Advertisement
Research Article

Temporal Analysis of the Honey Bee Microbiome Reveals Four Novel Viruses and Seasonal Prevalence of Known Viruses, Nosema, and Crithidia

  • Charles Runckel equal contributor,

    equal contributor Contributed equally to this work with: Charles Runckel, Michelle L. Flenniken

    Affiliations: Howard Hughes Medical Institute, Bethesda, Maryland, United State of America, Departments of Medicine, Biochemistry and Biophysics, and Microbiology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Michelle L. Flenniken equal contributor,

    equal contributor Contributed equally to this work with: Charles Runckel, Michelle L. Flenniken

    Affiliation: Department of Microbiology and Immunology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Juan C. Engel,

    Affiliation: Sandler Center for Drug Discovery and Department of Pathology, University of California San Francisco, San Francisco, California, United States of America

    X
  • J. Graham Ruby,

    Affiliations: Howard Hughes Medical Institute, Bethesda, Maryland, United State of America, Departments of Medicine, Biochemistry and Biophysics, and Microbiology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Donald Ganem,

    Affiliations: Howard Hughes Medical Institute, Bethesda, Maryland, United State of America, Departments of Medicine, Biochemistry and Biophysics, and Microbiology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Raul Andino,

    Affiliation: Department of Microbiology and Immunology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Joseph L. DeRisi mail

    joe@derisilab.ucsf.edu

    Affiliations: Howard Hughes Medical Institute, Bethesda, Maryland, United State of America, Departments of Medicine, Biochemistry and Biophysics, and Microbiology, University of California San Francisco, San Francisco, California, United States of America

    X
  • Published: June 07, 2011
  • DOI: 10.1371/journal.pone.0020656

Reader Comments (3)

Post a new comment on this article

Virus Sequences

Posted by charlesrunckel on 10 Jun 2011 at 22:42 GMT

Hello everyone,

It seems that Genbank will not be releasing the sequences for the viruses until after the weekend. I'm pasting them below in case anyone needs them before them. My apologies, and please let me know if you have any questions regarding them.

Charles Runckel
DeRisi Lab - UCSF


>HQ871931 Lake Sinai virus 1 Orf1, RNA-dependant RNA polymerase, and capsid protein genes, complete cds
GGGAAGUUUACAGGCGUACGACUUCUUAGCAUCGGUUUCAUGUGGUUACUGGUAAUUGGCCGCAGGUCAUCCCACACAUCAUGGUUAAGCUUGCGUUUGCCGCCUUUGUGUCUCUUUACAUCAUAUGUCAGGUUCCUCCUAUUUCCUAUUGGAUUGAGGAUCUCAUUGAUGAUUUUGAUACAAUGUGCAGUCAUGAGUACGCUGCCGCAGAUGCUUACAAUAACUUCGUUCACAGACACCGCGUUGCUGCCUAUGCUGCUGGCGUGCGUAUCCACCGUUACCGCACGCCGUGGUAUUGCGCCGCGUCACGGUCUGUUCCGGUCGUCCAUCCUCUUAACUGGUUGAUGACCCAGUACGAUCUUACUACUGGCCAUGUUCGUGAAUUACUGGAUCGACUGGAGGUUGUCAAUGUUACCCUUCGUGAUGGCCUCCGCACUGUUGCUGACACUGCGUUUACAGCUUAUAUGUACUAUCAGAUAAUGUGGUGUCAGCUCGCACUGAUUGUGCUGCUUGUUGGCUUGUUCUCUGCCAUCAUAUGCUCCAGUCGUGUUAGGGUUGUCAGAGUGCGCAACCGUGUUCGAGGUUAUUCGAUCACCGAUUUGCGUAAUGAGUUUGAUGAAUCCACCUCGGACAUCACGUUGCCCCUGUCACGUGGUCACUCUUGCCUCAAUUUCCAGCGCCGUGUGGCCGAGUCCUGGUGCUUGGAUCAGUUGCUGCGUUAUUUCCAUGGUGUGCGUUUCAUCUCUGCCUCCACGGGACGGUGGGCCGAGCUUGGCCAUCGAAUUCACAGGUGCUCGCCGGUCGUCAUGGAUGGCUCUUUUGUCCCUGAGGCCACGCAUCAUGGCGUGUUGUGCCGGCGCCAGCCGUCUGCUUGCCGUGAUAGGUUUGAAAUUCCUGCGUGUGUUAUCAGUCAUGCUGAUUAUUACAUGUCGCCUGACCAGUUGGCCUCCACGGUUACUGGCCCCACCUUCAUUAUCAACCAUGACUACCUUGCCCCUGACUCAUUGUCUGUGGCUGAAGCCACAACUCGUGUCGCCAACGGCCAUGUUACUUCUUCAGUGCGUGAGGGGCCAAUUUAUGGGCCGCACCCGUAUUAUUUGUGGAAUAACGAGGGAGUUGUCGUGUCCUCUGCAGGCGCAUUCCGUUACUAUCGCGUUGGCCGCCUGUUUGACACCUCCGUGUAUUAUGCGUUUCCUGCUGCCGGUACGUAUUCUUGUGAUGACUCCACGAACUUGCGUAGGUCCACGGUUGGCGACCUUCAUUACUAUUCCCCUCAUGAAAAGAAAUUUGUUAGUUACUCAGCCGAUGACACGAACUACCAUGUGUUCGGCACGUCGGUGCCAAGGUCUCUUGCUGACUACUGCGCUGCAACCUUCUGCCGUUCUGCCCGUGACGACAAAUUUUAUGACGGACUAAGAUCUUAUUAUCAGAACAGGUGCAGAGCAAUUGGAUUCACCGAUGCCCGUGAUACCCUUAUUUUGGACUUCAUUAUCCAUCUGUGUGACGAGGCCAGUCUGAAGACCUUCGGUUUCUCCCGACUUUCCGUCGCACCAUCUUCUUGGACCGCUUAUUGUCUCUCGUGGCUUCUCGUCAAAGUGAACCACAUGAUGCCCCUGGCGCUCACGUCGUUUGUCGUUAGCGCUCUCCAUCGGUUCUUUGGGGCCAAGUCAGCCCCGUGGAACUGGGCAUCGAUUCACUUGCCCACGUAUGAUAUGGUCACGUCGCCUUUCCGUUUGCGUAUGUUCGGUCGUAACCCCACCACAUUCAAUCUGGAGCGAUUUCGUGCUGAGGCCUCGACUGUUGGUGCCCCCAGUCCUGGCCAGUCUGCCGAGGGUACCGGCGAAAACGGUGACCAACAUGAUAUCAAGCUUGGUGACCCGAGUCCUUCGACCAGUUCCGUCCCCUCACUCUCGUCUGGUGACUCCAUUGAAACGUCAGACCACUUACUAUUCGACAACCGAUCCAGGCCGGCUUCUGUCAACUCUCGCUCCACGAACACGCAAGCGAGCCGAAGUUCUGGAAUAUCGUCUAACAAGAGCAAAGCAAGGCGCAAGUCCCAUAGAUCUUCGCACGAUAACUCCGAUGCUGACCACGGCCACAGUGUUUGUCAUCCCAAGAGAACCACUUACCCAUUGUGCCCCGACCCGACUGCCUCGUGCGGACCUCAUUUCUUCAUGUCAGUGUGUGAGCAUGAUGAGUCAAUACCUACGGUGUUCCAUGCACACUCGGUGGGAGGUCAAGAUAUCACCCACGACAUUGAUUCAGGUUUGGGAGCAAUUAUAUCAAAACGCUUUAGUGCUUCGCAGCUACGCCUCCUUAGCUGGUCUAUCGACGGAAUACUCAACACUUUAUCUCGCGCCGCCACCUCAUCGUUUGUCGAAUCGUCGCUGUUGUCCUUGUUACGAUUUAUGCAACAAGUACCUGCAGUUGAGUCCUCUGCAGAAACUCGCCGGUGUCUUUUAUUUGGUGGCCCUAGAGAAAGAUUUAAGGGAUACGACACCUUUGACCUUGGAUUCAUGGGUGUCGCGGUACCCUCUGACAAGACAAAGGGAAUUGAGGCUUGCUUACGAGAGGUUGCACGGCAGCAUGCUCGUGCAGACGUCCCACACGAAGGUGCGUAAUUUUAUAAAGGUUGAGCCCAUGGCUAAGUGCUCAGACCCGCGGAAUAUAUCGCCUCGCAAUGACGCCACCCUUGCAACACUGGGACCAUAUUUUUCCGCGAUUGAGCAUCGUGCUGCGUCCCUUCCUUUUCUCGUUAAGGGCUGUGACAUCCCGGCCCGUUCCUCGAAGAUGUCUAGCCUGUUGGGCUGGCCUGACUAUUAUGAGAUUGAUUACUCCCGAUUCGACUUGUCUAUUAGUGCUGAAGUUAUUUCACAGUACGAGCAUGCCUGGGUCUCUCUUGUUUAUCCUCCUCUCAAUUACCCUGGCUUCUGGCAGACUCUCGUUUCGACACUCAUUACCUCGGGCUUUAGUGAGUACGGUAUUACUUACUCUUUGCCUGGGUCACGUUGUAGCGGUGACCCACAUACGUCCGUUGGUAAUGGUUUGCUGAACGGGUUCUUAACCUGGCUCGUUACUUUUGACAAGGACUGUUCUUAUUUCUGUGAGGGCGAUGACGGCAUUAUCGGUUGUUCUCCACCUAUCGGUGAUGAGAUCGAGAUCAUCCCUGAUUUAGGAUUCAUGCUGAAGAUAGAUCAUUACCACCACAUUAACGACUGUUCUUUCUGCGGUAUGUAUCUUUUGGAUGAUUCUGGCACUCUUGGCAUGUAUUCUGACCCGUUGCGCACUCUUUCCAAGAUCCAUGUUUGUUGCGCUGAUGGUCUUCCCAACAAUUUGAUUGUGGCCAAGGCGCUUAGUGUUCUUAACCUCAAUCCAGCCACUCCAAUUAUCACCGCAUUUUGCCGCCAUAUUCUGCGUGUUGUUCAUUCUAAAUUGCUUAACCCGCGAAAUCGUAACAGACUCACUGCUGCUGUAAAGCGGGUCUCGCCUAUUAUGGCUUAUAUGCCUUUCCAGACUGCCCCUGUGUAUCGUGAGCCCAGUCCCGAGAUGCGCGCCGCGUUCGCUGCGCGUACUGGCAUAUCUCCUGCGUUGCAAUGUCAGUAUGAGCAGUAUCUGCUCUCAUUAUUGUUUGUUCCGUCGCGUUAUGCCUUACUUAAACGAGACAUUGAGCUCGACGGCCUACAGACCACCCUUCUUGGCGACUUCAGGUCUGUUCUUUACGCGUGAACAUUAUAAAUUUACUAUCAUGAAUCAACAACAAAUGAACCCCGCGCAGCGAUCGUUGCGCCCCCGCGCUCAAUCUACUCCCUCUCGGUCCGCUCGACGACGACGCAAUCGUAGGCGCCGUAACCCUUCAACGCCUGCUGGUACGGUUGCAAUUCAACCGUCACGCAUCACUCGUCGAGUAGUUUCCAGUUUGGCCCGGCGCCCUCUCACCAUUACAACCGCCGGUUUGGCCUGGCUUCGGCAGUAUUUGAACCCUAUGGGCCCUUCUACAUCCAGUGUGAGUGGCUUUCCUGAUGGGUCUGCUGUUACCACAUGCAUUGCCGAUUACACCAACACAUUCAAUAUCUCUUUCCCUCCUCGUGAGGCGAUUUAUUGUACCGGUUCUAAUUCUGAUGAGAAACCUGUUAUGCUGGACGCCGCCACCUAUGCUAAGAUCGACGCGUGGACUAAGUCGGAUAUCACCUUGUGCAUACUCGCCUUGCCCAUGCUCCGCAAUGUGGUUAUGAUUCGCCUCUACGCUUCUACUCCGACCGCUUUCACAUUAAGCGAAGGAGUACCCAAUUUCGUCCAAAGAUUUCCUAAUUGGAGCGCCUUUACCACCGAGGGCAAGGUGCUUAAUAAUGGCGACUCACCCGGAUAUAUUCAGUCGUUUGUUUACCUGCCUAACGUGGAUAAACACCUCUCUGCCGCCCGAGGCUUUCGUCUUUUGUCUCGCGGUUUGACCGGCAUUUACACCGCUCCGUCCCUUGAAACUCAGGGAUUUGUCACCGCAUGUCAGUACCUUGCCGAGGGUGCGCUUCAAACCCAAACAGUCGGCAACGACUUUGUACAGUCUGUUGAGGUCAAUGCUGACAAGACCGUCAAGAACGUUAAUGGUAAACGUCUCCACUAUUCCGGACCUCCGAAAUUCGUGUUCCCGCUUGAGGGCGACAACUGUGCUCCCUCAUCCCUUGUGGAGACAUACCAUCAAGCUUACCAGGCUCGUGCUGUAGACGGAUUUUACAUGCCAAUCCUUUCUUCUUCCCGUGACAAUCCUUUCAUCUCCCCAAAACCACAGCCCAUAGCGGUGUUCAACCGCUGGUAUUACCGUGGUUGUCUCGAUCCAGUCCCUGCUUCCAAGGUCGCUGACGGACCUUCACAAUACUACUAUGAUCUUAACGUCGCCGACGACGUUGCUCCGCUUUACAAUACUGGUGUCGUGUGGAUGGAGGGUAUUUCUUCCAAGUUUUCUUUGAAGCUGAAGACCCGCACUGUCAUUCAGUAUAUUCCCACUUCAGGAUCGGUUCUUGCCAAUUUUACUCGGCAUGAGCCCACAUAUGAUCAGGUUGCUCUUGAUGCUGCCGAUCGUAUCAGAAACAUGAUGCCUCAUGCUUACCCCGCCGCUUAUAAUGACUGGGGCUGGCUUGGUGAUUUGCUCGACUCCACGUUGUCUAUGUUGCCUGGCAUCGGUACUGCUUAUCGCUUUGCCAAGCCCCUCAUCAAGCCGGCGUGGAACUGGCUUGGUGGCAAGGUCUCUGACUUCUUUGGCAACCCCGUGUCCCGUGACGGCGACAUUUAUUUCGAUGCUAAGUAACGGAGACGCAAUCUCUGGCUGUUAGAAAUCUUUGAUUUCGACAUGCCCAUCGUGCUUACUUUGUACGUUUUAUUUGUUAUUGUGUGGUUACUGGUAAUCAGUCGCAGACUGUUCCACACUAUGCCUACCAGAGGUUCUUAUAGUUCUAUGCUCGCCACAGAGUGUUUGAGAGCCCAACUCGCGYUGGCUCGGCAGGUCGCUGACUGCAU
>HQ871932 Aphid lethal paralysis virus strain brookings non-structural polyprotein and capsid protein precursor, genes, partial cds
CAUGGGAAUACCUAUUAUAUCACACACGCCAAAUUAAACAAUAUUUAAAUAACGCAUCUCACGGAAUUAUGGAAACACUAUCAGGAUUUUUUGGAAAAUAUUGGCAAUUUGUUAAACAAGCAGUUCUCGUUGGCUUAUCGGUGUUCAGCACAUAUAUGUGUGUGAAAGCAUCAUUCGCUUUAGGAGAUUACGUAAAAGGAAAGAUUAUGCCUAAGUAUAUAUCAGACGAUGACGAGAUGGCCCAACUUGUAAGUGAAGCUAACGCUUGCUUUGAGAAGGGUUGUCAAAAUUGUCGCCUAUGCAAAAAUGCGGCUAUGACACAAUUGAACGUAAAAUGGAACUCUGCUUGCUUAUGCUAUGUGAAACGUAUGGAAAAAGGAAAGGACAUGAUUAAUAAAUAUGCUAUUUCUCUUUAUGGUAAUCAGCGUGUAUCUAACAAUCACGAUUUAUCUGUUACUGACAUGGCUGACAUUAUCAACCAAGUUGCAGAUUGUGAUUGUAGUACAUGUGACUGCUGUAAUGACCCGGAACUAUUGGAUAAACUUACGAAUGUGGCUCAAUUACACAACACCAAUUGUGUGUGUCUGUUGACUCGUUUCUAUCAAGGAUUUAAGACUGCGGAUCUAUAUGAGAUGACAAAGCAACUAAAUGUUACUUUACCAUCUAUUAUUAAGAAUCCCGAAUUGAAACGACUAAUCGACUCACACGCAAAAGUGUAUGACAAUGCUGUUACACAACGUAGGAAUAACACUCGAAUUGUAGGACAUGGACCCACAUAUGACGCACGCCCUAGACAACGACAAAUGGCUACUCGAAUUGGAGCACAGGCCCCGGUAUAUGAUAACCGCGUUACAAUAAAGAAAAAUACUAUUGUAGCCGCGCAAAAUCUAUUACCCGCUUUUGCCAAAAUCGAGCCCAAGGAACAGGAAAUGGAAAUACAAACACGAACUGCUUGCAACGGAUGUAACAACUGCUCACCCAUCGACGCUCAACGAUCUCUACCAGAACAAGAUAAAGGCUCUAUAGUGAUCGCGCGUGAUGUUGUGUACAGGAAUUUAUUCCGUUUCACUGUUGUGUUAAGGACAGAGGAAGGCGAAAAACGACGUGGAUUUGGACAAAUAUUUAUGUUAGGCGGUCGAUUAGGUAUGAUACCGAAACACUUCCUUUCAGUAAUGGAACAUUAUGUAGAAACUUAUGGACAAGAAAACUGCUUCUUUGUAUUGGAAAAUUGUAGUAAUAGUAUAUCUCCAUUAAUACCAUGCUCUGUUAUUUUAACAGAAGAGAAUCACAUUCGUGAUGCUCACAGAGAUAUUGCUAUAAUACAACUCCCAACAAAUGUAGGUGGUUUUGCACAAGCUUACAAACACAUUAUUGACGAGACUGAUUUGGCCCGUGUAUCUGAUUCCCCUGCUAUUUUGGCGAGGUAUCAAGGUGCAUCUGAACGUGACAAGAAAACUGGAACUAAUUAUUACAGAGAAAUCUUUUGGUUAUCUACAGCAACCCCUGAAGACCACCUUGUUGAAAGCACGGUGCCUGAAGCUAAUGUUGUAGUACAUAAUCGUGGUUCUUACACAUAUCAUGCCGUGACCUUCUUUGGUGACUGCGGAUCGAUUUUAAUCGCAUCCAACGCCGCUAUAACAUCGAAGAUUAUGGGUAUGCAUAUUGCUGGAAUUACGCACAUGAACAAAGGAAUAUCUGUAGCACUGACACGACAAAUAAUUGACCGAUUGAUGAGACAUUUUCAACCAAUCAGCCAAUAUGGACACGAAAUUGUACCCCUGACUGUUAACCCCGAUAUUUUAAAAGACAACGGAACAUUUUUGAUCUAUGGAACUGAACCAGGUAGACGGAUUAUGGGAAGCGUUAAAACUGCUCUCCAAAAGUCCCCUGCCUAUGGAAAAUUGAUCGAAAGCCCAAAUAAACCUGGAUAUUUACGUGAAUUUAUAAAUGAUGACGGAAUUACUAUUGACCCUAUGACUUUACAACGGAAUAAAUAUGGUGUUGUUCGCCCGUACGUCCCACAAGACAGAGUUGAAGCUGUUUAUGAAGCAAUGAGUGUAUUCUAUCAACGAGAAUAUAUUAACUCACCUGCCCAUUACAAACUUCCACUUACGCGUGAACAAGCUAUUAUUGGAAUAAACGGAGACCCAUUCGUCAACGCCAUUAACCGUCAAACUGCUCCCGGCUACCCAUAUACAUAUGAGAAGGCUGGAAAGAGCGGAAAGACGAAAUGGUUUGGCGAUGGAAUGGAUUACGAUUUAAACAAUGAAGCAUGUAGAGAAUUGAUGGCUGAUGUAGAUGAGCUCGCCCAGUGCAUGAUCGAUAACGUUAGGCCUCGCAUUAUUUGGAUCGAUACAUUGAAAGAUGCUAAGAUCCCUAUCGCGAAAGCCAACGUAGGUAAAACUCGAUUAUUCACCGCUUGCCCACUACACUACACAAUUCUCUUCCGACAAUACUUUUUGCCUUUUAUUGCUCAUUCUAUGCGUAAUCGCGUGCAAAAUUCUAUUGCUGUAGGCAUUAAUCCAAUGUCACCAGAAUGGGACCUAUUAGCCAAACGUUUGAAGAAAAAUGGAAAACAUGUCAUUGCUGGAGAUUACUCUAACUUUGACGGCACACUCCCGGUACAAUAUGUUGAAGUUGCCGUGAAAAUUAUGGUCGACUGGUUUAUGAGAAGCUGGGACACCAUAGUUCGCGAAGAACGCAACAUUAUAAAUGGACACGAACUGACUUACGAUGAAUUUGAACAAUUUUUGAUGAAAAUUGGAGUCGAGUGCAUUAACCAUCUGCACAUAUCUAACCAUAAAAACGUUUCCGGUGCUGCUUUAAUAUAUUACGUUCGUAAUGGUAUUCCAUCUGGAUGCCCUGCGACUGCUAUAUUGAACAGUAUCGUAAAUCAUUGCUGUCUUGCUGAUUCUUGGCUAGACAUAAUGAAUGGAACGUCGUAUGCUACGAUGAACUCGUUUUUUGAGCAUACUUCGUCUAUUUUUUAUGGUGAUGACUUCAUAAUGAAUAUACGACCAGAGGUUAUUGAUGUUUAUAAUCAAGAAACUCUCACCCCGAUUUUGAAACGCAACCUGGAAAUGACUAUGACUGAUGAAGCAAAAACAGGAGAAUGUGUUAAAGCACGAACUCUUGAAGAAGUUUCAUUUUUAAAAAGGAAAUUUAGGUUUGAAUCUUUCGUAGGAUUGUGGGUUGCUCCAAUUGACAUUGAUGUUAUUUUGGAUGCACCUAAUUGGGUACGUGUUGGUAAUCAAUUACCUCUACGUAUCUGUGUUGACACAAUCAGCGGCGGAUUAACCGAACUGGCUAUGCAUGAUAAAUCCACGGAUUCAAAAUGGAGAUCUAAGAUGAUAAAUCUUGGUCUCGACUUGACCCGUGGUACUGGAAUUGAAUUUAACCCGGACUCAAGAUCAACCACGCUAUUGAAACUCAGAAAUGAGGAGCUUGGCGGAGAUUUUGAGGUUAAUUACUAAUUUGACCUUUAGAUUAUAAUGUUAGGACUAUAAAAAUUAAUUUAAUGCAUUUAGUAAUUUUAGGCUUAGUUAUUUAACUUUACUUAUCAAGAUGGCCGUUGGCAGCCCCACGAAAUCUAGAUUAGUCCGAAUGUCCUAUUUUGAUUAGGUGGUCAGAUAGGUCAGAAACUCACCUGCAAAUUUUCAAGAAACAAAUAUGACACAUGAACAACAACAAAUUCUUACUUUCUCUUCUGAAGGUAUGAUGCCCUCAACUAGUAUAUACACAGACCCAUUAGAUUUAGAUAUGUCAUAUCUAACAUCUGUAGAUGACGGUCGCAAUCACUCUAUCAUUGAUUUUCUUCAACGUCCGAUUAAUAUAUCAAAUGUUGAAUGGAAAACUACGGAUAACGCCGGCGCGACUUUAGUUGCCGUCGACCUACCGUUGGAUCCUAUACUGAAUAAUUCAAUGUAUAAAGCGAAAUGCGAACGUUUUUACGGAUUUAGAGCUGAUGUAGAAUUAAAAUUACAAGUUAACGCUCAACCCUUUCAAGCUGGGCGUUUAUUAUUAGUAUAUAUACCUGGAUAUAAGUAUUUAGGUGCAUCCCGACAAAAAUAUUAUGACGAUCGCACUAAUGUAGACGAUGCUAGUUUGGUGCCACUGACAGGUUCUCCACGAGUAGAUUUAGAUCUAUCAACGUGUACUGAAGCCUCAAUGUGUAA
>HQ888865 Lake Sinai virus 2 strain BruceSD_T17E01 Orf1, RNA-dependant RNA polymerase, and capsid protein genes, complete cds
GGCCGCAGGUCAUCCCACACACGAUGAAGGUUGUCUUCUUGGUUUCGUUUGCUGUGUUCCUCAUCUGUCAGGUCCCACCAGUUUCGUACUGGCUGGAGGAUGCGUUGGAUGAGUAUAACACGAUGUGCAGCUAUGAGUAUGCUGCUGCUGAGGCUUACAACAAUUUCAUUCAUAAGCAUCGCGUGGCCGCCUAUGCCGCCGGCGUCCGUAUUUUGCGCUACCGUACACCGUGGUACUGCUUUGCGUCACGAAGCGUCCCCGUAGUCCAUCCAUUUUCCUGGCUUAUGGGUCAAUAUGACGCCACGAUCGACCGCGUCGGCACGCUGAUGCAGCGACUCGAGAUCGCCAAUGUCUCGAUUUCUGACGGCCUUCGCACCGUCGCUGACACUGCUCUCAAGGCUUACUUCUACUAUCAGAUUAUUUGGUUCCAGCUCUUCUCGAUCAUCAUGCUGGUCGGUUUCUUUUCUGCUGUCAUCUGCUCUAGUCGUGUGCGUGUUGUUCGCAUACGUAACAGGGUGCGUGGUUACAGCGUCGCUGAACUGCGCUCCGACUUUGAGGAGAGUAUGUCCGCUAUACUGGCCCCCUUAUCUCGUGGACACUCUUGUUUGAACUUUCAGCGUCGUGUCGUCGAGUCGUGGGCCAUCGACCAAUUGCUUCGAUAUUUUCGAUGCUUUAGGUCUGUUGCGUCAUCACAGGGUAGGUGGGCGGAAGUUGGUCAUCGUCUCCACCGCUGCUCACCUGUUGUUAUGGAUGGCGCGUUCGUACCUGAGUAUGAUCAGCGUUUCAGUGCCUGCCGUCGUCACCCCUCCGUUUGUCCGGAUAGGUUUGAUACCCCUGCUGCGAUUCUCAGCCAUGUUGAUUAUUACAUGACUCCUGAUCAGUUGGCCGCAGCUGUGACCGGACCUACAUUCAUCGUCAAUCACGACUAUUCAUCCAUUGAUACCUUGUCCGUUGCCGAGGUAUCUUUACGGUCGGCCGGUGGGUUGGUCACUGCCAGCGUUCGUGAUGGGCCUACCUUUGGCCCUCACCCGUAUUAUCGCUGGUCCGACGAGGGGGUUGUGGUUGCUUCUUCCGGUGCGUUUCAAUAUUUCAGAAUUGGACGCCUGUUCGACACCACCCUCUACUACGCAUUUCCAACCUCUGGAACAUAUUCUCAGGAUGACCCUUCAGCUCUUCGCCGUUCCACCAGCGGCGACCUCCAUUACUAUUCCCCGCACGAAAAGCGCUUCGUCAGUUAUACAGCUGAUGACACUCAUUACCACGUCUUUGGCGUUUCCGUCCCACGUUCGUUGGCCGAUUACUGUGCAGCUACUUUUUGCAGAGCAGUUCGUGAUGAUAAGUUUUAUGACAGUCUGCGUUCUUACUACCAGAAUAGGUGUCGGGCCAUAGGGUUUGCCGACGCCCGCGACACACUGAUGCUCGACUUCAUCAUCCAUCUGUGCGACGACGCUAGCUUGCGUACUUUCGGCUUUUCCCGGUUGUCUUCCGCUCCUUCGUCCUGGUCAGCUUAUUGCUUGUCGUGGAUUCUGGUCAAGGUUAAUCAUAUGAUGCCACUGGCCCUCACCUCAUAUGUCUUGAAUGUGCUGCACCGCUUCUUCGGCGCUAAGGCCGCGCCGUGGAACUGGGCAACGAUUCACUUGCCAACUUAUGAUAUGGUGACGUCACCAUUUCGGUUGAGGCUAUUUGGGCGUAAUCCCACAGUCUUCAACCUUGAGCGAUUUCGUGCUGAGGCCACGGUUGUUGGUUCCCCCGAUCGUGGCCAGUCUGCCGAGGGUGCCAGCCAAGACCAUUACGAACAUGAUAUCAAGUCUUGUGACGCGAGUGCUGCGUCCAGUUCCUCUCCCACACCCCUACCUGGUGACUCCUCUACGUCGGGAUCAGUCUUAUUACUCGACGACACUACCGACCGAGUUCGUGUGGAUGACUCGUCCGCGAGAUCGACACCGGGCCGAAGUUCUGGAAUAUUGUCUAACAAAGGCAAAACAAGGCGCAAGUCCCAUAGACCUUCGCACGAUAACCCCGAUAUUGACCACGGCUACAGUGUUUGUCAUCCCAAGAGAACCACUUACCCAUUGUGCCCCGACCCGACUGCCUCGUGCGGACCUCAUUUCUUCAUGUCAGUGUGUGAGCAUGAUGAGUCAAUACCUACGGUGUUCCAUGCACACGCGGUGGGAGGUGAAGAUAUCACCCAUGUUGUUGAUCCGGCUCUGGGAGCGUCUAUAUCGCAACGGUUUAGCGCUUCGCAGUUACGCCUCCUUGGCUGGUCUAUCGACGGAAUUUUCAAUACUUUAUCUGGCGCCGCCACCUCGUCAUUCGUCGAGUCGACGUUGUUGUGCUUAUCACGAUUUAUGCGUGAAGUACCGCCAACUCAGCCCGUUACAGAAGCUCGCCGCAGUCUUUUAUUCUGUCGCCCUCGAGAGAGAUUUAGGGGAUACGACACCUUUGACAUUGGAUUCAUGGGUAUCGCGGUACCCUCAGGCAAGACAAAGGGAAUUGAGGCUUGCCUUCGCGAGGUUGCAAGGCAGCACUCUCGUGCAGACCUCCCAAACGAAGGUGCGUAAUUUCAUUAAGGUUGAGCCCAUGGCCAAGUGUUCCGACCCACGGAACAUUUCACCUCGAAGCGAUGCGACCCUUUCAACCCUUGGCCCUUAUUUUUCUGCCAUCGAGCAUAAUGCCGCUGGUUUACCCUUCUUAAUUAAGGGAUGUGACAUGGCGGCUCGUGCCGCCAAGAUGCGUGACCUCCUGGGUUGGCCUCACUAUUACGAGAUCGACUACUCUCGUUUUGAUUUGUCGAUAAGUGCUGAGGUCAUAUCUCAGUUUGAGCAUGCUUGGAUCUCGUUGGUCUACGCCCCCGACAUGCACCCGCUGUUCUGGCAGACGCUGGUCGCCACGUUGGUCACUUCAGGGUUUAGUGAGUAUGGCAUUACCUAUACCCUCCCCGGAUCGCGUUGCGGCGGCGACCCUCAUACGUCUGUCGGCAAUGGCAUCCUCAACGCGUUCCUCACAUGGCUUGUCACGUUUGAUAAGAGUUGCUCUUAUUAUUGUGAAGGUGACGAUGGGAUUAUUGGCUGUGCUCAGCCUAUUUGCGAUGAGAUUGAGAUUAUACCGGACUUGGGCUUCAUGCUCAAGAUCGAUCACUAUGAGCAUGUCGACGAUUGUUCGUUUUGCGGUAUGUACUUGCUGGAUGAUCGUGGAUCGCUCCGCAUGUACUCUGACCCGGUGCGCACACUGUCUAUGAUACAUGUGUGCUGCGCCGAUGGUCUACCCAACAAUUUGAUCGUGGCCAAGGCUCUGAGCCUUCUCAAUCUGAAUCCAUGUACCCCCAUCGUCACAGCCUUUUGUCGUCACAUAUUGCGCGUAGUUCGGUCCGUGUUGCUUAAUCCGCGAAACCGUAACAGACUUGCUGCUGCCGUUAAGCGUGUUGCUCCGUGGRCGGUUUAUUUUCCGUUUAGUUAUGAACCGUUCCACUCUGAACCAACUCCAGCCAUGCGCGCUGCUUUCUCGGCGCGCACAGGUAUAUCUCCUGCCUUGCAGAUAUCGUACGAGCAGUAUCUCCUCAAUUUAAAAUAUGUCCCCUCUACUUACCGCUAUCUCAAGCGCGAUCUCGACAUUGACGGUGUCCAUACCGCGUUGUUGGGUGAGUUUAGGUCUGUUCUUUACGCGUAAUUAAUAGAAAUUAUCACGAUGAAUCCACCAACUACGACUACGACUACGACGCGCACCAUCCGCGCCCCAAAAGUUCAACUGACGCCCAAUUCUGCUACUCGGCGUCGGCGUAAUCGUCGGCGCCGUCGACCUGCCGCUGCUAUUGCCGGGCCUUUAUCCAUUCAGCCUUCGUCUAUUAAUAGGCGUAUGGUGUCCAGGGUCACCAGGAGGUCCGCCGUUGUUACUGCGGCUGGUCUAGCGUGGCUGCGUCAAUAUCUCAACCCCAUGGGUCCCGACACAACCAGUGUUACAGGCUACCCCGAUGGUUCUGCUGUCACCACAUGUAUCGCAGAUUAUUCCAACACGUUUAAUGUGUCUUUCCCGCCCAGGGAGGCUCUUUAUUGUACUGGGUCCUCUUCUUCGGAAAAGCCUACCCUUGUCGACGCUGAUAAUUAUGCCAAGAUAGACAAGUGGUCCAACUACGACAUCACGCUAUGCGUGCUUGCACUACCCAUGUUGCGCAACGUUGUGAUGCUUCGUCUUUACCCGCAUACCCCUACCGCUUUCGCCCUUACUGAGCAGACUCCUAAUUUUCCUCAACGUUUUCCCAACUGGAGUGUUUACUCCGCUGAUGGUACCCGGUUCAACAACGGCGAUGAGCCUGGUUACCUUCAGUCCUAUGUUUACUUGCCGAACGUUGACAAGCACCUUUCUGCUGCCCGGGGAUACCGCUUACUGUCCCGCGGCAUCACUGGUAUCUUUAGUGCUCCUGCUCUUGAGACUCAGGGAUUCGUCACAGCUUGCCAGUAUUUGGCUGAGGGGUCUAUACAAUCUCAGUCCAUUAAGUCUGACGCUGUUCGAUCCGUCACUGUUAACAGUGAUGGUACUGUUAAGAACGUUGAGUCUAGCUCACAAACAGUUUCGUCUAUGCCCCGAUAUGUGUUCCCGUUAGACGGAGAUAAUUGUGCUCCGUCGUCCCUCACUGAAACUUACCAUCAAGCCUAUCAGUCUAAGGCUACUGAUGGAUUUUACAUGCCUGUGUUAUCAUCAUCGAGGGACAAUCCCUUCCACCCGCCACAGCCCAGGGCCAUUGCAGUUUAUGGCUCUUUCUUGGCUAGGGGUUGCCUUGACCCUGUUUCGGAAGCCCACGAGGCUGAUGGCCCAACUCAUGACAUUUACCGUUUGAAUGUUGCCGAUGAUGUGGCACCAUUGUUCAAUACCGGCGUCGUAUGGUUUGAGGGCAUCUCACCUAAAUUUUCUCUCAAACUUAAGACUCGAACUGUAUUGCAAUAUAUUCCCACCUCCGGCUCUGUCUUGGCUAACUUCACCAGACACGAGCCUACUUACGAUCAGAUAGCGCUCGAUGCUGCUGAUCGUCUGCGUAACCUGAUGCCUCACGCUUACCCUGCCGCAUACAACGAUUGGGGAUGGCUUGGUGAUCUGCUCGAUUCUGCCAUCUCCAUGUUGCCGGGUGUAGGUACUGUGUAUAACAUUGCCAAACCACUCAUCAAGCCUGCGUGGAACUGGCUCGGAAAUAAGGUGUCUGAUUUCUUCGGAAACCCGGUGGCUCGUGACGGCGACAUCUUCUUUGACGCUAAGUAAUCGGAGGCGUAAUCUCUCGGCGCUAGAAAUUUAACGAUUUCGAUAUGCCAAGUAUCUUGACGUUGUAUUUCGUCUUUAUUGUAGUGUGGUUACUGGUAAUCAGUCGCA
>JF423195 Big Sioux River virus isolate BSRV1 nonstructural polyprotein gene, partial cds
GAACGUGACGGCUUCGAUUAUGCAAUCAGAUAUGCCAGCUAAUUUAUUACCCCAACUGAGAGAAUUAUUUUGUACCUCAACAGCUCAGUCUGCUUCCAUUGAUGGACAACUAGUACUAAGACUUUUAGCUUUGUGCUCGUUUUCAUUGAUGGUUAGUAAGAUACCAACUUCUAAAGACAUUGAUAUUUUUAUCAAUCGUCUUGAUCGAGUUCCAAAAGCACUGAGUGGCAUGGAGAGUAUGUGGAAACGCAUAGACUCCGUGUCAACUGUACUAUGGAAUUGGAUGGAAGUAACUGUGUUGAAGAGAGAAGGAGUGAUUCCUCGAUCUGAUAUCCUUGAUUCUGUUUCUAAGUGGGCCAAUGAACUUAGUCGUUUGUUGACCCUAGCUUCUCGAAGAGAAAUCCAGAGAGACGUUGRAACCUUGCAUGCUGCAGGACGGAUGUAUUCUGAAGGAAUACGCUUAAUGAAGCAAUGUAAAGAUUUGAACCUUAGUAAGGGAAACAUGGAAAUCAUCGCCCGAAAUUUACCAGCYGCUAAACUCUUGUUAGACGAAGCUAAUAUGAGUGGAGCRGAUAGAUCAAAAYUCVGGACUGAACCGUUAAUCGUAUGGUUUUCAGGUGCUUCUGGVAAHGGAAAAUCAGGGUUAUCAUAUCCUUUCAUCUUAGACAUGAUGAGAGUGUAUGGUGAUCCUCCUGAUACAUGGCAACAAAAUGUAUACGCCCGCGUGCCCGAAACUGAGUACUGGGACGGCUACAUUAACCAAGAAUACAUUAUUUAUGACGAUUUUAUACAAAUUAAAGAUUCACAACUUAAACCAAAUCCUGAAUUAUUUGAAAUGAUUAGAUUAGGAAACAUGUUCCCUUAUCAGUGUCAUAUGGCAUCAAUAUUGGAUAAAAACAAUACUUUUGCUGAACCAAAAUUAAUAUGUUUAACAUCAAAUUUACGAAGAUUGCAAAUAGAGUCAUUGAAUUGUCCCGAAGCUGUAUCGCGUCGUAUAGAUUACGCUUUUAAUGUUCGUAUCAUCCCAGAAUACCAAAUGGAAUAUACGGAUGCUAAUGGCGAUAGGCUAUAUAGAUUAGAUGCUGCUAAGGCUCGUAGAGAUUUUGGUGACGUUUUAUGUUUUGACGUCUACCGAUUCGACAUGUUUGAUGCAUCUAGUAGAGUAUUUUUACAGACUGAUUUGACUUACACUGAAAUGGUUGAGUUAUGUCAACGGAAAAUGAAAGAUAGAGCAACAGAUUUUUACGAUUUUGCUAGCUUUUUAGAAACGUACAGGAAUAAGGGAGKCGCUCAAGUAGAGAAACUCAAGCAUGAAACUGUACAUUUUGAUAUAACAGAUGAUUACUCUCCAGAAUAUAAUGGACAAACAAUGGAGUUCACAUCAACCGCGCAAGUAGGAAUUUCGGAAAUUGUUUCUGAAAUAUCACCUCBUUCCACUUUACUCGAACGCAUAUAUUGGAGGACCUGUAAGAG
>JF423196 Big Sioux River virus isolate BSRV2 nonstructural polyprotein gene, partial cds
AACUACAGCACCUGGAUAUCCUUAUUCUCAACAGCGGAAAGGUAAGAAAGGUAAAACGUUAUGGUUUGGAGACAGUAUGGAAUACGAUCUUACUGGACCUGACGCGCUUAGGCUGAAAGAUGAUGUUAUUAAGUUGGAAGCUAAUAUAUUAAAAGGCGAAAGACCCGAAGUUGUUUGGACUGACACCCUUAAAGAUCAAAAAAUAGCCAUAGCUAAAGCUAACCUUGGUAAAACGCGCCUAUUUUCUGCAGCGCCUAUGCAUUAUGCAAUCGCAUUGCGGAAAAUUUGUGCGCCUUUUGUAGCUCACUUAUCACGAAUGCGCAUACGUAAUACUAUUUGCGUAGGUGUAAAUCCUUUUUCCACUGAAUGGGGGGAGGUAGCACGAAAAUUGAGUACAAAGGGUCGAGACGUUAUAGCUGGCGAUUAUUCUAAUUUUGACGGGACGUUACCAGCACAAUUUGUAUAUGCUGCAACAGAAAUCAUGGCCGAUUGGUAUGAUUUGAAUUGGGACUUUGUAGAAGCUCACAAACGCAAUUAUAUCGCGGGAGUAGAGCUAAACAAAGAUCAAUUUUUACUAUAUUGUAGAAAAUUAUAUUAUGAAUGUGUACACCAUUUGCACGURACUAAUUAUGAUUCUGGAGCAUUAUUAUACUAUGUCCGAAACGGCAUACCUUCAGGGUGCCCCGUCACUGCACCCCUUAAUUCCAUAGUUAAUCAAAUGGCCCUCAUAUAUUGUUGGUUUAAGAUAUACGAAGGAAGUGACAAAGCUAGUGUGAAAGAGUUUUUUGAACAUACCUCGAGUGUUUUUUAUGGAGAUGACUUCGUAAUGAACAUUCGAGCUGACGCUA
>JF423197 Big Sioux River virus isolate BSRV3 nonstructural polyprotein and structural polyprotein genes, partial cds
GAAAUUGACAAUCGUUGGCGUCCAAGAAUAACGCAACUGGGACUCAAGGUUACUGAAUCUAUACCAGGAGAGUUGUUUAUACCUGACACUAGGUAUGCAACACUUUUGGCGAUAAAGAAUCUUGAAACAGACAGUUUAGAAUGCUUAGAUAGUCUAAGUUGAGAACACCUCUACUGGGUCAUCCCGAGCCAUAGGCCGGUCUACCAGCAAGUGAACCCUCACUAAUCUAAUCCUCUUCUAUAAAAUCUGUUAUAAUCGUAAGUGUAGUCUAAUUAAGAGAACGCUCUGCAGAGUCAACCCGUUAAUACCGGUCCAUCUGUAUCGUAAACUCUUAGUAACAUGAACGAUUAUGUUAACAUACACGUAGAUAGCAUAGUCUUAUUUGAAGAACGCUCUACUGGGUCAAUCCGUUAAAACCGGUCCACCAGCAACGUAAACUUCAUUCAAUGAAAGAAGCGUGUAUAUAAAACAAACAAAAUUGCUACAAUGUGAUCUUGUGCAAUAAAUGCUGACGUGAAAACGUUGUACAUUGCUAUUGUAGUUGGUUAGCUAUUUAGCUUUACUCAUCAAGACGCCUGAGUGCAGCCCACCAAAGUCUAGAUACGUCACAAGCGGCAGAGCAUUAGGUCGUGCAUGUUGCUCAAAAUUGACCUGCUAAUAUACAAGAAAACAAAUCAACAACAACCCAACAACAAAUAUUAUCAUUUAGCUCAGAAGGUGAAGCACCGCGUUCCCAAACUGUUUCAAAUCCCUCUAAACUUGACAACCCUUUAUUAGAUUGUGCUCGUGAUGGAAAGACUCACACAGUGACAUCCUUCCUUGAACGACCUAUUAACUUUAGGACUGCAAGUUGGGGUAAUCAAGCGGCCGGAACGCGAUUAACGUCAUUCAACUACCCUUCUGACGUAGUCAAAAAUACCAUGUAUAGUAGAAAAUUACAAAAUUUUUUAGCUUUGCGAGCUGAUUUAGUUGUGCGUGUUCAAGUGAAUGCCCAACCAUUUCAUGCUGGCAGGUUGAUGCUAUCAUGGACU
>JF423198 Big Sioux River virus isolate BSRV4 structural polyprotein gene, partial cds
AACUAUUCUACCGUAGUUGACUUACGAUCUGAUACCGAUGUUGAAUUUAACUUACCAUAUGUUGCAACUGUACCUUGGUUACACGUUAAGGAAAGUCCGUGGACUGGCUCAUUUAAUCAAACACAAGUUUGUGGAGCUGUCCAUGUAGAAGUUUUGAAUGAACUUGUUAAUACAUCAACAGUAUCUGAUUCCGUUGAAGUUUUAGUUGAGGUUUGUGGUGCAGAAGAUAUUGAGUUUGCUAUACCUAUUCAGCCCAAUUUGACACCACGCGCGAGGCCAGCCACUACACGCACACGUAACGUUAUGCGUAUGUUGACCAAUAGCGUGGCACAAGUUGGUACUGAUACGGGCGAUACUCCUUCGGAGCAAGCGCGGGUAGAACCAACCAAUUUUUCUGAAGUACCACUUCAGCCAAAAGCUACUACUUAUAAUGAAGCAAUGUUGACGAUGGGAGAAAAAGUAACAUCUUUUAGACAAUUAAUUAAAAGAUUUCACAUGUUAACACCAUCAACUGAAGAACGGUAUUGGAAUUUUAGUAAACCUUUUUGGAUUAACCCCAAUAAAUUUGUCGGUACAACCUUAGAAGGAACUAAUGAUCUAGAUUCACUUUCGUGGUUUGCCUCUUUGUAUGCUUUUUACAGAGGUUCCACGAGGGUGAAAAUCGCUCCAAUAAAUAAAACCGGGCCUAUGCAAGUUUUGUUAAAACCCACUUACCUUUAUGGUAAUGGGUCUAUUAUAGAACCUGAUACAACUUGGCCAAGAGUUGAUGCUCGAGGCGCUGAUGUUUUCUUACCGCGCACCGAAGGGAUAUACGAGUUAUCGUUUCCUUACUAUAGCUCUUACCCUGUAACUCUUACAACAUACAACGCUACUAAUUCUGAUGUUUUGGAUGCGAGAAACGGUUUCAACCGCGCUAUUGCUACUUUUCACGAAGAUACACAAGCUUACGUUUAUAGAGCUGCAGGUGAUGACUUUAGUUUUGGAUUUCUCUUAGGU
>JF423199 Crithidia mellificae isolate GAPDH glyceraldehyde phosphate dehydogenase gene, partial cds
GAGAUCGACGUGGUCGCCGUGGUGGACAUGAGCACGGACGCCGAGUACUUCGCGUACCAGAUGAAGUUCGACACGGUGCACGGCCGCCCGAAGUACACGGUGGAGGUUGCGAAGAGCUCGCCUGAGGUGAAGAAGCCGGACGUGCUCGUGGUGAACGGCCACCGCAUCCUGUGCGUGAAGGCGCAGCGCAACCCGGCGGACCUGCCGUGGGGCAAGCUCGGCGUGGAGUACGUGAUCGAGUCGACCGGCCUGUUCACGAACAAGGCGAAGGCCGAGGGCCACGUGAAGGGUGGCGCGAAGAAGGUGGUGAUCAGCGCGCCGGCGUCUGGCGGCGCGAAGACGAUCGUGAUGGGCGUGAACCACCACGAGUACGACCCGGCCACGCACCAUGUCGUGUCGAACGCGUCCUGCACGACCAACUGCCUGGCCCCGAUCGUGCACGUGCUGACGAAGGAGAACUUCGGCAUCGAGACCGGCCUGAUGACGACCAUUCACUCCUACACGGCGACGCAGAAGACGGUGGACGGCGUGUCGCUCAAGGACUGGCGCGGCGGCCGCGCUGCUGCGGUGAACAUCAUCCCGAGCACGACUGG

No competing interests declared.