨯
Selena Y. Lin,

Affiliation Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania, United States of America
⨯
Yih-Jyh Lin,

Affiliation Department of Surgery, National Cheng Kung University Hospital, Tainan, Taiwan, Republic of China
⨯
Alison A. Evans,

Affiliation School of Public Health, Drexel University, Philadelphia, Pennsylvania, United States of America
⨯
Florin M. Selaru,

Affiliation Division of Gastroenterology and Hepatology, Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America
⨯
Pin- Wen Lin,

Affiliation Department of Surgery, National Cheng Kung University Hospital, Tainan, Taiwan, Republic of China
⨯
Shun-Hua Chen,

Affiliation Department of Microbiology, Medical College, National Cheng Kung University, Tainan, Taiwan, Republic of China
⨯
Timothy M. Block,

Affiliation Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania, United States of America
⨯
Chi-Tan Hu,

Affiliation Department of General Medicine, Buddhist Tzu Chi General Hospital, Hualien, Taiwan, Republic of China
⨯
Wei Song,

Affiliation JBS Science Inc., Philadelphia, Pennsylvania, United States of America
⨯
Stephen J. Meltzer,

Affiliations Division of Gastroenterology and Hepatology, Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America, Department of Oncology, The Sidney Kimmel Comprehensive Cancer Center, Baltimore, Maryland, United States of America
⨯
Ying-Hsiu Su

* E-mail: Ying-hsiu.Su@drexelmed.edu

Affiliation Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania, United States of America
⨯

Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

Surbhi Jain,
Ting-Tsung Chang,
James P. Hamilton,
Selena Y. Lin,
Yih-Jyh Lin,
Alison A. Evans,
Florin M. Selaru,
Pin- Wen Lin,
Shun-Hua Chen,
Timothy M. Block

Published: November 2, 2011
https://doi.org/10.1371/journal.pone.0026799

Reader Comments

Post a new comment on this article

Publisher's Note: Error in primer sequence; Supporting Information, Table S1

Posted by yinghsiusu on 03 Jan 2013 at 17:35 GMT

In Table S1, the primer sequence of the reverse primer (R) of the bisulfite specific PCR (BSP) for the sense strand (S) of the APC gene is inaccurate.

http://www.plosone.org/ar...

Current inaccurate version
Table S1, APC/BSP S R: ggaaatttatttttagtgttgtag

Corrected primer sequence
Table S1, APC/BSP S R: aaaaatccatctccaatactacaat

No competing interests declared.

Subject Areas
?

For more information about PLOS Subject Areas, click here.
We want your feedback. Do these Subject Areas make sense for this article? Click the target next to the incorrect Subject Area and let us know. Thanks for your help!

DNA methylation
Is the Subject Area "DNA methylation" applicable to this article?

Thanks for your feedback.
Antigen-presenting cells
Is the Subject Area "Antigen-presenting cells" applicable to this article?

Thanks for your feedback.
Hepatocellular carcinoma
Is the Subject Area "Hepatocellular carcinoma" applicable to this article?

Thanks for your feedback.
Methylation
Is the Subject Area "Methylation" applicable to this article?

Thanks for your feedback.
Polymerase chain reaction
Is the Subject Area "Polymerase chain reaction" applicable to this article?

Thanks for your feedback.
DNA isolation
Is the Subject Area "DNA isolation" applicable to this article?

Thanks for your feedback.
DNA sequencing
Is the Subject Area "DNA sequencing" applicable to this article?

Thanks for your feedback.
Sense strands
Is the Subject Area "Sense strands" applicable to this article?

Thanks for your feedback.

Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

Reader Comments

Post Your Discussion Comment

Why should this posting be reviewed?

Thank You!

Publisher's Note: Error in primer sequence; Supporting Information, Table S1

Posted by yinghsiusu on 03 Jan 2013 at 17:35 GMT