Advertisement
Research Article

Mitochondrial Mislocalization Underlies Aβ42-Induced Neuronal Dysfunction in a Drosophila Model of Alzheimer's Disease

  • Kanae Iijima-Ando mail,

    Kanae.Iijima-Ando@jefferson.edu (KIA); Koichi.Iijima@jefferson.edu (KI)

    Affiliation: Laboratory of Neurogenetics and Pathobiology, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America

    X
  • Stephen A. Hearn,

    Affiliation: Microscopy Facility, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, United States of America

    X
  • Christopher Shenton,

    Affiliations: Laboratory of Neurogenetics and Pathobiology, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America, Department of Biochemistry and Molecular Biology, Farber Institute for Neurosciences, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America

    X
  • Anthony Gatt,

    Affiliation: Department of Biochemistry and Molecular Biology, Farber Institute for Neurosciences, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America

    X
  • LiJuan Zhao,

    Affiliation: Laboratory of Neurogenetics and Pathobiology, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America

    X
  • Koichi Iijima mail

    Kanae.Iijima-Ando@jefferson.edu (KIA); Koichi.Iijima@jefferson.edu (KI)

    Affiliation: Department of Biochemistry and Molecular Biology, Farber Institute for Neurosciences, Thomas Jefferson University, Philadelphia, Pennsylvania, United States of America

    X
  • Published: December 15, 2009
  • DOI: 10.1371/journal.pone.0008310

Reader Comments (1)

Post a new comment on this article

Publisher's Note: Error in Materials and Methods section.

Posted by PLoS_ONE_Group on 04 Oct 2012 at 21:16 GMT

Fly
http://plosone.org/article/info:doi/10.1371/journal.pone.0008310#article1.body1.sec4.sec3.p1

There is an error in the Material and Methods section "Genomic DNA Extraction and Quantitative Real Time PCR Analysis". In this section, the primer sequences for rp49 are incorrectly described as "GCTAAGCTGTCGCACAAATG (forward) and GTTCGATCCGTAACCGATGT (reverse)." However, the correct primer sequences used for rp49 are "ATCGTGAAGAAGCGCACCAA (forward)" and "GTCGATACCCTTGGGCTTGC (Reverse)."

No competing interests declared.