Reader Comments
Post a new comment on this article
Post Your Discussion Comment
Please follow our guidelines for comments and review our competing interests policy. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided:
- Remarks that could be interpreted as allegations of misconduct
- Unsupported assertions or statements
- Inflammatory or insulting language
Thank You!
Thank you for taking the time to flag this posting; we review flagged postings on a regular basis.
closeTable S2: Oligo sequences
Posted by JPrescott on 26 Apr 2012 at 23:00 GMT
I think that the primers for FGFR3 exon 7 in table S2 have the same genomic sequence in the forward and reverse (after the M13 sequence; TGGCGGTGGTGGTGAGGGAG). This sequence maps to just 5' of exon 7.
RE: Table S2: Oligo sequences
GottfridSjodahl replied to JPrescott on 27 Apr 2012 at 12:48 GMT
Thank you for the comment.
The Exon 7 primer sequences in Table S2 in this article read:
Fwd 5'-3'
[TGTAAAACGACGGCCAGTAGT]GGCGGTGGTGGTGAGGGAG
Rev 5'-3'
[CAGGAAACAGCTATGACC]TGTGCGTCACTGTACACCTTGCAG
In the sequences above I have put the auxiliary sequence (M13 Fwd/Rev) in brackets. For clarity I should have done this in Table S2 as well.
If the sequence after the brackets above is used as primers in an e-PCR at UCSC (http://www.genome.ucsc.ed...)
the PCR fragment maps to the beginning of exon 7 of the FGFR3 gene, covering the most commen mutation site (although the whole exon is not covered).
I hope this resolved you question. If not, please let me know
Gottfrid Sjödahl
gottfrid.sjodahl@med.lu.se